Analyze the stanza from Lewis Carroll's "You Are Old, Father William" poem and determine which metrical foot Carroll uses. "You are old, Father William," the young man said, "And your hair has become very white; And yet you incessantly stand on your head - Do you think, at your age, it is right?" 
iambictrochaicanapesticdactylic

Answers

Answer 1

Answer:

The metrical foot Carroll uses in the poem is ANAPESTIC.

Explanation:

The metrical foot Lewis Carroll uses in the "You Are Old, Father William" poem is ANAPESTIC. Anapest is a poetic device defined as a metrical foot of three syllables in a line of a poem wherein the first two syllables are short and unstressed, followed by a third syllable that is long in quantitative meter and stressed in accentual meter.


Related Questions

Which section addresses concerns about high numbers of unwanted pets?
A) Section 3
B) Section 4
C) Section 5
D) Section 7

Answers

Answer:

C) Section 5

Explanation:

I quote from the passage (that is what people were asking for in the comments)

"because of the abundance of homeless animals, pet owners who wish to have their animals cloned are unlikely to adopt an animal from a shelter."

This shows that the passage is talking about unwanted pets saying that those who clone are likely not to adopt when there is so many pets that need homes, by bringing this to attention they show concern for the high numbers of unwanted pets in the section of the passage.

Hope this helped!

Have an amazing day!

Section 3 of Chapter 7 deals with the moral responsibilities of pet ownership and directly addresses concerns about high numbers of unwanted pets. So, A is correct.

The section that addresses concerns about high numbers of unwanted pets is Section 3. This section of Chapter 7 titled 'Pets / Companion Animals; Zoos, Hunting, Racing, and other Uses of Animals' is focused on the moral responsibilities of keeping pets, which includes discussion on shelters, adoption, and the management of unwanted companion animals. Addressing these concerns is significant as it deals with ethical decisions and humane treatment of animals.

Which of the following details from the passage best helps the reader picture the setting?
A.
I looked closely and saw intricate symbols carved into the sparkling black stone.
B.
Absorbed with my own thoughts, I didn't realize that Jasper had stopped until he called my name.
C.
I watched the trail so that I could avoid the tree roots and large rocks that dwelt in the pathway.
D.
Without talking, Jasper and I walked in a rhythmic, steady pace.
SENSORY LANGUAGE

Answers

C.) I watched the trail so that I could avoid the tree roots and large rocks that dwelt in the pathway.

A setting describes the time, place, and/or circumstances in which an event takes place.   "C" uses imagery to help the readers imagine the place in which the characters are at.  At first glance, the answer seems like it could be "A"...however, instead of describing the setting, "A" actually describes an object.

Does the passage best help the reader picture the setting?

The correct answer is Option C. I watched the trail so that I could avoid the tree roots and large rocks that dwelt in the pathway.

Describe the tree roots and large rocks that dwelt in the pathway?

The settings describe when, where, and/or the status of the event. The "C" uses an image to allow the reader to visualize where the character is. At first glance, the answer looks like an "A", but the "A" doesn't really represent an environment, but an object.

A long time ago, a very old man and his wife were hunting alone ... crouching over a tree and looking like an old stump.

Learn more about the tree roots and large rocks here

https://brainly.com/question/17168794

#SPJ2

Read the details from a Sioux Indian legend. A little girl owned a pet rabbit, which she loved dearly. She carried it on her back like a babe, made for it a little pair of moccasins, and at night shared with it her own robe. Which statement best describes the details and identifies the theme of the legend? The details teach readers a lesson, revealing the theme "living things require constant care." The details show how the characters interact with each other, revealing the theme "sharing can lead to new friendships." The details explain something about nature, revealing the theme "living things need protection." The details show how a character treats nature, revealing the theme "we must take care of the things we love."

Answers

Answer:

D: The details show how a character treats nature, revealing the theme "we must take care of the things we love."

Explanation:

I just took the test and this was the correct answer.

Answer: D

Explanation:

What is the definition of a statement of the writers viewpoint

Answers

Answer:

A statement or belief that the author wants to support or prove. ( Also called the MAIN POINT, CLAIM or AUTHOR'S VIEWPOINT in an argument)

Explanation:

Use the drop-down menus to identify how the reader's
emotions change during the story.
The reader feels
during the story
when each new cat is bigger than the last one.
The reader feels
when Martin
speaks and runs out the door with a chair stuck to his
backside.
That timber cat walks over and sits down in the fire. Just
like the other cats did it. And he picks up this live coal.
And he puts it right on his slanted, green eyes. He dusts
his eyeballs with it! And he turns around to the other cats
sittin on each side of John.
The timber cat says to the other cats, says, showin his
teeth, "What you want to do with him there?" And looks
straight dead at John, too.
And the other cats say right back all in one meow, "We
better wait till Martin comes."
With that, John gives a great heave up. The chair comes
up with him. But at least he was up. And he runs out the
wide-open front door. He's callin as he goes out flyin,
"Mister Cats! You tell Martin I was here, but I couldn't
wait on him. And now I'm gone!"
And he was. Long gone. And never seen in that county
since.

Answers

Answer:

the first one is anxiety & fear

the last one is relief & humor

sorry for the late answer .

:)

Answer:

the first one :anxiety and fear

the second one: relief and humor

Explanation:

did this assignment on EDG 2020

What kind of literary device is the author using in this excerpt: "Training was a crucible, and it transformed Phil's crew. They would not all live through what lay ahead, but the survivors would speak of their good fortune in serving among such skilled men. They worked together with seamless efficiency, and judging by their training scores, in the grim business of bombs and bullets, there was no better crew in the squadron." (62)

Answers

Answer:

inspiration is the answer

Read the excerpt from Neil deGrasse Tyson's "Death by Black Hole.
All parts of your body are moving toward the same spot-the black hole's center. So while you're getting ripped apart
head to toe, you will also extrude through the fabric of space and time, like toothpaste squeezed through a tube.
Read the excerpt from Billy Collins's "Man Listening to Disc."
This is not bad-
ambling along 44th Street
with Sonny Rollins for company,
his music flowing through the soft calipers
of these earphones,
Which of the following ideas is presented in both excerpts?

Answers

Answer:

- The human body is being moved along by an outside force.

Explanation:

'Death by Black Hole' authored by Neil deGrasse Tyson details the significance of our senses in advancing the scientific understanding while Billy Collins's 'Man Listening to Disc' discusses the sensory impressions evoked through music('jazz').

As per the question, the key idea that is being discussed in both the given excerpts would be 'the human body is being moved through an outside force('black hole' in the first and 'music' in the second). The idea is clearly reflected by the phrases 'parts of...body moving towards the same spot' and 'music flowing through the soft calipers.' Both the authors have excellently employed 'imagery' to provide a sensory experience to the readers how the human body is being dislocated by the external forces.

Answer:

B) the human body is being moved by along by an outside force

Explanation:

No time to explain, just answer it

Which statement best captures Zimbardo’s point of view regarding the Abu Ghraib prison abuses?
A.
Zimbardo condemns the perpetrators of these crimes, arguing against them.
B.
Zimbardo excuses their behavior based on his own Stanford Prison Experiment.
C.
Zimbardo does not justify their actions, only explains how these abuses likely developed under certain conditions.
D.
Zimbardo argues that the guards of Abu Ghraib had no motive and though legally responsible they are psychologically blameless.

Answers

Answer:

B

Explanation:

I believe this is the answer because he know's what it's like in the jail from his OWN experience.

Answer:

Explanation:I found the options for your question and the correct answer would be: Zimbardo does not justify their actions, only explains how these abuses likely developed under certain conditions.

Zimbardo who is actually a highly respected psychology professor at Stanford University does not justify the action of soldiers at the prison but gives us the explanation for their behavior. He argues that the certain social conditions and the relationships between the soldiers contributed to their behavior. The influence of those more authoritative soldiers most likely played a major role in addition to the fear, boredom, stress and exhaustion along with no accountability and supervision as well as the lack of training. 

Read more on Brainly.com - https://brainly.com/question/9351043#readmore

In the story, the author explores how people
crie author explores how people can view the same situation very differently.
How can literature help us understand a varie
ature help us understand a variety of perspectives? What is another book that
you have read that provided you with a new and interesting point of views

Answers

The correct response is - Even while you have the right to be furious, you don't have the right to be cruel. Before spitting life out, he consumed it. My mother makes an effort to come across as cool by claiming to share all of my interests.

What is a perspective?

The practice of painting or drawing a subject in such a way that the things in it appear to be far away and to have depth. the way a thing or one of its pieces is perceived mentally. puts the problems in context.

She was astonished by his viewpoint when he talked. She had an intriguing viewpoint that caused him to rethink certain concepts. She undoubtedly appreciated his viewpoint more than he did. As it turned out, Carmen and Senior Medena both saw the issue similarly.

Having perspective enables us to see things from several angles and take into account the beliefs, experiences, and points of view of others. This improves our comprehension and empathetic capacity. It lessens prejudice, condemnation, and conflict.

To read more about perspective, refer to - https://brainly.com/question/25467203

#SPJ2

Select the best choice from each drop-down menu
What is the conflict in this passage?
What theme is best shown by the conflict?
There, as the whirlpool drank the tide, a billow
tossed me, and I sprang for the great fig tree,
catching on like a bat under a bough.
Nowhere had I to stand, no way of climbing,
the root and bole being far below, and far
above my head the branches and their leaves,
massed, overshadowing Charybdis pool.
But I clung grimly, thinking my mast and keel
would come back to the surface when she spouted.
And ah! how long, with what desire, I waited!
till, at the twilight hour, when one who hears
and judges pleas in the marketplace all day
between contentious men, goes home to supper,
the long poles at last reared from the sea.
-The Odyssey

Answers

Answer:

Odysseus vs. Nature

Patience has its rewards

Explanation:

I took the course on e2020 :)

Final answer:

The conflict in this passage is the protagonist's struggle to hold on to a fig tree while being swept away by a whirlpool. This represents the theme of survival and perseverance. The passage is from The Odyssey.

Explanation:

The conflict in this passage is the protagonist's struggle to hold on to a fig tree while being swept away by a whirlpool. This conflict represents the theme of survival and perseverance in the face of adversity. Despite the protagonist's desperate situation, they clung to the tree with grim determination, hoping for rescue. This theme is a recurring motif in The Odyssey, as the hero Odysseus faces numerous challenges and obstacles on his journey back home.

Learn more about Conflict and Theme in The Odyssey here:

https://brainly.com/question/9181113

#SPJ2

2. Choose the word that best defines the italicized word from the novel Frankenstein.
**Is it not a duty to the survivors that we should refrain from augmenting their unhappiness by
an appearance of immoderate grief?

creating
increasing
mocking
reducing​

Answers

Answer:

Increasing

Explanation:

The word 'augment' as used in the passage can best be described with the word 'increasing'.

From the excerpt, the question is asked owing it to survivors not to AUGMENT (Increase) their sorrow by excessive grief.

From the passage, we can infer that the speaker doesn't want to open new wounds for the survivors as it seems like they remember their sorrow and grief all over again when people begin to display much grief about the sad situation that befell them.

Final answer:

In the context of the sentence from Frankenstein, "augmenting" means to make something greater by adding to it, thus the word that best defines it is "increasing".

Explanation:

The question relates to the novel Frankenstein and asks to choose the word that best defines the italicized word in the provided sentence. The sentence is: "Is it not a duty to the survivors that we should refrain from augmenting their unhappiness by an appearance of immoderate grief?" In this context, the italicized word "augmenting" means to make something greater by adding to it. Therefore, the correct choice is "increasing". The sentence suggests that showing too much grief might increase the unhappiness of the survivors, hence the duty to refrain from making their sadness greater.

Selecting Evidence
Which excerpt from the passage would be the best
evidence for an essay arguing that the Dust Bowl
migrants were intruders?
Many of the people moving west were not farm folk. At
least half had been living in a town or city and doing
some kind of blue-collar or less frequently white-collar
work before unemployment or stories of California
opportunities encouraged them to pack the car and hit
the road. Most of these migrants headed for the cities of
California where they usually found jobs and a decent
standard of living in fairly short order. They were the
overlooked half of the illnamed Dust Bowl migration.
- "The Dust Bowl Migration: Poverty Stories,
Race Stories,"
James N. Gregory
"stories of California opportunities encouraged them
to pack the car and hit the road."
"Most of these migrants headed for the cities of
California."
"they usually found jobs and a decent standard of
living in fairly short order."
"They were the overlooked half of the illnamed Dust
Bowl migration."
) Intro
Done

Answers

Answer: A

Explanation:

Our family loves planning a trip to New York.
A. singular
B. plural

Answers

Plural because it names more then 1 person

Final answer:

In the sentence 'Our family loves planning a trip to New York,' the collective noun 'family' is used as a singular entity sharing the action of planning, therefore requiring a singular verb. The correct answer is A. singular.

Explanation:

The sentence 'Our family loves planning a trip to New York.' uses the word 'family' as a collective noun. In this context, 'family' is seen as a single unit which is involved in the action of planning a trip together. Therefore, the correct answer to whether the word 'family' is used as a singular or plural noun in this sentence is A. singular. Collective nouns such as 'family' can take a singular or plural verb depending on whether the group is acting as a single unit or as individuals doing things separately. In the given sentence, it is implied that the family unit shares a single collective interest in the activity, which is why a singular verb ('loves') is appropriately used.

Which event does this excerpt foreshadow in “the monkey’s paw”

Answers

Final answer:

The excerpts provided are examples of foreshadowing in literature, which hints at future events and builds suspense, often indicating pivotal upcoming developments in the narrative.

Explanation:

These excerpts from various literary texts all foreshadow future events in their respective stories. Foreshadowing is a technique used by authors to hint at events that will occur later in the narrative. It serves to build suspense and forewarn the reader or audience of upcoming events, often leading to the climax of the story. Whether through vivid descriptions, dramatic revelations, or suspicious circumstances, foreshadowing is an integral rhetorical device that engages the reader further into the plot. For example, a door shaking as if something is trying to enter might foreshadow an impending confrontation. Similarly, the references to a hot paw, devilish claws, and suspicious characters all hint at dramatic developments to come. Lastly, a narrative that begins with an introduction to a fearful man suggests that this character will have significant relevance later on.

What does this characterization of Arnetta reveal?

her academic strengths
her loyalty to friends
her community involvement
her spiritual devotion​

Answers

Answer:

it is c

Explanation:

i just took the test

The chief of police is concerned because a number of women in the department appear to be experiencing frustration and lack of job satisfaction. You are asked to explain this and point out that one reason for this problem is that _________.

Answers

Answer:

Refer below.

Explanation:

In recent decades, women have accounted for a growing share of police officers, but this growth has been relatively slow and women remain underrepresented in the field. They also sometimes differ sharply from male officers in their views of policing and their experiences.

Women accounted for 12% of full-time local police officers in 2013 (the latest data available).

When it comes to their experiences in the field, women are less likely than men to say they have physically struggled with a suspect who was resisting arrest in the past month (22% vs. 35% of male officers). Six-in-ten female officers say they have been verbally abused by a citizen while on duty in the past month, compared with 69% of men.

Which element should be included in an objective summary of a text

Answers

Answer:

B

Explanation:

A clear statement of the text's central idea, with relevant supporting details.

An evaluation of the event described in the text should not be included in an objective summary.

An objective summary aims to provide a concise and unbiased overview of the main points and key elements of a text. It should focus on presenting the central idea and relevant supporting details without expressing personal opinions or evaluations. Including an evaluation of the event would introduce subjectivity and bias into the summary, as it involves the summarizer's judgment or interpretation of the event's significance.

The purpose of an objective summary is to present the factual content of the text in a neutral and concise manner, allowing readers to grasp the essential information without being influenced by the summarizer's perspective. Therefore, an evaluation of the event goes against the goal of maintaining objectivity and should be avoided in an objective summary.

To know more about objective summary, click here.

https://brainly.com/question/28441568

#SPJ3

------------The given question is incomplete, the complete question is:

"Which element should not be included in an objective summary of a text?

A. a clear description of the central idea

B. Relevant supporting details

C. complete sentences

D. an evaluation of the event described in the text"-------------

Select the correct answer.

Which fact would be best to add after sentence 9 to develop the idea that while rare, the white moose population is

Increasing?

Answers

Hello. This question is incomplete. The full question is:

"(1) A nature lover and local politician in the area had been trying for three years to capture the moose on video. (2) He finally got footage of the moose crossing a river and walking through tall grass. (3) Wandering the southwest region of Sweden is a mysterious white moose. (4) While other moose are typically dark brown or black, this rare moose looks almost entirely white, with soft white velvet coating, even on its antlers. (5) Many believed that the moose's white coloring was a result of a condition called albinism. (6) This is a condition that causes the loss of pigment, or color in skin, hair, and fur. (7) It is now believed that moose with this white fur have a recessive gene that causes white fur with specks of brown. (8) While this condition is totally rare, these weird white moose continue to pop up across Europe. (9) Their population is increasing in Europe, as moose in this area face few natural predators. (10) In order to protect these ghostly creatures, hunters have chosen to avoid these animals, effectively protecting them, allowing the populations to grow. (11) These white moose have also been seen in various areas of Alaska and Canada but are most common in the vast forests of Sweden and Norway in Europe. (12) With the number of predators, such as bears and wolves, in North America, it is unlikely that the populations of white moose will increase too much. (13) The animals' white fur keep them from being able to camouflage themselves in the forest, making them easy prey.

Which fact would be best to add after sentence 9 to develop the idea that while rare, the white moose population is increasing?

A. At a local restaurant, the patrons keep track of how many white moose they have seen wandering through the forests.  B. According to the British Broadcasting Company, there are now over 100 white moose in Sweden alone compared to only 70 a few years ago.  C. Based on a recent town hall meeting, residents think they have seen about 100 white moose in the forests of Sweden.  D. Local news agencies in Norway are gathering videos of these rare white moose to create a tracking system for where these creatures are living.

Answer:

B. According to the British Broadcasting Company, there are now over 100 white moose in Sweden alone compared to only 70 a few years ago.

Explanation:

Alternative B, shows that a scientific investigation was carried out by a recognized and renowned organization that can present data obtained from studies and experiments that prove that, although rare, it is possible to affirm that the population of white moose in Europe is increasing over the years. years.

For this reason, we can say that among the options given in the question above, option B is the one that could be placed after statement 9, contained in the text.

The fact that would be best to add after sentence 9 to develop the idea is that B. According to the British Broadcasting Company, there are over 100 white moose in Sweden alone.

What is a central idea?

A central idea simply means the main idea that's conveyed by an author in a literary work.

In this case, the idea portayed by the author is that there's an increase in the white moose.

Therefore, the fact that would be best to add after sentence 9 to develop the idea is that according to the British Broadcasting Company, there are over 100 white moose in Sweden alone compared to 70 a few years ago.

The complete question is:

A nature lover and local politician in the area had been trying for three years to capture the moose on video. He finally got footage of the moose crossing a river and walking through tall grass.

Wandering the southwest region of Sweden is a mysterious white moose. While other moose are typically dark brown or black, this rare moose looks almost entirely white, with soft white velvet coating, even on its antlers. Many believed that the moose's white coloring was a result of a condition called albinism.

This is a condition that causes the loss of pigment, or color in skin, hair, and fur. It is now believed that moose with this white fur have a recessive gene that causes white fur with specks of brown. While this condition is totally rare, these weird white moose continue to pop up across Europe.

Their population is increasing in Europe, as moose in this area face few natural predators. In order to protect these ghostly creatures, hunters have chosen to avoid these animals, effectively protecting them, allowing the populations to grow. These white moose have also been seen in various areas of Alaska and Canada but are most common in the vast forests of Sweden and Norway in Europe.

With the number of predators, such as bears and wolves, in North America, it is unlikely that the populations of white moose will increase too much. The animals' white fur keep them from being able to camouflage themselves in the forest, making them easy prey.

Which fact would be best to add after sentence 9 to develop the idea that while rare, the white moose population is increasing?

A. At a local restaurant, the patrons keep track of how many white moose they have seen wandering through the forests.

B. According to the British Broadcasting Company, there are now over 100 white moose in Sweden alone compared to only 70 a few years ago.

C. Based on a recent town hall meeting, residents think they have seen about 100 white moose in the forests of Sweden.

D. Local news agencies in Norway are gathering videos of these rare white moose to create a tracking system for where these creatures are living.

Learn more about central idea on:

https://brainly.com/question/2684713

#SPJ5

2. What type of texts usually use chronological order? (Choose THREE)
O
historical events
stories
manuals
math textbooks
biographies​

Answers

Answer:

I would say that Historical Events, Manuals, and Biographies are typically in chronological order.

1. What makes a poem a poem?
2. What are three common characteristics of poetry?
3. Are songs poems? Why or why not?
4. Can speeches or tweets be considered poems?
‌(It doesnt need to be complete sentences but at least well explained)

Answers

1.  What makes a poem a poem is the ability to make the reader feel something.  I know that can happen with prose, as well, but it seems to me it must happen with a poem.  As has already been mentioned, a poem is different in form from prose--the normal rules of writing just don't apply.  That doesn't mean a poem can't have form or punctuation, but it doesn't have to.  One of the books I teach from is called Sound and Sense, which comes from the idea that poetry should match its sound with its meaning (sense).

2.  Rhyme, form, sound.

3. Yes, without a musical rhythm poetry is dead. Poetry is a sense of expression, completely based on imagination which we portray in words and rhythm is used by adorning words. ... Music (words + melody) can be seen as poetry.

4. Yes they could!

A poem is a form of literature that uses concise and artistic language to express ideas and emotions. Three common characteristics of poetry are conciseness, rhythm and meter, and imagery. Songs can be considered poems due to their similar characteristics, while speeches and tweets may also be seen as poetry depending on their form and content.

A poem is a form of literature that uses language to express ideas, emotions, experiences, or observations in a unique and artistic way. It is characterized by its use of concise and condensed language, rhythm, and imagery.

Conciseness: Poems often use words sparingly and focus on expressing ideas and emotions succinctly.Rhythm and meter: Poems frequently have a regular pattern of stressed and unstressed syllables that create a musical quality.Imagery: Poems use vivid sensory language and figurative devices like metaphors and similes to create images in the reader's mind.

2. Songs can be considered poems because they share similar characteristics. They both use language creatively, employ rhythm and rhyme, and convey emotions or stories. However, songs have the additional element of music, which enhances the overall impact.

3. Speeches and tweets can sometimes be considered poetry, depending on their form and content. If a speech or tweet exhibits the characteristics of a poem, such as concise language, rhythmic patterns, and artistic expression, it can be seen as a form of poetry.

Learn more about poetry

https://brainly.com/question/30275502

#SPJ6


What decision did grandmother take when she realized her end was near?

Answers

Answer:

The grandmother decided to spend her remaining time to pray while lying in bed. She didn't want to communicate with anyone in the family about it because she thought it would just waste her time.

Explanation:

The question above is related to the story entitled "The Portrait of a Lady," written by Kushwant Singh. The story focuses on  the author and his relationship with his grandmother. They started having a close relationship at the beginning but ended up growing apart especially when the author decided to study out of the country.

It was very common for the grandmother to spend time with her sparrows in the veranda. Thus, when she died, it seemed like the sparrows were mourning for her death as they were surrounding her.

Which sentence in this excerpt from Robert Cormier’s “The Moustache” reveals a character’s internal conflict?
Frankly, I wasn’t too crazy about visiting a nursing home. They reminded me of hospitals, and hospitals turn me off.I mean, the smell of ether makes me nauseous, and I feel faint at the sight of blood. And as I approached Lawnrest—which is a terrible, cemetery kind of name, to begin with—I was sorry I hadn’t avoided the trip. Then I felt guilty about it. I’m loaded with guilt complexes. Like driving like a madman after promising my father to be careful. Like sitting in the parking lot, looking at the nursing home with dread and thinking how I’d rather be with Cindy.Then I thought of all the Christmas and birthday gifts my grandmother had given me and I got out of the car, guilty as usual.

Answers

Answer:

I think it would be "I’m loaded with guilt complexes."

Explanation:

Answer:

I hope this helps

Explanation:

What key features are brought to life in dystopian societies?

Answers

• Propaganda is used to control the citizens of society. Information, independent thought, and freedom are restricted. A figurehead or concept is worshipped by the citizens of the society. Citizens are perceived to be under constant surveillance.
Final answer:

Dystopian societies in literature showcase oppressive regimes, a lack of personal freedoms, and serve as a critique on social, political, and environmental issues. They explore the human condition within extreme social and political changes and serve as cautionary tales for the real world.

Explanation:Key Features of Dystopian Societies in Literature

Dystopian societies, often depicted in science fiction, bring to life a range of key features that reflect on dire societal, political, and environmental issues. The protagonists in these societies usually face various forms of oppression and lack of freedoms under totalitarian control, as seen in George Orwell’s 1984. These societies serve as a critique on current societal issues such as disparities in health, the presence of weapons of mass destruction, and environmental degradation due to human activity.

Authors like Orwell and Ellison tackle totalitarianism and social invisibility, respectively, to show how individuals may fight or succumb to such environments. In Ralph Ellison's Invisible Man, the protagonist’s search for identity in a society that refuses to see him highlights the personal struggle within these grim settings. Furthermore, literature poses vital questions concerning the human condition, choices, and resilience in the face of overwhelmingly negative circumstances.

In the realm of science fiction, the dystopian genre serves not only as a backdrop for storytelling but also a platform to explore the consequences of extreme social and political change. For example, The Hunger Games series uses a dystopian future to discuss the implications of capitalism and social inequality. These narratives encourage readers to examine the hypothetical results of our current actions and choices within our own societal context.

Which is an example of a dialect

Answers

Answer:

An example of dialect is Cantonese to the Chinese language

Questions 1–5: Identify the correct object or subject form of the pronoun to complete each sentence.

1. When you finish the report, you can give it to Linda or myself/me/I.

2. The report isn’t for myself/me/I; it’s for Dr. Robinson.

3. I/myself/me would prefer a verbal report.

4. My colleagues and myself/me/I want to thank everyone who made this project a success.

5. Andrew gave more of the credit for the sale to myself/me/I than is warranted.

Questions 6–8: Read each sentence and choose the correct pronoun.

6. The actor who/whom plays in the new movie used to live in my hometown.

7. The driver with who/whom she feels most comfortable is Mr. Harris.

8. That is the young man who/whom Lisa met at the party last week.

Questions 9–10: Answer the following questions about plural nouns.

9. List five nouns of foreign origin that retained their original plural endings. Write the noun in singular and plural form.

10. List three words that are always in the plural form.

Questions 11–16: Fill in the blank in each of these sentences by forming the correct plural possessive of the noun in parentheses.

11. We waited several hours for the _____ (man) decision, then went ahead.

12. The door of the _____ (airplane) hangar had to be repaired before they could takeoff.

13. Two insurance companies were involved, and both _____ (company) forms had to be completed.

14. The difference in quality between the two _____ (sheep) wool was apparent.

15. The dental technician told me that flossing was for my _____ (tooth) protection.

16. We were present when our _____ (brother-in-law) new restaurant was opened for business.

Answers

Answer:

1. Myself

2. Me

3. I

4. I

5. Me

Explanation:

How did the actions of women in previous wars contribute to the decision to integrate them into the military in 1948? A Women had voiced their desire to participate in past wars, finally convincing officials to train them in 1948. B Women proved to be extremely capable in past wars, encouraging officials to include them as recruits. C Women were successful in combat roles in the past, leading officials to believe they would be even better if trained. D Women volunteered for past wars in greater numbers than men, showing officials that they would greatly improve the reserves.

Answers

Final answer:

Women's actions in previous wars contributed to their integration into the military in 1948 through their expressed desire to participate, their capabilities and success in combat roles, and their enthusiastic volunteerism.

Explanation:

The actions of women in previous wars contributed to the decision to integrate them into the military in 1948 in several ways.

First, women had already voiced their desire to participate in past wars, convincing officials that they were capable and willing. The activism of women and their successful efforts in supporting the war effort during World War II played a significant role in changing the perception of women's roles in the military.

Second, women demonstrated their capabilities and success in combat roles during past wars, proving to officials that they would be even better if trained. For example, in World War II, over 350,000 women served in the military as noncombatants, filling various roles such as clerical work, nursing, mechanics, and even as pilots.

Lastly, women volunteered for past wars in greater numbers than men, showing officials that they were enthusiastic and dedicated to serving their country. This demonstrated the potential for women to greatly improve the military reserves.

The actions of women in previous wars contribute to the decision to integrate them into the military in 1948 as B) Women proved to be extremely capable in past wars, encouraging officials to include them as recruits. Thus, the correct answer is option B.

During World War I and World War II, women demonstrated their abilities by taking on various roles traditionally held by men.

They served as nurses, clerks, and even in auxiliary military units such as the Women's Auxiliary Army Corps (WAAC) and the Women Accepted for Voluntary Emergency Service (WAVES).

Their success in these roles highlighted their capability and reliability, which led military leaders to recognize the necessity of women's contributions. In 1948, their proven competence and the need to maintain a robust military workforce resulted in the passage of the Women's Armed Services Integration Act, allowing women to serve permanently in all branches of the military.

What does the deer symbolize in “Destiny” by Rosario Castellanos

Answers

Answer:

Deer is the symbol of 'gentleness' and 'innocence.'

Explanation:

"Deer" is a poem written by Rosario Castellanos. The poem speaks about the destiny of the things that we love and don't love. Castellanos speaks that the things that we love dies and the things that we don't love lives with us.

The deer in the poem symbolizes 'gentleness' and 'innocence.' The deer, in the poem, is over powered by the lion, which symbolizes violence and strength. It is assumed that the poem was written in remembrance of the two miscarriages that Rosario faced in her life.

The deer is being shot with an arrow in the poem, which refers to the 'gentleness' and 'innocence' being shot and over powered by the lion (the things that we don't love).

So, the correct answer is 'gentleness' and 'innocence.'

Final answer:

The deer in Rosario Castellanos' "Destiny" symbolizes vulnerability and strength amid adversity, reflecting themes of character depth and the human condition. In broader cultural contexts, the deer represents longevity, beauty, and balance with nature. Castellanos' narrative weaves these symbols to support the thematic expressions of isolation, resilience, and the complexity of human experiences.

Explanation:

In "Destiny" by Rosario Castellanos, the deer is symbolic, representing various thematic elements such as innocence, vulnerability, and possibly destiny itself. The image of a wounded deer with a serene face juxtaposes the appearance of calmness against the reality of suffering, suggesting a depth of character and strength amid adversity. This reflects the multiple wounds the deer—like individuals or society—can endure while maintaining an outward appearance of peace. Furthermore, the simplicity of the backdrop, with only tree trunks and a broken branch, emphasizes the isolation and perhaps the loneliness of the deer, aligning with themes of solitude and the human condition presented in Castellanos' work.

Similarly, in other cultural contexts, the deer symbolizes longevity, the pursuit of beauty, and the spirit of nature. For example, the rough painting of the deer decorated with chrysanthemums denotes long life, friendship, and associations with autumn—a season of change. This can further be intertwined with Castellanos' narrative, where symbols of nature support larger thematic expressions. Lastly, the practice of deer dancing by the Yaqui people symbolizes the interaction with nature and the spiritual world, suggesting a deeper connection exploring the balance of life and the relationship between humans and the environment.

Kennedy conveyed the idea that Americans have certain responsibilities to all of the following except: Question options: Themselves and each other The federal government The global community

Answers

The federal government

Answer: Option 1.

Explanation:

The citizens of America are given certain rights and opportunities to enjoy liberties and freedom and to have a peaceful life. But in return of these rights, the citizens have some responsibilities that they have to fulfill not only towards them but also other people.

They should work not only for their own benefit and welfare, they should also take into the considerations, the welfare of the society and the people who are living in the society.

The night sky was a loom threaded with darkness. Select one: hyperbole simile personification metaphor

Answers

Answer:

metaphor

Explanation:

what does the tree represent in the book i promised i would tell




Answers

Answer:

The tree is the tree of life and it shows the appreciation of life and how everyone should get the chance to have it.

Explanation:

Other Questions
1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes. if tan 0= -3/8 which expression is equivalent to cot0? A fairground ride spins its occupants inside a flying saucer-shaped container. If the horizontal circular path the riders follow has a 6.75 m radius, at how many revolutions per minute are the riders subjected to a centripetal acceleration equal to that of gravity What should you expect to happen if you participate in a poetry workshop? Gothic archtiture rarely used on the outstide of cathedrals and churhes. true or false Theo's Survey ResultsEye ColorBrown BlueBoy2525GenderGirl2525Theo recorded the gender and eye color of students walking in the hallway at his middle school. What is theexperimental probability in simplest form that the next student he sees will be a boy with brown eyes? A group of adults plus one child attend a movie at Cineplex 15. Tickets cost $9 for adults and $6 for children. The total cost for the movie is $78. Write an equation to find the number of adults in the group. Add your results to those of your partner to produce a total of 20 tosses. Assuming that you expect ten heads and ten tails in 20 tosses, how close are these results to what was expected? five rock songs and six hip-hop songs on a disk jockeys playlist for a radio show. If the disc jockey shuffle the songs randomly, what is the possibility that all hip-hop song are played consecutively The measure of central angle RST is radians. What is the area of the shaded sector? 4Pi units squared8Pi units squared16Pi units squared20Pi units squared find the area of that shape please and show work The Smiths spend 8% of their budget on entertainment. Their total budget this year is $3,000 more than last year, and this year they plan to spend $3,600 on entertainment. What was their total budget last year? Circumference and Area of a circle #5 please