After presenting groups of research participants with words like thread, eye, pin, syringe, sewing, sharp, and thimble, a memory researcher asks the participants whether they remember seeing the word needle. the fact that many participants do is an example of __________.

Answers

Answer 1
I would feel this represents "grouping by association". Naturally, we lump things together and create a reasonable order. All of the items listed are things used for sewing or stitching. If we add a needle to the scenario, only makes common sense

Related Questions

Theodore roosevelt's presidential candidacy as a member of the progressive party is an example of a ________.

Answers

It is an example of splinter party. A splinter party is where a small group or an organization is likely to be separated or broke off with a group that they used to belong to which is in a large group and that they have created a small one of their own.

Which is not a class characteristic of a suspect's sneakers?

Answers

Shoe prints and ect.... I not sure i dont really understand this question but i maybe the answer.

When grocery shopping with his mother, 4-year-old hakim sometimes throws temper tantrums if his mother refuses his requests for a particular snack food. parent-training experts would suggest that his mother should:?

Answers

If consulted to a parenting training expert based on the scenario above, the mother who is grocery shopping with a child that is throwing tantrum because he can’t get what he wants is that the mother should ignore the tantrums of the child and continue shopping because this is a way of disciplining their child.

According to wundt and titchener, reporting what you sense, think, and feel is called:

Answers

Introspection - apex

The correct answer is introspection.

Introspection is the examination of one's own thoughts and feelings. It means observing one own's mental state which many believe means examining  the souls as well.

It is the process of looking inward and reflect on our emotions and memories.

This research technique was first developed by the psychologist Wilhelm Wund. His technique involved training people to carefully and objectively as possible analyze the content of their own thoughts.

Edward Titchener was a student of Wilhelm Wund. He was interested in the individual components that comprises conscious experience and he developed the psychological theory of structuralism.

Consider these two statements: 1) the patterns of physiological responses differ among the emotions; 2) however, people are not always very sensitive to these patterns of responses. based on this information:

Answers

Based on the information given above, statement 2 is true and accurate since it is consistent with the two factor theory of emotion. The two factor theory of emotions states that emotion is grounded on two factors and these are the physiological arousal and cognitive label. This means that when an emotion is sensed, a physiological arousal happens and the person uses the close environment to look for emotional signals to tag the physiological arousal. 

According to harding, what is the only reliable weapon that men have against women?

Answers

According to Harding, the reliable weapon of the men have against women is the man's private part or the part of the body that is used for mating in men. It is because he has proposed that the men's private body part can assert to things that would be use as a weapon in women in some cases.
Final answer:

The passages do not directly answer what Harding believes to be the only reliable weapon men have against women, but they suggest historical patriarchal control and maintaining traditional roles as strategies men used against women's autonomy and progress.

Explanation:

The question appears to reference historical views on gender roles and the dynamics between men and women as perceived during certain periods of the past. However, the provided passages do not explicitly state what the "only reliable weapon that men have against women" is according to Harding. The closest interpretation within the context of these passages highlights the patriarchal tactics used historically to control and subjugate women, suggesting that control, discipline, and delegating women to traditional roles of femininity and beauty might have been perceived as the 'weapons' men used against women's advancement and autonomy.

Signs of such tactics are visible in the passages, which discuss the historical roles of women and men and the reaction to women moving into spheres traditionally reserved for men. However, one could argue, based on the tone of some provided texts like the advancement of women, that enlightenment and equal rights would ultimately overturn such 'weapons'. The passages hint at a society grappling with the changing roles of women and men's reactions to these changes.

"central route persuasion is most likely when people"

Answers

Central route persuasion is most likely when people are naturally analytical.
It means that the person is persuaded by the content of the message rather than some other not-so-relevant cues such as somebody's attractiveness (which occurs with the peripheral route persuasion). What is said in the message is analyzed and then used to persuade the person.

Powerful evidence from comparing iq test scores in many nations over time has shown that younger generations score higher because of:

Answers

The technological changes that we are experiencing in human society. With a little device that many carry in their pockets, individuals have the power to reach out to someone on the other side of the world. We are immersed in culture and ideas from around the globe. We have more opportunity to gather knowledge and use this knowledge, applying it to our general intelligence.

As a listener, you have the ability to process words much faster than you generally need to while the speaker is sharing information.
a. True
b. False

Answers

the answer is. a. True

Research finds that there is one decided advantage to cohabitation. what is it?

Answers

The one decided advantage is It helps people save money by living together.
By living together, we could cut all the fixed cost (such as renting price of the apartement) and divided into several cuts.
Not only that, cooking in large quantity also saved us a lot of time and money to avoid wasted ingredients.

Final answer:

The main advantage of cohabitation is that it allows individuals to delay marriage, contributing to an increase in the median age for first-time marriages. However, cohabitation does not significantly affect the likelihood of a successful marriage. Attitudes toward cohabitation have become more accepting, potentially decreasing the urgency to marry.

Explanation:

One decided advantage to cohabitation is that it allows couples to delay marriage, which can contribute to an increase in the median age at which individuals enter into matrimony. Research indicates that cohabitation has little to no effect on the success rate of a marriage. Specifically, those who do not live together before marriage have slightly better rates of remaining married for over ten years. Despite the fact that many couples see cohabitation as a trial run for marriage, approximately 28 percent of men and women cohabitated before their first marriage, and almost half transition into marriage within three years.

Furthermore, attitudes towards cohabitation have changed over time, leading to an increase in the number of couples who live together before or instead of getting married. The societal acceptance of single parenting and cohabitation has grown, and thus the motivation to marry may be less compelling for some individuals. On the contrary, for children, being raised in a home with married parents as opposed to single or never-married parents generally leads to more financial and educational advantages.

Mead claimed that the origin of the self is found in _______

Answers

The answer is social experience. 

Hope this helped! :)


in what way do penguins not resemble other kinds of birds?

Answers

Penguins are not like birds because they don't fly.  Instead, they have small little arms. They can waddle and swim. hope that helped

Why do the results of zimbardo's prison study not lead to a firm conclusion?

Answers

The results of Zimbardo's prison study do not lead to a firm conclusion for two reasons:
a. First of all, the experiment was intended to go on for two weeks. However, due to the experiment going out of hand, it had to be stopped within 6 days. This was because many of the people who were paying the role of prisoners started getting hit and abused. Some  even developed psychosomatic rashes, others started suffering from other psychological disorders.
b. Many critics believe that the results were not very reliable since Zimbardo himself was part of the experiment (he  played the role of the prison warden) and could have influenced the direction of the experiment.

According to the text, what explains why many teenagers are thrill seekers?

Answers

To have fun during their teenage years// peer pressure
Hey there,
Many teenagers are thrill seekers as their prefrontal cortex is not yet mature 

Hope this helps :))

~Top

Four-year-old rex goes with his family to new york city. when rex returns to his preschool, he volunteers to tell the class about his trip. rex's memory of this personally meaningful, one-time event is known as

Answers

Rex's memory of this personally meaningful, one-time event is known as "Autobiographical Memory".

Autobiographical memory is a memory framework comprising of scenes remembered from a person's life, in light of a blend of long winded (individual encounters and particular articles, individuals and occasions experienced at specific time and place) and semantic (general information and realities about the world) memory.

What were the major achievements of the government under the articles of confederation? its major problems?

Answers

The major downfall of the Articles of Confederation was simply weakness. The federal government, under the Articles, was too weak to enforce their laws and therefore had no power. The Continental Congress had borrowed money to fightthe Revolutionary War and could not repay their debts.

Which importation was most important to the Egyptians? enslaved persons wood gold salt

Answers

I am pretty sure the answer is wood.

Answer:

Option B.

Explanation:

wood, is the right answer.

Ancient Egyptians had unique methods and styles for their artwork, varying from brushed hieroglyphics, to rock sculptures, to sculptural, wooden sarcophagi. But, Ancient Egyptians did not have advanced materials or tools that are easily accessible to modern artists. However, they began using natural resources such as wood and stone shipped some materials and created other items such as paint and stone weapons. Though they used the wood and other materials available in their land, they had to import wood for some big items which include boats and sarcophagi. Accordingly, they import wood such as ebony from central Africa, fir from Syria, cedar from Lebanon.

Drinking five or more alcoholic drinks at a sitting is called

Answers

Hey there,
The answer is binge drinking

Hope this helps :))

~Top

According to wollstonecraft, the problem with studying at home is that:

Answers

Final answer:

According to Wollstonecraft, the problem with studying at home is that historically, women were not given the same opportunities for education as men, leading to distraction from societal expectations for women to focus on domestic and maternal responsibilities.

Explanation:

The problem with studying at home, according to Wollstonecraft, is that historically, women were not given the same opportunities for education as men. Until the 19th century, women were not allowed to attend college in representative numbers, and even then, only a few wealthy women had access to higher education. This meant that women were often distracted from pursuing their own studies by societal expectations of focusing on domestic and maternal responsibilities.

In the early 1800s, many people in the United States migrated westwards because

Answers

In the early 1800s, many people in the United States migrated westwards because of the availability of farmland.

I hope this helps you!

Answer:

B) of the availability of farmland.

Explanation:

During the 19th century, many settlers moved into the American West influenced by the availability of farmland that was fueled by the Louisiana Purchase, the Gold Rush, the Oregon Trail, and Manifest Destiny.

All of these aspects influenced people to believe that moving west was going to bring them and the nation a new life. The land was cheap during that time and people received reports that the West was a land of opportunity with gold, solver, fruitful land.

Our ability to learn by witnessing the behavior of others best illustrates:

Answers

observational learning

The human ability to speedily recognize familiar objects best illustrates the value of:

Answers

Parallel processing.

Which model of the internal social structure of the city explains that a city grows outward from a central area in a series of five rings, like the growth rings of a tree?

Answers

The answer is the concentric model
the concentric model was first created by a sociologist named Erness Burgest in 1925. This model divided each areas into several zones depending on their functions. He proposed 6 different zones for his initial model, which are:  Commuter zone,  Residential zone , Working class zone , Zone of transition  ,Factory zone , and Central business Zone

The Concentric Ring Model, proposed by Ernest Burgess, describes a city's growth in outward circular rings from a central business district. This model categorizes different zones based on social class and housing quality, affecting where urban residents live within the city.

Concentric Ring Model

The model that explains that a city grows outward from a central area in a series of five rings is called the Concentric Ring Model. This model was introduced by sociologist Ernest Burgess in 1924. It theorizes that urban development occurs in circular rings which emanate from the central business district (CBD) at the core. The CBD, labeled Zone A, is typically characterized by high business density and few residential areas.

Surrounding the CBD is the Zone of Transition, or Zone B, which includes industry and lower-quality housing. Beyond this is the Working-Class Housing in Zone C, the middle-class Residential Suburbs in Zone D, and the outermost Commuter Zone or Exurbs in Zone E. This model envisions urban residents naturally sorting themselves into these concentric rings based on social class, occupation, and cultural assimilation.

Cities like Columbus, Ohio and Indianapolis, Indiana are suggested to follow this model, especially those that developed in areas without significant physical geographical constraints that might affect their outward expansion.

What were some of the main features of advancing industrialism in the west?

Answers

The main features of advancing industrialism in the west was the invention of rail roads, telephone, camera, electricity and so on. In short it lead to technological advancement.

________ are patterns of behavior that are accepted as normal and to which an individual is expected to conform.

Answers

I believe the answer is Social Norms, but I can't really be sure because I don't really remember my vocabulary... might be better to check with other people as well, but that's my answer :)

One should know who represents him in his various governments. True/False.

Answers

true it is good to know who represents you because you want to know if they are representing your values...
the answer is True, good luck

The Fourth Amendment states that a reasonable search and seizure must

Answers

the fourth amendment states that a reasonable search and seizure must include a warrant and be based on probable cause.

God bless!

Final answer:

The Fourth Amendment requires that searches and seizures be reasonable and backed by a warrant supported by probable cause. Landmark cases have clarified these protections, extending them to situations where an individual has a reasonable expectation of privacy.

Explanation:

The Fourth Amendment of the United States Constitution protects citizens from unreasonable searches and seizures. It requires any search or seizure to be carried out under a lawful warrant issued upon probable cause, which must be supported by Oath or affirmation and particularly describe the place to be searched and the persons or things to be seized. The warrant is a legal document signed by a judge allowing the police to conduct a search or seizure.

In landmark cases such as Mapp v. Ohio and Katz v. United States, it was established that evidence obtained in violation of the Fourth Amendment is inadmissible in court, and that the protection against unreasonable searches and seizures applies wherever an individual has a "reasonable expectation of privacy." New Jersey v. T.L.O. extended this protection to public school students, allowing school officials to search based on "reasonable suspicion" rather than probable cause.

Why were colonial assemblies and colonials courts created

Answers

They were created so that they could keep laws in the colony.. Making sure that there was structure in the town.

Colonial assemblies and colonial courts were created to manage local affairs and provide a level of self-governance. These institutions allowed colonists to make decisions without waiting for directives from England, which was often slow due to the distance. Additionally, they gave colonists a sense of participation and representation in their government, and they were instrumental in dealing with day-to-day issues and local disputes.

Colonial assemblies and colonial courts were established primarily because of the challenges and logistics of managing the colonies from afar. The significant time lag in communication between England and the colonies made it impractical to wait for responses on local matters. Thus:

They allowed immediate decision-making on issues that required quick resolution.Colonial assemblies often mirrored British political structures but were adapted to meet local needs.More colonial men met property qualifications to vote, thus fostering a direct connection to government decisions.Assemblies had to be responsive to the needs of colonists to maintain public support and stay in office.Colonial courts handled local disputes and legal matters, ensuring the administration of justice in the colonies fairly quickly.

These institutions not only empowered the colonists but also helped in developing a political culture and governance system distinct from England, laying the groundwork for future independence.

In erikson's theory, the conflict of toddlerhood, __________, is resolved favorably when parents provide suitable guidance and reasonable choices. industry versus inferiority initiative versus guilt basic trust versus mistrust autonomy versus shame and doubt

Answers

Final answer:

In Erikson's psychosocial development theory, the conflict of 'autonomy vs. shame and doubt' is critical during toddlerhood (ages 1-3 years). Toddlers need to feel that they can control their environment and make choices to develop a sense of independence. Parents can support this by offering suitable guidance and allowing reasonable choices.

Explanation:

In Erikson's theory, the conflict of toddlerhood is autonomy versus shame and doubt. This stage occurs typically around ages 1-3 years when toddlers begin to explore their world and learn that they can control their actions and the environment to achieve results. They start to express clear preferences for things like food, toys, and clothing, marking the "me do it" stage, where a growing sense of autonomy is observed. For instance, a 2-year-old child might insist on choosing their clothes and attempting to dress themselves. While their outfit choices might not always be appropriate, their involvement in such decisions significantly impacts their sense of independence.

If toddlers are denied the opportunity to exert control over their surroundings and make choices, they may start to doubt their abilities, leading to feelings of low self-esteem and shame. The resolution of this conflict favorably depends on parents providing suitable guidance and reasonable choices, thus fostering an environment where the child feels supported in their attempts to act independently.

How do people start to treat jonas now that he is the new receiver?

Answers

Final answer:

When Jonas becomes the new receiver, people start treating him differently, with a mix of respect, fear, and curiosity.

Explanation:

When Jonas becomes the new receiver in the book 'The Giver', people start treating him differently. The receiver holds a special position in society as they are the one who receives memories of the past. As the receiver, Jonas is respected but also viewed with a certain level of fear and curiosity by others. People may not interact with him in the same way as before, as they know he carries the weight of the community's memories.

Learn more about Treatments towards Jonas as the new receiver here:

https://brainly.com/question/37459465

#SPJ12

Other Questions
John Adams Alien and Sedition Acts influenced the election of 1800 because can someone plz help me. Which of the following best describes the Battle of Britain? A. The bombardment of northern France to prepare for a British invasion of continental Europe B. The German sea landing on the southern coast of Britain C. An air battle above the English Channel to prepare for an invasion of Britain D. The sea battle between German U-boats and British battleships Why did the united states get involved in the korean war? what was the outcome of the war? By establishing this link between the levels of cooperation observed in _____ with local forest conditions, rustagi et al. have increased the confidence that scholars can have in the external validity of results from previous experiments carried out all over the world, with student and nonstudent subjects. Refer to landing service. because the company is known for its ability to produce lawn furniture more efficiently than any other company in the world, the company must have a(n) ____ advantage. If the mass of an object increases, the force acting on it, such as gravitational force, also increases. A manufacturer wants to implement a trade sales promotion. Which of the following would apply?A. Offering retail stores a 10% discount on their productsB. Offering mail-in rebates to consumers who purchase their productsC. Distributing coupons through newspapers for "buy one get one free" offers on their productsD. Purchasing television ads that promote the enhanced style of their products why did the catholic church feel threatened by the heliocentric theory of the universe A subway ride for a student costs $1.25. A monthly pass costs $35.Write an inequality that represents the number of times, x , you must ride the subway for the monthly pass to be a better deal. 10 lb____64 oz (equal to, greater than, less than) What is the primary mode of transportation for Manaus 1.9r+0.1r=0.6 what s the value of r which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer