according to the graph........

According To The Graph........

Answers

Answer 1
I would say the best answer is a but the whole thing is set up weird
Answer 2

The solution is:

H(w) gets very small when w gets very large .

What is graph?

In mathematics, the graph of a function f is the set of ordered pairs, where {\displaystyle f(x)=y.} In the common case where x and f(x) are real numbers, these pairs are Cartesian coordinates of points in two-dimensional space and thus form a subset of this plane.

Here, we have,

Considering the graph H(w),

As w gets larger, H(w) continues to approach a horizontal asymptote.

we know that,

A horizontal asymptote of a graph is a horizontal line y = b where the graph approaches the line as the inputs approach ∞ or –∞. A slant asymptote of a graph is a slanted line y = mx + b where the graph approaches the line as the inputs approach ∞ or –∞.

Hence, H(w) gets very small.

Therefore, the correct option is option D

Hence, The solution is:

H(w) gets very small when w gets very large .

To learn more on graph click:

brainly.com/question/17267403

#SPJ2


Related Questions

what are vertical angles? give an example.

Answers

THERE YOU HAVE IT


HOPE THAT HELPS!!

When a transversal is perpendicular to two parallel lines, all the angles formed measure 90°. Explain why.

Answers

When two parallel lines are cut by a transversal, due to the natures of the different relationships among the angles, all of them will be either equal to the measure of the first angle or equal to that angle subtracted from 180.  If the transversal is perpendicular to the parallel lines, forms a right angle, then both the angle given and the angle subtracted from 180 will be 90.  This means all of the angles will be 90.

Final answer:

When a transversal intersects parallel lines perpendicularly, all angles formed are right angles (90°). This is due to perpendicular lines creating right angles and the angles at the intersection points being equal in measure because of the corresponding angle postulate.

Explanation:

When a transversal is perpendicular to two parallel lines, all the angles formed measure 90° because of the geometric properties of parallel lines and transversals. A transversal is a line that intersects two or more lines at distinct points. In the case of perpendicular transversals and parallel lines, the angles formed are called right angles.

If we consider two parallel lines, like railway tracks, they never meet and are always the same distance apart, maintaining a 180° straight line angle between them. A transversal that is perpendicular to these lines would intersect at points which lie along the x-axis if we consider the parallel lines to be along this axis. By the definition of perpendicular lines, the angles formed at the intersection points are 90°. As there are two intersection points on each parallel line, and due to the corresponding angle postulate, all four angles formed are equal in measure and hence are all right angles.

This can also be understood by considering vectors in physics, where if two vectors are perpendicular to each other, they form a right triangle, indicating a 90° angle between them. Knowing that parallel lines crossed by a perpendicular transversal produce angles of equal measure, and by the property that perpendicular lines form right angles, we can conclude that all angles formed in the described scenario are indeed 90°.

Consider the scatter plot.


Which choice best describes the association?



Positive association


No association



Negative association

Answers

your answer negative linear and heres why :D

negative linear is a line with dots that are mostly straight but go down

positive is when a line is going up DOES NOT have to be PERFECTLY straight

no associate is when its NOT straight AT ALL

please help the temperature in degrees fahrenheit can be estimated by counting the number of times a cricket chirps in one minute write an algebraic expression for the following written expression
the number of chirps divided by 4 added to 37

Answers

you will need to multiply then round to the nearest hundred

Factor completely; 100-9x^2

Answers

Answer:
(10 - 3x)(10 + 3x)

Explanation:

This type of question yields what is called a difference of squares, which is recognizable because of the subtraction (-) operation between the two terms of the binomial. When questions like this are seen, the formula for difference of squares can be implemented. This formula is:

(a² - b²) = (a - b)(a + b)

With this, we can square root both terms of the original binomial and plug our variables for a and b into the formula.

Let 100 = a², let 9x² = b²

√(100) = 10
√(9x²) = 3x

Those values are now a and b, respectively, so when we place them in their spots in the formula, the completed factoring is: (10 - 3x)(10 + 3x)

To check this answer for accuracy, we can use the FOIL method and combine like terms to see if it gives us the original equation. FOIL stands for Firsts, Outsides, Insides, and Lasts, instructing us which terms should be multiplied together so:

Firsts: 10(10) = 100
Outsides: 10(3x) = 30x
Insides: -3x(10) = -30x
Lasts: -3x(3x) = -9x²

We place them in the same equation and combine like terms:
100 + 30x - 30x - 9x²
100 + 0 - 9x²
100 - 9x²

We are back to our original equation so the answer of (10 - 3x)(10 + 3x) is accurate.

What is the product of the two solutions from the quadratic formula?

Answers

c/a

This is a standard formula you need to know in order to solve. 
The answer is the third option.

[tex] \dfrac{c}{a} [/tex]

You need to know this standard formula to solve the equation.

Hope this helps. - M

Margie has a $50 budget to purchase a $45 pair of boots if there is an 8% sales tax rate then how much under budget will Marjorie be

Answers

Boots + (Boots * Tax %) < $50 budget

$45 + ($45 * 8%) < $50
45 + (45 * 0.08) < 50
45 + 3.60 < 50
48.60 < 50

Subtract the total boot cost from the total budgeted amount.

= 50 - 48.60
= $1.40 under budget


ANSWER: She will be $1.40 under budget.

Hope this helps! :)
Sales Tax = 8% x $45 = 0.08 x 45 = $3.60

Cost of Boots with Sales Tax = $45 + $3.60 = $48.60

Amount left = $50 - $48.60 = $1.40


Answer: $1.40

Are the following figures similar? Rectangles ABCD and EFGH are shown. AB equals 5. BC equals 25. EF equals 3. FG equals 15. Yes; the corresponding angles are congruent No; the corresponding angles are not congruent Yes; the corresponding sides are proportional No; the corresponding sides are not proportional

Answers

The correct answer among all the choices is C) Yes; the corresponding sides are proportional. This is the correct answer because the corresponding sides have a similar relationship of 1:5. We can see this relationship when dividing 25 by 5 & dividing 15 by 3, since their both equal to 5, we know the figures are similar. I hope I answered this question to your satisfaction. Have a good day!

Answer:

Yes; the corresponding sides are proportional

Step-by-step explanation:

If two figures are similar, the lengths of their sides are proportional.  This means if we set up a proportion with the sides we are given and cross-multiply, we get a true statement at the end of it.

Using the similarity statement ABCD~EFGH, we will compare AB to EF and BC to FG:

5/3 = 25/15

Cross multiply:

5(15) = 3(25)

75 = 75

We got a true statement, so the sides are proportional.

(Photo) Pls help me!
The 3 sections of a game spinner are numbered 1 to 3. Which tree diagram shows all the possible outcomes for 2 spins?

Answers

C, there are 3 options the first time, and after that, there are 3 options for each of those. So it would be C.

The tree diagram shows all the possible outcomes for 2 spins C is correct.

We have given that,

The 3 sections of a game spinner are numbered 1 to 3.

We have to determine, which tree diagram shows all the possible outcomes for 2 spins.

There are 3 options the first time and after that,

There are 3 options for each of those.

So it would be C.

To learn more about the spinner game visit:

https://brainly.com/question/27567805

#SPJ2

Math- finding the volume of the triangle. Please show work, I am very confused

Answers

Volume of a triangle: 1/2(2b × h)
The 1/2 and 2 cancel each other out, so it's just b × h.

Area of base: 8 × 8 = 64 cm²

Height: 12 cm

64 × 12 = 768

The volume of the triangle is 768 cm³.

suppose you have a 100 millimeter cup a 300 millimeter cup and a 500-milliliter cup list two different ways you can measure exactly 1 liter

Answers

Hey there!

I will list out five ways for you, so you can choose either two.

1st way :
One 500 milliliter cup
One 300 milliliter cup
Two 100 milliliter cups

2nd way :
Two 500 milliliter cups

3rd way :
Three 300 milliliter cups
One 100 milliliter cup

4th way :
Ten 100 milliliter cups

5th way :
Two 300 milliliter cups
Four 100 milliliter cups

Hope this helps. - M

Which relations represent functions ?

Answers

Answers 1 and 3 are functions.

Answer: First and third

Step-by-step explanation:

A function is a special kind of relation between two variable such that each input corresponds to exactly one output.

In the given pictures, the first and third picture are representing function  because each input corresponds to exactly one output.

In second and fourth picture one input value corresponds to two output values.

i.e. a corresponds to 25 and 55 and x corresponds to 7 and 5 in output.

In two or more complete sentences, compare the number of x-intercepts in the graph of f(x)=x^2 to the number of x-intercepts in the graph of g(x)=-x^2. Be sure to include the transformations that occurred between tye parent function f(x) and its image g(x)

Answers

The graph of g(x) = -x^2 is a reflection in the x-axis of the graph of f(x) = x^2. Both graphs have one x-intercept as both graphs have their vertices at the origin, (0,0).

Find vertical and horizontal asymtope for (x^2+2x-48)/x+8

Answers

There are none.

[tex]y=\dfrac{x^{2}+2x-48}{x+8}=\dfrac{(x+8)(x-6)}{x+8}\\\\y=x-6[/tex]

The expression describes a straight line with a hole at x=-8 where it is undefined.

What fraction makes the equation true?

2/3 x blank = 8/12

Answers

So, find x to complete [tex] \frac{2}{3} [/tex]x = [tex] \frac{8}{12} [/tex]
But, since 8/12 is already equal to 2/3, this means:

x=1
Its 1!! Hope This Helps

what is equivalent to
[tex]13 - \sqrt{ - 81} [/tex]

Answers

√- 81 doesn't result in a rational number because you can't get a negative from squaring any number. Instead you get a number with an imaginary number. 

13 - √- 81 = 13 - 9i

The equation y – 9 + 9 = –17 + 9 is an example of which property of equality?

A.Substitution Property of Equality
B.Addition Property of Equality
C.Reflexive Property of Equality
D. Symmetric Property of Equality

Answers

you add 9 to both sides to get:
y – 9 + 9 = –17 + 9

so it's Addition Property of Equality

answer

B.Addition Property of Equality

Answer:

addition property of equality

Step-by-step explanation:

The equation y – 9 + 9 = –17 + 9 is an example of which property

A.Substitution Property of Equality:

In this property we substitute some particular value for the variable.

B.Addition Property of Equality

This property states that when we add any number to one sides of the equation we do the same on the other side

y – 9 + 9 = –17 + 9

In the equation , 9 is added on both sides of the equation. So it is an example of addition property of equality

C.Reflexive Property of Equality

Reflexive property states that the number is equal to itself

D. Symmetric Property of Equality

It states that if a=b then b=a

The speed that a tsunami (tidal wave) can travel is modeled by the equation where S is the speed in kilometers per hour, and d is the average depth of the water in kilometers. A tsunami is traveling at 140 km/hr. What is the approximate average depth of the water?

Answers

Answer:

The average depth of the water will be 0.155 kilometers or 155 meters.

Step-by-step explanation:

The speed at which the tsunami waves travel is [tex]S=356\sqrt{d}[/tex]. Here S is the speed in kilometers per hour and d is the average depth of the water in kilometers.

Now, it is given that the wave travels at the speed of [tex]S=140\rm km/hr[/tex].

So, the average depth of the water will be,

[tex]S=356\sqrt{d}\\140=356\sqrt{d}\\\sqrt{d}=0.393\\d=0.155\rm km[/tex]

Therefore, the average depth of the water will be 0.155 kilometers or 155 meters.

For more details, refer the link:

https://brainly.com/question/14242193?referrer=searchResults

Answer: c

Step-by-step explanation:

0.155 km

jeffs water bill includes a base charge of 12.00. plus a charge of 1.50 for each 1000 gallons of water used. his water bill is 28.50. how many gallons of water did jeff use?

Answers

ok u have to subtract 28.50 from 12 that is 16.50 and then u divide it by 1.50 then multiply the dividend that's your answer. I belive its 11,000 gallons.
Final answer:

Jeff has used 11,000 gallons of water. We find this by subtracting the base charge from the total bill and dividing it by the cost per 1000 gallons.

Explanation:

The water bill that Jeff receives is made up of a base charge of $12.00, plus an additional charge of $1.50 for each 1000 gallons of water used. From the given information, we know that Jeff's bill came to $28.50. To find out how much water Jeff used, we first need to subtract the base charge from the total bill which gives us $16.50. Now we divide this number by the cost per 1000 gallons, which is  $1.50. Therefore, we can say that Jeff used 16.50 ÷ 1.50 = 11 units of water. Since 1 unit refers to 1000 gallons, Jeff has used 11,000 gallons of water.

Learn more about Water Consumption here:

https://brainly.com/question/13125895

#SPJ2

Change to decimals and put in order of smallest to biggest
7/5 3/8 5/9 3/16

Answers

7/5=1.400
3/8=0.375
5/9=0.556
3/16=0.188

0.188, 0.375, 0.556, 1.400
3/16, 3/8, 5/9, 7/5

Data Set 1 has a mean of 84 and a MAD of 6. Data Set 2 has a mean of 78 and a MAD of 8. What can be concluded about the two distributions?

Select each correct answer.

A. The distributions are somewhat similar.

B. The means-to-MAD ratio is 1.

C. The means-to-MAD ratio is 0.75.

D. The distributions are similar.

Answers

Answer: The actual answers are: "The distributions are similar." & "The Means-to-MAD ratio is 0.75." I took the same test and got it right. I hope this helps anyone reading this. :D Thanks!

~H*****

Answers are C. The means-to-MAD ratio is 0.75. and D. The distributions are similar. hope it helps

How is the expression (5 + y) ⋅8 described by its factors and terms?

A) It has two factors and the factor (5 + y) has one term.
B) It has three factors and the factor (5 + y) has one term.
C) It has three factors and the factor (5 + y) has two terms.
D) It has two factors and the factor (5 + y) has two terms.

Answers

The correct answer is D) it has two factors and the factor (5+y) has 2 terms.

The factors are what are multiplied to make the expression.  In this expression, (5+y) and 8 are multiplied, so those are the 2 factors.

The factor (5+y) has two terms, 5 and y.

Any help if possible Thank you ❤

Answers

[tex]v = \frac{1}{3} \pi {r}^{2} h \\ r = 8 \: cm \\ h = 15 \: cm[/tex]
From the diagram, we can see that the radius of the cone is 8cm and the height of the cone is 15cm. We then just plug these numbers into the formula and simplify:
[tex]v = \frac{1}{3} \pi {r}^{2} h \\ v = \frac{1}{3} \pi {(8)}^{2} (15) \\ v = 320\pi[/tex]
The volume of the cone is approximately 1005.3096 cm^3. With 3 sig figs, this is 1010 cm^3.

PLEASE HELP! In college, you earn credits for courses taken. For each semester, tuition at a local college is $2400, plus $184 per credit. You have financial aid that will cover $5,160 for the semester. How many credits can you take without spending any of our own money?

Answers

15 because 5,160-2400=2,760, then 2760/184

perimeter with radius 14

Answers

[tex]360^o-150^o=210^o\\\\\dfrac{210^o}{360^o}=\dfrac{7}{12}[/tex]

[tex]P_{LQM}=\dfrac{7}{12}\cdot2\pi\cdot14=\dfrac{7}{3}\pi\cdot7=\dfrac{49\pi}{3}\ cm[/tex]

[tex]P_{QRP}=\dfrac{1}{2}\cdot14\pi=7\pi\ cm[/tex]

[tex]P_F=\dfrac{49\pi}{3}+7\pi+3\cdot14\approx\dfrac{49}{3}\cdot\dfrac{22}{7}+7\cdot\dfrac{22}{7}+42=166\dfrac{2}{3}\ cm^2[/tex]

David and Terri drove a small motorboat down a river with the current. The rate the boat traveled in still water was r miles per hour, and the current’s average speed was   c miles per hour. It took them 1.5 hours to travel 4 miles downstream. Which of the following equations can be used to represent this information?

Answers

speed of boat r mi/hr
speed of currect c mi/hr
speed downstream (c+r) mi/hr
but
distance= 4miles
time=1.5 hours
thus
speed=distance/time
hence:
4/1.5=(c+r)
thus
4=1.5c+1.5r
hence the answer is:
4=1.5c+1.5r

which angle is coterminal with 153°

Answers

It will be:

Positive Cotermintal Angles - 513 & 873
                        
and
Negative Coterminal Angles -  -207 -567

To find a coterminal angle with 153°, we can either add 360° to get 513° or subtract 360° to get -207°, both of which have the same terminal side as 153°.

To find an angle that is coterminal with 153°, we add or subtract multiples of 360° to the original angle. Adding 360° to 153° gives us 513° as one such coterminal angle. Subtracting 360° from 153° provides us with -207° as another coterminal angle. Both of these angles have the same terminal side position as 153° when plotted in standard position on a coordinate system.

Math question, I appreciate ANY help! :D

Answers

Radius = Diameter ÷ 2 = 33 ÷ 2 = 16.5 cm

[tex]\text{Volume = } \dfrac{4}{3} \pi (16.5)^3 = 18,816.57 \text { cm}^3[/tex]

For what value of p,-4 is a zero of the polynomial x square-2x-(2p+3)

Answers

we have that
x²-2x-(2p+3)

if -4 is a zero of the polynomial
so
for x=-4
x²-2x-(2p+3)=0----> (-4)²-2*(-4)-(2p+3)=0-----> 16+8-2p-3=0
21-2p=0
2p=21
p=21/2-----> p=10.5

You have two exponential functions. One function has the formula g(x) = 5 x . The other function has the formula h(x) = 5-x . Which option below gives formula for k(x) = (g - h)(x)?

k(x) = 10x
k(x) = 5x + 5-x
k(x) = 5x - 5-x
k(x) = 2(5x)

Answers

Hmm it would be k(x)=2(5x) or it could be k(x)=10x

Hope this helps!

g(x) = 5x

h(x) = 5 - x

k(x) = (g - h)(x)

k(x) = g(x) - h(x)

k(x) = 5x - (5 - x)

Hence, the correct option is k(x) = 5x - 5-x


Other Questions
What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure Summarize the narrative Churchill present Read this timeline:1975: federal election commission (fec) is established2002: bipartisan campaign reform act (bcra) is passed2010: citizens united v. fec is decidedwhat process do the events in the timeline reflect? Read this newspaper headline: Congressman Pushes Immigration Agenda Which change to the wording of this headline would make it more neutral without changing the overall meaning? A.Congressman Opposes Immigration Agenda B.Congressman Forces Immigration Agenda C.Congressman Advances Immigration Agenda D.Congressman Retracts Immigration Agenda Simon, come and clean up this mess at once for you(be)in trouble How did thomas jefferson purchase expand the president's power?