At boarding school, students spend 1/4 of their time eating and sleeping, 3/5 of their time in class, and 1'12 studying. The rest of the time is considered free time, which the student can spend doing activities of their own choosing. What fraction is considered free time?

Answers

Answer 1

Answer:

1/15 of their time is free time.

Step-by-step explanation:

To find the answer to this 2-step problem, we have to add all the fractions up, then find how much of that time is not part of the fraction.

So to add all the fractions, you have the equation:

1/4 + 3/5 + 1/12

The first thing we have to do is to find a common denominator.

4, 5, and 12 are each able to multiply into 60.

So we can make the equation now with a common denominator.

15/60+36/60+5/60=56/60.

We now can simplfy this.

56/60=14/15

Now that we know how long it is to do all the other activities, it tells us that the rest of the time is free time. To find the rest of the time, we have to do:

1-14/15=1/15

So 1/15 of their time is free time.

Answer 2

The total time spent is 14/15 and the free time is 1/15 if students spend 1/4 of their time eating and sleeping, 3/5 of their time in class, and 1'12 studying.

What is a fraction?

Fraction number consists of two parts, one is the top of the fraction number which is called the numerator and the second is the bottom of the fraction number which is called the denominator.

We have:

At boarding school, students spend 1/4 of their time eating and sleeping, 3/5 of their time in class, and 1/12 studying

Add all the fractions:

= 1/4 + 3/5 + 1/12

= 14/15

Free time = 1 - 14/15

= 1/15

Thus, the total time spent is 14/15 and the free time is 1/15 if students spend 1/4 of their time eating and sleeping, 3/5 of their time in class, and 1'12 studying.

Learn more about the fraction here:

brainly.com/question/1301963

#SPJ2


Related Questions

Determine the solution by using substitution. Write your answer as a point below (x,y).

Answers

Answer:

(2,-2)

Step-by-step explanation:

To solve this using substitution you would take your second equation and plug it in for y of the first equation (4x-10= -3x+4). You then would add the 10 over (4x= -3+14). Next you add the 3x over(7x=14). Finally divide both sides by 7, which should give you x=2. Now all you have to do is plug the two in for x in one of your equations (which ever equation you prefer) (y=-3(2)+4). Solve the equation and you will then have the answer to y, which you can then put into a point.

Answer:

(2,-2)

Step-by-step explanation:

4x-10=-3x+4

+10           +10

4x=-3x+14

+3x . +3x

7x=14

/7  /7

x=2

y=4(2)-10

y=8-10

y=-2  

sorry i took so long i was cooking pasta

1. Compare Nya and Salva. Use the double bubble map you created Monday.

Answers

Answer:

Step-by-step explanation:

ok so go on google and it should show u

Please help with somewhat some work.

Answers

Answer:

x+11

Step-by-step explanation:

draw the image of quadrilateral ABCD under a translation by 2 units to the right and 5 units down

Answers

Final answer:

To draw the image of a quadrilateral under a translation, shift every point of the quadrilateral accordingly. The translated points form the new quadrilateral.

Explanation:

To draw the image of quadrilateral ABCD under a translation by 2 units to the right and 5 units down, you need to shift every point of the quadrilateral 2 units to the right and 5 units downwards. For example, if point A was at (2,3), its new point after the translation would be at (2+2, 3-5) = (4,-2). You will need to do the same for points B, C, and D. Once you have the new coordinates for A, B, C, and D, simply connect them in the same order to get your translated quadrilateral. Remember that the shape and size of the quadrilateral will not change during the translation, only its position on the graph.

Learn more about Translation of Shapes here:

https://brainly.com/question/35496591

#SPJ3

what is (x+3)(x-1) equal to

Answers

Answer:

x² + 2x - 3

Step-by-step explanation:

Given

(x + 3)(x - 1)

Each term in the second factor is multiplied by each term in the first factor, that is

x(x - 1) + 3(x - 1) ← distribute both parenthesis

x² - x + 3x - 3 ← collect like terms

= x² + 2x - 3

Answer:

x^2+2x−3

Step-by-step explanation:

lets use the multiplication property of distrubution.

x * x = x^2

x * -1 = -x

(x+3)(x−1)

=(x+3)(x+−1)

=(x)(x)+(x)(−1)+(3)(x)+(3)(−1)

=x2−x+3x−3

=x^2+2x−3

brainliest?

PUDICII
In the figure below, the radius of circle P is 18 units. The arc length of BA is
14.
What is the arc measure of BC, in degrees?​

Answers

Answer:

The arc measure of BC is 64

Step-by-step explanation:

1. Calculate the full circumference of the circle

C=2pir

=2pi(18)

=36pi

2. Figure out the arc measure

arc length/circumference=arc measure/degrees in a circle

14pi/36pi=arc measure/360 (solve for arc measure)

14pi/36pi *360=140

The measures of BC and CA add up to the measure of BA

mBC +76=140

BC=64

Plz help I will give brainliest answer

Answers

It is Jada with a mad of 1.5.

Solve the inequality.

3/4x−2/3≤5/6


and then graphed on a number line

Answers

Answer:

x ≤ 2

Step-by-step explanation:

3/4x−2/3≤5/6

Multiply each side by 12 to get rid of the fractions

12(3/4x−2/3)≤5/6*12

9x - 8 ≤ 10

Add 8 to each side

9x -8+8 ≤ 10+8

9x ≤ 18

Divide each side by 9

9x/9 ≤ 18/9

x ≤ 2

Answer:

x ≤ 2

Step-by-step explanation:

¾x - ⅔ ≤ ⅚

¾x ≤ ⅚ + ⅔

¾x ≤ [5 + 2(2)]/6

¾x ≤ 9/6

x ≤ 9/6 × 4/3

x ≤ 2

Number line going towards left from 2 with a closed circle at 2

Please help it’s irritating when I keep having to post this and no ones bothering to even help me. Like I need to turn this is ASAP

Answers

Measure of E is congruent to K, so E is 50 degrees.

Measure of G is congruent to L, so G is 105 degrees.

Measure of F is congruent to J, J is 180 deg - 50 deg - 105 deg = 25 degrees, so F is 25 degrees.

The proof I am using is the Corresponding Angles Postulate.

I NEED BRAINLIEST!

What is the area of this trapezoid?
b2 = 5 in.
h = 4 in.
3 in.
2 in.
-b. = 10 in.

Answers

I really don’t know I was about to ask the same question

Answer: 30

Step-by-step explanation:

Why is the answer c and not 7?

Answers

Answer:

You have to C or clear the calculator first

Step-by-step explanation:

Some other randum number is there. So you have to press C or clear and then type the problem

mark brainliest plz

Answer:

the answer is C

Step-by-step explanation:

because you have clear the calculator's memory of any operations that has been performed prior to this new operation





How many solutions can be found for the system of linear equations represented on the graph?


A)
no solution


B)
one solution


C)
two solutions


D)
infinitely many solutions

Answers

Answer:

no solutions

Step-by-step explanation:

The lines are parallel (they have the same slope) but have different y intercepts, so they will never intersect.  The solutions are found where the lines intersect, so there are no solutions

Find the area of a circle with a circumference of 50.24 units

Answers

Answer:

A = 200.96 units^2

Step-by-step explanation:

We know the circumference is given by

C = 2 * pi *r

Approximating pi by 3.14

50.24 = 2 * 3.14 *r

50.24 = 6.28 r

Divide each side by 6.28

50.24/ 6.28 = 6.28r/6.28

8 =r

Now we can find the area

A = pi * r^2

A = 3.14 * r^2

A = 3.14 (8)^2

A = 200.96 units^2

The surface area of a piece of paper is 137 cm2. Use the fact that 10 mm = 1 cm to convert this area to mm2. Give your answer as a number. Do not type the units in the space below.

Answers

The surface area of a piece of paper is [tex]13700\ mm^2[/tex]

Solution:

surface area of a piece of paper = 137 sq cm

Use the fact that 10 mm = 1 cm to convert this area to mm^2

[tex]1\ cm = 10\ mm[/tex]

Then,

[tex]1\ cm^2 = 100\ mm^2[/tex]

Convert  137 sq cm to sq mm

[tex]137\ cm^2 = 137 \times 100\ mm^2\\\\137\ cm^2 = 13700\ mm^2[/tex]

Thus, surface area of a piece of paper is [tex]13700\ mm^2[/tex]

Final answer:

To convert the surface area of a piece of paper from cm² to mm², use the conversion factor 1 cm² = 100 mm².

Explanation:

To convert the surface area of a piece of paper from square centimeters (cm²) to square millimeters (mm²), we can use the conversion factor that 10 mm = 1 cm. Since we are given the surface area as 137 cm², we can multiply it by the conversion factor to get the value in mm².

Conversion factor: 1 cm² = (10 mm)² = 100 mm²

Therefore, the surface area of the paper in mm² is 137 cm² x 100 mm²/cm² = 13700 mm².

Plz help
What is the median value of the data set shown on the line plot?

Enter your answer in the box.

Answers

Answer:

30

It's thirty because median is the middle of all numbers, and thirty is the middle of all numbers.

Find measure of angle 2

Answers

Answer:

I am thinking 108 please correct me if I am wrong

Answer: measure angle 2 is 72

Step-by-step explanation: All angles of a triangle add up to 180 so you add 42 and 30 to find measure angle 1 which would be 108 now a horizontal line is 180 is you subtract 108 from 180 and you get 72.

Find the circumference of a circle with diameter = 30 ft

Answers

Answer: 94.2

Step-by-step explanation: If pie were to equal 3.14 then you would multiply 30 and 3.14 and that would equal your answer

Answer:

94.26

Step-by-step explanation:

General formula for the circmference of a circle=2πr

π=3.142

Diameter is given in the question so to determine the radius

Radius=diameter/2

Radius=30/2

Radius=15

Circumference=2πr

=2×3.142×15

=94.26

So the final answer is 94.26

5. A soccer ball is kicked from the ground level with an upward velocity of 60 feet per second. The
equation h(t) = -16t2 + 60t gives the height of the ball after t seconds.
a) What is the height of the ball after 1 second?

Answers

Answer:

-16(1)^2+60(1)= -16+60=44

Step-by-step explanation:

What shape has 5 vertices and 3 sides

Answers

Answer:

a polygon

Step-by-step explanation:

A quadrilateral is a polygon. The shape that has more than 3 sides and less than 5 vertices is a quadrilateral.

What is a quadrilateral?

A quadrilateral is a polygon with 4 number of sides and 4 vertices. A few examples of a quadrilateral are square, rectangle, rhombus, parallelogram, etc.

The complete question is: What shape has only straight sides more than 3 sides and has fewer than 5 vertices and can be cut into fourths?

Since we need to cut the shape into four equal parts, Also the number of sides should be greater than 3, while the number of vertices should be less than 5. Therefore, the shape that fits these criteria is a quadrilateral. For example, square, rectangle, etc.

Learn more about Quadrilateral:

https://brainly.com/question/13805601

Find the greatest common factor of 50, 25, and 100.

Answers

Answer:

25

Step-by-step explanation:

Find factors of:

25: 1, 5, 25

50: 1, 2, 5, 10, 25, 50

100: 1, 2, 4, 5, 10, 20, 25, 50, 100

Reduce possibilities to only common factors

25: 1, 5, 25

50: 1, 5, 25

100: 1, 5, 25

The greatest of these factors is 25

Greatest Common Factor (GCF) = 25

Hope this helps :)

Rewrite 100,000 as a power of 10

Answers

10^4=100,000
Hope this helps :)

Answer:

10⁵

Step-by-step explanation:

100000 = 10⁵

you have five $1 bills, four $5 bills, six $10 bills, and three $20 bills you select a bill at random, without replacing the bill what is the probability of a 1 then a ten?
a.11/35
b.5/51
c.5/54
d.193/306

Answers

Answer:

Option B.

Step-by-step explanation:

It is given that,

Number of $1 bills = 5

Number of $5 bills = 4

Number of $10 bills = 6

Number of $20 bills = 3

So,

Total number of bills = 5 + 4 + 6 + 3 = 18

We need to find the probability of a 1 then a ten (without replacement).

Probability of selecting $1 bill in first draw [tex]=\dfrac{5}{18}[/tex]

After one draw, the number of remaining bills is 18 - 1 = 17.

Probability of selecting $10 bill in second draw [tex]=\dfrac{6}{17}[/tex]

The probability of a 1 then a ten is

[tex]P=\dfrac{5}{18}\times \dfrac{6}{17}=\dfrac{5}{51}[/tex]

Therefore, the correct option is B.

Each day Donna and Mary toss a coin to see who buys the other person coffee ​($2.34 a​ cup). One tosses and the other calls the outcome. If the person who calls the outcome is​ correct, the other buys the​ coffee; otherwise the caller pays. Assume that an honest coin is​ used, that Mary tosses the​ coin, and that Donna calls the outcome. Find​ Mary's expected payback. Is this a fair​ game?
Now how much is she expected to pay back?

Answers

Answer:

The game is not fare $4.68

Step-by-step explanation:

brainlist will be welcom :))

what is 2 x 2 =
PLEASE HELP

Answers

Answer:

4

Step-by-step explanation:

Answer: 4

because 2 times 2 is just like 2 plus 2

Use the elimination method to solve the system of equations. Choose the
correct ordered pair.
3x + 5y = 48
-3x+ 5y = 12

Answers

Answer: x=6

Y=6

Step-by-step explanation:

Using the elimination method

3x+5y=48.....equ1

-3x+5y=12......equ2

Add equation 1 &2

3x+5y=48

+

-3x+5y=12

Answer =

10y=60

Y=60/10

Y=6

Substitute for y in equation 1

3x+5y=48

3x+5(6)=48

3x+30=48

3x=48-30

3x=18

X=18/3

X=6

Therefore,

X= 6

Y= 6

Answer: x=6

Step-by-step explanation:

Let's solve your system of equations by elimination.

3x+5y=48;−3x+5y=12

Steps:

3x+5y=48

−3x+5y=12

Add these equations to eliminate x:

10y=60

Then solve

10y=60

for y:

10y/10=60/10

(Divide both sides by 10)

y=6

Now that we've found y let's plug it back in to solve for x.

Write down an original equation:

3x+5y=48

Substitute

6 for y in 3x+5y=48:3x+(5)(6)=48

3x+30=48

(Simplify both sides of the equation)

3x+30+−30=48+−30

(Add -30 to both sides)

3x=18

3x/3=18/3

(Divide both sides by 3)

x=6

Help me this is important

Answers

So the answer is of option D.

KHD M D CM
2.5 L = [?] ml
Enter

Answers

Answer:      0.0025ml

Step-by-step explanation:

Emily and Lydia go to the movie theater and purchase refreshments for their friends. Emily spends a total of $78.50 on 2 bags of popcorn and 8 drinks. Lydia spends a total of $89.50 on 4 bags of popcorn and 7 drinks. Write a system of equations that can be used to find the price of one bag of popcorn and the price of one drink. Using these equations, determine and state the price of a drink, to the nearest cent.

Answers

The price of one drink is $7.5

The price of one bag of popcorn is $9.25

Step-by-step explanation:

Let us assume,

The price of one bag of popcorn = xThe price of one drink = y

Emily spends a total of $78.50 on 2 bags of popcorn and 8 drinks.

⇒ 2x + 8y = 78.5  -------(1)

Lydia spends a total of $89.50 on 4 bags of popcorn and 7 drinks.

⇒ 4x + 7y = 89.5  --------(2)

To solve for x and y values :

Multiply eq (1) by 2 and subtract eq (2) from eq (1),

  4x + 16y = 157

- (4x + 7y = 89.5)

        9y = 67.5

⇒ y = 67.5/9

⇒ y = 7.5

∴ The price of one drink is $7.5

Substitute y = 7.5 in eq (1),

⇒ 2x + 8(7.5) = 78.5

⇒ 2x + 60 = 78.5

⇒ 2x = 78.5 - 60

⇒ 2x = 18.5

⇒ x = 18.5/2

⇒ x = 9.25

∴ The price of one bag of popcorn is $9.25

A dartboard has 3 equal sections. A player gets 2 throws. If he misses the dartboard he gets 0 points. His final score is the sum of the points he receives on both throws. How many different point totals are possible?

Answers

Answer:4

Step-by-step explanation:

Find the radius of circle if AB = 24 and OC = 5

Answers

Answer:

13

Step-by-step explanation:

Since OCB forms a right triangle, you can find the length of side OB and therefore the radius by simply using the pythagorean theorem. The first step is to note that, since AB=24 and OC bisects that, that both CB and AC have length 12. Therefore, the radius is [tex]BO=\sqrt{12^2+5^2}=13[/tex]. Hope this helps!

Other Questions
40% of OatyPop cereal boxes contain a prize. Hannahplans to keep buying cereal until she gets a prize. What isthe probability that Hannah only has to buy 3 or lessboxes before getting a prize?We need to design a simulation. Which random device can we use to BESTrepresent this situation?Use a double-sided coin andassign heads as the prize andtails as no prize.Use a number cube with thenumbers 1 through 6 and assign1 through 2 as the prize and 3through 6 as no prize.Use a random number generatorranging from 1 to 10 and assign1 through 4 as the prize and 5through 10 as no prize.Use a deck of cards and assignspades as the prize and allother suits as no prize. There are three groups that contain carbon but are not organic compounds:carbon chlorides carbon oxides carbon iodides carbides carbonates When should you use the median and interquartile range as your measure of center and measure of variability tocompare populations shown on a box plot? Check all that applywhen there are outliers in the data setswhen there are no big gaps in the middle of the data setswhen the plots representing the data are symmetricalwhen the plots representing the data are nonsymmetricalwhen there are no outliers in the data setIntroDone To assist with a class demonstration, a student (whose mass is 60 kg) filled a water balloon with 2 kg of water. He then climbed to the second floor (10 metres) of the school and held the balloon out of a window. How much work did the student do? What is it called when plants give off water vapor as a waste product? Jason is entering a weight lifting contest. Gurrently, his maximum bench press weight is 105 pounds. If he increases the weight by 7 pounds each week, What is the maximum weight he be able to bench press after 13 weeks? Which statement best summarizes the central idea of thisexcerpt?DOUO One must know the process of hiring servants.0 It is important to always honor one's servants.O It is necessary to choose trustworthy servants.O The intelligence of servants must be considered.herofich 1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes. if tan 0= -3/8 which expression is equivalent to cot0? A fairground ride spins its occupants inside a flying saucer-shaped container. If the horizontal circular path the riders follow has a 6.75 m radius, at how many revolutions per minute are the riders subjected to a centripetal acceleration equal to that of gravity What should you expect to happen if you participate in a poetry workshop? Gothic archtiture rarely used on the outstide of cathedrals and churhes. true or false Theo's Survey ResultsEye ColorBrown BlueBoy2525GenderGirl2525Theo recorded the gender and eye color of students walking in the hallway at his middle school. What is theexperimental probability in simplest form that the next student he sees will be a boy with brown eyes?