Mathematics High School

At a shoe store a sales person earns a weekly salary of $150.a salesperson is also paid $2.00 for each pair of shoes he or she sells during the week what is the algebraic expression

Answers

Answer 1

Salary = 150 + 2x
or 150 + 2.00x but the .00 is not necessary.
x would represent the number of pairs of shoes sold.

Answer 2

Answer:

150 + (2x)

Step-by-step explanation:

At a shoe store a sales person earns a weekly salary = $150.

He or she also paid for the sale of each pair of shoes = $2.00

Let the number of pairs of shoes sold be 'x'

the commission on the shoes sold = 2(x)

So the algebraic expression for her/his weekly pay would be

150 + (2x)

Related Questions

Which equation in point-slope form contains the point (4, –1) and has slope 3? y – 1 = 3(x + 4) y – 4 = 3(x + 1) y + 1 = 3(x – 4)

Answers

Hello!

The equation for point-slope form is

y - b = m(x - a)

m is the slope
(a, b) is a point the line goes through

Put in the values into the equation

y - -1 = 3(x - 4)

Simplify

y + 1 = 3(x - 4)

The answer is C) y + 1 = 3(x - 4)

Hope this helps!

Answer:

the answer is option d y+1 =3 (x-4)

What size does the radius of a sphere need to be for its volume to be larger than its surface area? HINT! It is less than 10. HINT! It is NOT a whole number. If you can show me a whole number for a radius where the surface area and volume are equal, then any radius bigger than that will have a larger volume.

To get full points you will need to SHOW me formulas for surface area of a sphere, volume of a sphere, and calculations on how you found your answer.

Answers

we know that
volume of a sphere=(4/3)*pi*r³----> (r/3)*(4*pi*r²)
and
surface area of sphere=4*pi*r²

so
the volume of a sphere=(r/3)*surface area of sphere
therefore

if r=3
volume of a sphere=(3/3)*surface area of sphere
volume of a sphere=surface area of sphere

if r> 3
the term (r/3) is > 0
so
volume of a sphere > surface area of sphere

if r<3
the term (r/3) is < 0
so
volume of a sphere < surface area of sphere

example
1) for radius r=3 units
volume of a sphere=(4/3)*pi*3³----> 113.04 unit³
surface area=4*pi*3²----> 113.04 units²
volume is equal to surface area

2) for radius r=10 units
volume of a sphere=(4/3)*pi*10³----> 4186.67 unit³
surface area=4*pi*10²----> 1256 units²
volume is > surface area

3) for radius r=2 units
volume of a sphere=(4/3)*pi*2³----> 33.49 unit³
surface area=4*pi*2²----> 50.24 units²
volume is < surface area

Can someone help me in this trig question, please? thanks
A person is on the outer edge of a carousel with a radius of 20 feet that is rotating counterclockwise around a point that is centered at the origin. What is the exact value of the position of the rider after the carousel rotates 5pi/12

Answers

[tex]\bf \textit{the position of the rider is clearly }20cos\left( \frac{5\pi }{12} \right)~~,~~20sin\left( \frac{5\pi }{12} \right)\\\\ -------------------------------\\\\ \cfrac{5}{12}\implies \cfrac{2+3}{12}\implies \cfrac{2}{12}+\cfrac{3}{12}\implies \cfrac{1}{6}+\cfrac{1}{4} \\\\\\ \textit{therefore then }\qquad \cfrac{5\pi }{12}\implies \cfrac{1\pi }{6}+\cfrac{1\pi }{4}\implies \cfrac{\pi }{6}+\cfrac{\pi }{4}\\\\ -------------------------------[/tex]

[tex]\bf \textit{Sum and Difference Identities} \\\\ sin(\alpha + \beta)=sin(\alpha)cos(\beta) + cos(\alpha)sin(\beta) \\\\ cos(\alpha + \beta)= cos(\alpha)cos(\beta)- sin(\alpha)sin(\beta) \\\\ -------------------------------\\\\ cos\left( \frac{\pi }{6}+\frac{\pi }{4} \right)=cos\left( \frac{\pi }{6}\right)cos\left(\frac{\pi }{4} \right)-sin\left( \frac{\pi }{6}\right)sin\left(\frac{\pi }{4} \right)[/tex]

[tex]\bf cos\left( \frac{\pi }{6}+\frac{\pi }{4} \right)=\cfrac{\sqrt{3}}{2}\cdot \cfrac{\sqrt{2}}{2}-\cfrac{1}{2}\cdot \cfrac{\sqrt{2}}{2}\implies \cfrac{\sqrt{6}}{4}-\cfrac{\sqrt{2}}{4}\implies \boxed{\cfrac{\sqrt{6}-\sqrt{2}}{4}} \\\\\\ sin\left( \frac{\pi }{6}+\frac{\pi }{4} \right)=sin\left( \frac{\pi }{6}\right)cos\left( \frac{\pi }{4} \right)+cos\left( \frac{\pi }{6}\right)sin\left(\frac{\pi }{4} \right)[/tex]

[tex]\bf sin\left( \frac{\pi }{6}+\frac{\pi }{4} \right)=\cfrac{1}{2}\cdot \cfrac{\sqrt{2}}{2}+\cfrac{\sqrt{3}}{2}\cdot \cfrac{\sqrt{2}}{2}\implies \cfrac{\sqrt{2}}{4}+\cfrac{\sqrt{6}}{4}\implies \boxed{\cfrac{\sqrt{2}+\sqrt{6}}{4}}\\\\ -------------------------------\\\\ 20\left( \cfrac{\sqrt{6}-\sqrt{2}}{4} \right)\implies 5(-\sqrt{2}+\sqrt{6}) \\\\\\ 20\left( \cfrac{\sqrt{2}+\sqrt{6}}{4} \right)\implies 5(\sqrt{2}+\sqrt{6})[/tex]

The exact value of the position of the rider after the carousel rotates 5π/12 is 5 (-√2 + √6), 5(√2 + √6).

The position

Since the position of the carousel is (x, y) = (20cosθ, 20sinθ) and we need to find the position when θ = 5π/12 = 5π/12 × 180 = 75°

So, substituting the value of θ into the positions, we have

(20cos75°, 20sin75°)

The value of 20cos75°

20cos75° = 20cos(45 + 30)

Using the compound angle formula

cos(A + B) = cosAcosB - sinAsinB

With A = 45 and B = 30

cos(45 + 30) = cos45cos30 - sin45sin30

= 1/√2 × √3/2 - 1/√2 × 1/2

= 1/2√2(√3 - 1)

= 1/2√2(√3 - 1) × √2/√2

= √2(√3 - 1)/4

= (√6 - √2)/4

= (-√2 + √6)/4

So, 20cos75° = 20 × (-√2 + √6)/4

= 5 (-√2 + √6)

The value of 20sin75°

20sin75° = sin(45 + 30)

Using the compound angle formula

sin(A + B) = sinAcosB + cosAsinB

With A = 45 and B = 30

sin(45 + 30) = sin45cos30 + cos45sin30

= 1/√2 × √3/2 + 1/√2 × 1/2

= 1/2√2(√3 + 1)

= 1/2√2(√3 + 1) × √2/√2

= √2(√3 + 1)/4

= (√6 + √2)/4

= (√2 + √6)/4

So, 20sin75° = 20 × (√2 + √6)/4

= 5(√2 + √6)

Thus, (20cos75°, 20sin75°) = 5 (-√2 + √6), 5(√2 + √6).

So, the exact value of the position of the rider after the carousel rotates 5π/12 is 5 (-√2 + √6), 5(√2 + √6).

Learn more about position here:

https://brainly.com/question/11001232

can someone help me on trigonometry ?

Answers

Using the image I gave you, you don't need to solve for x.
So tan is opposite/adjacent
sin: opposite/hypotenuse
cos: adjacent/hypotenuse
Take theta and do: adjacent/hypotenuse which is cosine
cos theta = adjacent/hypotenuse
cos theta = 1.5/9
inverse cos = 1.5/9 and the answer is: 80.4 degrees

how do you do 27?????

Answers

Hey there!

To start, the equation needed to represent this problem would be an equation:
y= ab^x

a represents the initial amount. In this case, the initial amount would be 4 billion. It would be represented as 4 since each 1= one billion.

b represents the rate. Because the problem discusses a growth, convert the rate, 1.9% to a decimal and add 1 to it (add one if it is a growth, subtract one if it is a decay). b would be 1.019.

x represents the time in which the population grows or t.

When you piece this together, your equation should look like:
y=4(1.019)^t

or

Choice A.

Hope this helps and have a nice day! Feel free to ask any questions about my work. :)

The correct answer is: [A]: " P(t) = 4 * (1 .019)^t " .
_______________________________________________________
Explanation:
______________________________________________________
Use the formula for "exponential growth" :
______________________________________________________
→ " y = A * (1 + r)^t " ;
______________________________________________________
in which:
______________________________________________________
A = the "beginning population" ;

→ (in number representing "billions of people") ;

→ given the "beginning population" is "4 billion" ;

→ " A = 4 " ;
______________________________________________________
r = rate (of change) = 1.9% ; expressed as a decimal:

→ "r = rate = 1.9% = { 1.9 ÷ 100 } ;

→ {Take the "1.9" ; & move the decimal point 2 (two) spaces backward }:

→ 1.9% = 1.9 ÷ 100 = 0.019 ;

→ " r = 0.019 " ;

→ " t = time" ; (usually in "years" ; however, all the answer choices provided leave the "t" as it is; so we shall do so, too.
________________________________________________________

→ Replace "y" with: " P(t) " ;

→ And rewrite the equation of the function with our known values:

→ " y = A * (1 + r)^t " ;
____________________________________________________
→ becomes:

→ " P(t) = 4* (1 + 0.019)^t " ;

→ " P(t) = 4 * (1 .019)^t " ;
____________________________________________________
→ which is: Answer choice: [A]: " P(t) = 4 * (1 .019)^t " .
____________________________________________________

If a scare as side lengths of 5 inches what is the lengths of the diagonal to the nearest 10th of in inch

Answers

A 5 by 5 square would have a diagonal equal to

square root (25 + 25) =
square root (50) =
7.07106781 =
7.1 (rounded to nearest 10th of an inch.

Karen is considering taking out a 20-year loan with monthly payments of $260 at an APR of 5.5%, compounded monthly, and this equates to a loan of $37,796.89. Assuming that the APR and the length of the loan remain fixed, which of these is a correct statement?

Answers

The correct statement is A;If Karen monthly payment $260 the amt of the loan that he is considering taking out would be less than $37,796.89

How to calculate EMI?

The EMI formula is :

[tex]\dfrac{pr(1 + r)^n}{(1 + r)^n - 1}[/tex]

Where r = 5.5/12/100 = 0.00425

p = 37,796.89

and n = 20 x 12 = 240

Putting the values in formula we get'

= (37,796.89x 0.00425 x 2.767)/1.767

= $350

Hence,

The correct statement is A; If Karen monthly payment $260 the amt of the loan that he is considering taking out would be less than $37,796.89

Learn more about the compounded here;

brainly.com/question/11814596

#SPJ5

Answer:If Karen's monthly payment were $240, the amount of the loan that she is considering taking out would be less than $37,796.89.

Step-by-step explanation:

help! I will give thanks!

Answers

Mode = 60

Reason: 60 appeared 4 times.

6\000= 60 7/00=70 8/00 =80 9/0=90

the probability of winning the game is 7/10. What is the probability that they will lose?

Answers

3/10 is the probability of them losing.

The probability of losing the game is 3/10 or 0.3 when the probability of winning is 7/10, because the total probability must always equal 1.

If the probability of winning the game is 7/10, then the probability of losing the game is the complement of the probability of winning. This means we subtract the probability of winning from 1. Therefore, the probability of losing the game is 1 - 7/10 = 3/10 or 0.3. This is because the sum of the probabilities of all possible outcomes in a probability distribution must equal 1.

A car is traveling at 48 miles per hour. What is the speed of the car in centimeters per second? (1 mile = 5,280 feet, 1 foot = 12 inches, 1 centimeter = 0.39 inch)

Answers

the speed of the car in centimeters per second based on the information given would be 2,145.8

A car is traveling at 48 miles per hour. What is the speed of the car in centimeters per second? (1 mile = 5,280 feet, 1 foot = 12 inches, 1 centimeter = 0.39 inch)

Solution:

We have 48 [tex] \frac{miles}{hour} [/tex]

To convert, miles to centimeters.

Let us convert miles to feet and then inches and then centimeters.

1miles=5280feet

And, 1 foot=12inches

So, 5280 feet or 1 miles =12*5280inches

So, 1miles=63360inches

Now, Let us convert inches to centimeters

1centimeter=0.39inches

Or, 1 inch= [tex] \frac{1}{0.39} [/tex] centimeter

So, 63360inches (or 1 mile)= [tex] \frac{63360}{0.39} [/tex] centimeter

1mile or 63360inches=162461.54centimeter

1mile=162461.54 centimeter

We have, 48 [tex] \frac{miles}{hour} [/tex]

We have, 48 *[tex] \frac{162461.54 centimeter}{60minutes} [/tex]

We have, 48* [tex] \frac{162461.54 centimeter}{60*60seconds} [/tex]

So, We have, 48* [tex] \frac{162461.54 centimeter}{3600seconds} [/tex]

=48*[tex] \frac{162461.54}{3600} [/tex][tex] \frac{centimeters}{second} [/tex]

=48*45.13[tex] \frac{centimeters}{second} [/tex]

=2166.15[tex] \frac{centimeters}{second} [/tex]

Answer:= Speed of the car in centimeters per second is 2166.15 centimeters/second

The cross-sectional area parallel to the bases of the two figures above is the same at every level. Find the volume of the cone, to the nearest tenth.

A.26.5cm3
B.44.2cm3
C.79.5cm3
D.132.5cm3

Answers

Para resolver este problema, debe aplicar el procedimiento que se muestra a continuación:

1of the first figure in the image attached, is:

a ^ 2 = b ^ 2 + c ^ 2
c =
c=√(6 cm)^2-(4.8 cm)^2
c=3.6 cm

2. The area of the base of the first figure is:

A=BxH/2
A=3.6x4.8/2
A=8.64 cm^2

3. Therefore, the volume of the cone is:

V=(8.64 cm^2)(9.2 cm)
V=79.5 cm^3

Therefore, the answer is: C. 79.5 cm^3

what is 3 ^9? how to solve?

Answers

3⁹ is the same as doing:

3 * 3 * 3 * 3 * 3 * 3 * 3 * 3 * 3

What I would do it is narrow it down piece by piece.

3 * 3 * 3 = 27. Do that 3 times, now you are left with:

27 * 27 * 27

27 * 27 or 27² = 729.

That leaves you with:

729 * 27

You can multiply by hand or use a calculator to get your answer of 19683.

To check your answer, plug 3⁹ into a calculator. Your answer should match this.

what is 3√27x^9

3x^6
3x^3
9x^3
9x^6

Answers

The first step for solving this expression is to know that the root of a product is equal to the product of the roots of each factor. Knowing this,, the expression becomes the following:
[tex] \sqrt[3]{27} \sqrt[3]{ x^{9} } [/tex]
Write the number in the first square root in exponential form with a base of 3.
[tex] \sqrt[3]{ 3^{3} } \sqrt[3]{ x^{9} } [/tex]
Now reduce the index of the radical and exponent in the second square root with 3.
[tex] \sqrt[3]{ 3^{3} } [/tex] x³
Lastly,, reduce the index of the radical and exponent with 3 to get your final answer.
3x³
This means that the correct answer to your question will be option B.
Let me know if you have any further questions.
:)

The value of the expression ∛27x⁹ is 9x³.

The given expression is ∛27x⁹.

Cube root of twenty seven times of x power nine.

We can split the terms inside the cube root.

27=3×3×3

∛x⁹ = x³

Now let us plug in the above expression.

= 3√3³ × x⁹

= 3√3³ × √ x⁹

= 3 × 3 × x³

= 9x³.

Hence, the value of the expression ∛27x⁹ is 9x³.

To learn more on Expressions click:

https://brainly.com/question/14083225

#SPJ6

Which regular polygon would have each of its interior angles measure 120°? hexagon heptagon octagon nonagon?

Answers

Sum of angles of regular polygon = 180*(n-2), n - number of sides, or angles.

120n=180*(n-2)

120n=180n-360
180n-120n=360
60n =360
n=6

It is hexagon.

Which graph would help solve the equation 5log(x+3)=5

Answers

5log(x+3)=55log(x+3)=5Simplify 5log(x+3)5log(x+3) by moving 55 inside the logarithm.log((x+3)5)log((x+3)5)Simplify the right side of the equation.55Graph each side of the equation. The solution is the x-value of the point of intersection.x=7

The value of x is 7 for the given equation.

What is logarithm?

Logarithm, a mathematical concept involving multiplication. It is the exponent or power to which a base must be raised to yield a given number.

For the given situation,

The equation is 5log(x+3)=5.

On solving this equation, we can get value of x.

⇒ [tex]5log(x+3)=5[/tex]

⇒ [tex]log(x+3)=1[/tex]

We know that, log 10 = 1

Then,

⇒ [tex]log(x+3)=log10[/tex]

⇒ [tex]x+3=10[/tex]

⇒ [tex]x=7[/tex]

Hence we can conclude that the value of x is 7 and the graph fro the logarithmic equation is shown below.

Learn more about the logarithm here

https://brainly.com/question/20785664

#SPJ2

HELP!! Drag values to complete each equation.

Answers

(12²)³ x 12^-4 = 144 which means it is 12² = 144.

12^7 x 12^-5 / 12² which equals 1.

Hope this Helps!!

Answer:

a.[tex]((12)^2)^3\cdot (12)^{-4}=12^2[/tex]

b.[tex]\frac{(12)^7\cdot (12)^{-5}}{(12)^2}=1[/tex]

Step-by-step explanation:

We have to complete each equation

We are given that

[tex]((12)^2)^3\cdot (12)^{-4}[/tex]

[tex](12)^6\cdot (12)^{-4}[/tex]

Using identity

[tex](a^x)^y=a^{xy}[/tex]

[tex](12)^{6-4}=(12)^2[/tex]

Using identity: [tex]a^x\cdot a^y=a^{x+y}[/tex]

[tex]((12)^2)^3\cdot (12)^{-4}=12^2[/tex]

b.[tex]\frac{(12)^7\cdot (12)^{-5}}{(12)^2}[/tex]

[tex]\frac{(12)^2}{(12)^2}[/tex]

[tex](12)^{2-2}=(12)^0=1[/tex]

Using identity: [tex]\frac{a^x}{a^y}=a^{x-y},a^0=1[/tex]

[tex]\frac{(12)^7\cdot (12)^{-5}}{(12)^2}=1[/tex]

The measure of an angle is 8 times the measure of its complement. tina writes an equation and finds the correct measure of each angle. which shows the equation tina could have written and the angle measures she could have found?

Answers

One of the unknown angles (let's called it n) has a complement (meaning their sum adds up to 90 degrees) and the other angle is 8 times the unknown angle (8n)

With all this information, you should have the equation:

n + 8n = 90

To solve, combine like terms to get:

9n = 90

Divide by 9 on both sides to isolate the variable n.

n = 10

Now we plug back in to find our angle measurements. The first angle, n, is 10 degrees. The second angle, 8n, is 8 * 10 which is 80; the second angle is 80 degrees.

The measure of angles are 10 and 80 degree.

What is Algebra?

A branch of mathematics known as algebra deals with symbols and the mathematical operations performed on them.

In order to determine the values, these symbols are also subjected to various addition, subtraction, multiplication, and division arithmetic operations.

We have,

let the complementary angle = x

and, the another angle is = 8x

We know the complementary angle sum to 90 degree.

So, x + 8x = 90

9x = 90

x =10

Thus, the measure of angles are 10 and 80 degree.

Learn more about Algebra here:

https://brainly.com/question/24875240

#SPJ2

If p(x) = 2x^3 - 3x + 5, what is the remainder of p(x) divided by (x - 5)

Answers

Dividing the function given, P(x) by (x-5) will give us the following
P(x)/(x-5)
=(2x^3-3x+5)/(x-5)
=(2x^2+10x+47)+240/(x-5)
thus the remainder is:
240

Final answer:

Using the Remainder Theorem, after substituting 5 into the polynomial p(x), we find that the remainder when p(x) is divided by (x - 5) is 240.

Explanation:

To find the remainder of p(x) divided by (x - 5), we can use the Remainder Theorem. The Remainder Theorem states that the remainder of a polynomial p(x) divided by (x - a) is p(a). Thus, we need to evaluate p(5).

Let's substitute x with 5 in the polynomial p(x):

p(5) = 2(5)^3 - 3(5) + 5
= 2(125) - 15 + 5
= 250 - 15 + 5
= 240.

Therefore, the remainder when p(x) is divided by (x - 5) is 240.

NEED HELP ASAP!
Subtract.
(4x^2+8x−2)−(2x^2−4x+3)
Answer in standard form

Answers

[tex](4x^2+8x-2)-(2x^2-4x+3)\\\\=4x^2+8x-2-2x^2+4x-3\\\\=(4x^2-2x^2)+(8x+4x)+(-2-3)\\\\=\boxed{2x^2+12x-5}[/tex]

Find the Mean Median Mode and range of each data set that is obtained after adding the given constant. 12,10,15,17,15,9,10,15,12,14,+9. Please show work.

Answers

The given number arranged in order are:
9, 9, 10, 10, 12, 12, 14, 15, 15, 15, 17
1. To find the mean, add all the number together and divide the summation by 11[ which is the total number of the figures given]
Mean = [9 + 9 + 10 + 10 + 12 + 12 + 14+ 15 + 15 + 15 + 17] / 11 = 138 / 11
Mean = 12.5
Therefore, the mean is approximately equal to 13.

2. The median of a number refers to the number in the middle of a sorted set of number.
To find the median of a set of numbers, the numbers have to be arranged first in the correct increasing order and the number that falls in the middle will be the median. If two numbers fall in the middle, add the two together and find the average. For the set of number given above, the number that falls in the middle is 12.
Therefore, the median = 12.

3. The mode of a set of number refers to the number in the set, which has the highest frequency of occurrence, that is, it is the number that occur most. Looking at the set of number given above, 15 occurred three different times. Therefore, the mode of the set of number given above is 15.
Mode = 15.

4. The range of a set of number refers to the difference between the highest and the lowest numbers in the set of a given number. It represents the spread of the data. In the set of numbers given above the range is determined thus:
Range = 17 - 9 = 8.
Therefore, Range = 8.

Mean: 12.545454545455

Median: 12

Range: 8

Mode: 15, appeared 3 times

Largest: 17

Smallest: 9

Sum: 138

Count: 11

Subtract.

(x + 1) − (−2x − 5)

Answers

3x+6, you have to distribute the negative to get the parentheses away and simplify

Answer:

3x+6

Step-by-step explanation:

you have to distribute the negative to get the parentheses away and simplify

Please someone help Me with this problem. I really need help.

Answers

The distance between (4, 7) and (2, 2) might be A, 10. Hope this helps, sorry if I'm wrong.

what expression is equivalent to the division expression 3/4 divided by 4/5

Answers

3/4 ÷ 4/5 =

3/4 times 5/4 =

15/16 = .9375

Answer:

3/4 ÷ 4/5 = .75 ÷ .80

Step-by-step explanation:

3/4 ÷ 4/5

= .75 ÷ .80

= 0.9375

At noon joyce drove to the lake at 30 mph, but she made the long walk back home at 4 mph. how many hours did she walk if she was gone for 17 hours

Answers

By definition we have the following equation:
t = d / v
Where,
t: time
d: distance
v: speed
For this case we have:
d / 30 + d / 4 = 17
Rewriting we have:
2d + 15d = 17 (60)
17d = 17 (60)
d = 60 mi
Then, the walking time is
t = d / v
t = 60/4
t = 15 hours
Answer:
She walked
t = 15 hours

Answer:

i just did this on a quiz the answer was 15 hours

Step-by-step explanation:

Determine whether quantities vary directly or inversely and find the constant of variation. If 5 bushels of wheat weigh 136 kg, how much do 3.5 bushels of wheat weigh?

Answers

Well if 5 bushels = 136kg then 1 = 27.2 then 3.5 = 95.2 so it is directly and th vriation is 27.2

Let the bushels of wheat is b and weight of the wheat is w.

We can say that more the bushels of wheat more will be the weight of the wheat.

Hence, the quantities vary directly.

Therefore, we have

[tex]b=kw[/tex], where k is the constant of variation.

Now, we have been given that 5 bushels of wheat weigh 136 kg. Thus, we have

[tex]5=136k\\ \\ k=\frac{5}{136}[/tex]

Thus, the constant of variation is [tex]\frac{5}{136}[/tex]

Now, we have been given 3.5 bushels of wheat. Hence, we have

[tex]3.5=\frac{5}{136} w\\ \\ w=\frac{136\times 3.5}{5} \\ \\ w=95.2[/tex]

Therefore, 3.5 bushels of wheat weigh 95.2 kg

Tourists covered 255 km for a 4-hour ride by car and a 7-hour ride by train. What is the speed of the train, if it is 5 km/h greater than the speed of the car?

Answers

Speed of the car = 255 ÷ 4 = 63.75 km/h

Speed of the train = 63.75 + 5 = 68.75 km/h

Answer: 68.75 km/h

[tex]\\ \text{Let the speed of the car is x km/h}\\ \text{Then, the speed of the train is x+5 km/hr}\\ \text{Now, 4 hr is the time of the car}\\ \text{and 7 hour is the time of the train}\\ \text{We know the formula}\\ \text{Distance }= \text{Velocity }\times \text{ time}\\ \text{Distance travelled by car is 4x}\\ \text{Distance travelled by train is }7(x+5)\\ \text{The total distance is given by 255 km. Hence, we have}\\ 4x+7(x+5)=255\\ 4x+7x+35=255\\ 11x=220\\ x=20[/tex]

The speed of the car is 20 km/hr and hence the speed of the train is 2+5=25 km/hr.

The speed of the train is given by 25 km/hr.

Roman saves $500 each year in account earning interest at an account earning interest at an annual rate of 4% compounded annually.How much interest will the account earn at the end of each of the first 3 years?

Answers

500 x(1.04)^3=562.432
562.432-500= 62.432
62.432 / 3= 20.8106

A math book sells for $106.50. (a) find the amount of sales tax, to the nearest cent, if the sales tax rate is 8.5%. (b) find the total purchase price

Answers

Answers:
________________________________________________________
a)  " $ 9.05 " .
________________________________________________________
b)  " $ 115 .55 " .
________________________________________________________
Explanation:
________________________________________________________

a)   "FInd the amount of sales tax, to the nearest cent,
if the sales tax rate is 8.5% ."

  → 8.5% of 106.50 = (8.5/100) * 106.50 = 0.085 * 106.50 ;

= 9.0525 ;

→ round to the nearest cent: $ 9.05 .
________________________________________________________
b)  Find the purchase price:

→ $ 106.50
+ 9.05
________________________________________________________
$ 1 1 5.55
________________________________________________________

sketch one cycle of the cosine function y=-cos 3 theta

Answers

The graph of the equation given by y=-cos³θ will be as follows:

Answer with explanation:

The given cosine function is

y= - cos 3 (theta)= -3 cos A, where , theta =A.

→→Domain of Cos A

= All Real number

= Period is from (-π , π)

Range of Cos A=[-1, 1]

→Domain of Cos 3 A,will be also, all real number.

Period is from,

[tex][\frac{-\pi}{3},\frac{\pi}{3}][/tex]

But range of Cos 3A,will be same as ,Cos A which is equal to ,[-1,1].

→Plotted the graph of ,y=-cos 3 A, having cycle ,

[tex][\frac{-\pi}{3},\frac{\pi}{3}][/tex]

An equiangular triangle can be scalene. A. True B. False

Answers

False is correct answer.

Because equiangular triangle is not to be scalene.

Hope it helped you.

-Charlie

:)

False, Scalene triangles have three unequal sides and equilateral have three equal sides

Other Questions

What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure Summarize the narrative Churchill present Read this timeline:1975: federal election commission (fec) is established2002: bipartisan campaign reform act (bcra) is passed2010: citizens united v. fec is decidedwhat process do the events in the timeline reflect? Read this newspaper headline: Congressman Pushes Immigration Agenda Which change to the wording of this headline would make it more neutral without changing the overall meaning? A.Congressman Opposes Immigration Agenda B.Congressman Forces Immigration Agenda C.Congressman Advances Immigration Agenda D.Congressman Retracts Immigration Agenda Simon, come and clean up this mess at once for you(be)in trouble How did thomas jefferson purchase expand the president's power?