Brianna recorded the high temperatures in her town each day for 8 consecutive days. Her data are shown. 78 , 65, 72 , 80, 68 , 77, 75 , 52 Which is not a true statement about the data ?

Answers

Answer 1

Answer:

D)50% of the temperatures are less than 77.5 degrees

Step-by-step explanation:

The correct amount of temperatures that are less than 77.5 degrees is 6/8, or 75%.  So D) is false.


Related Questions

What is the slope of each line? Line A: y = negative 5 x minus 2 Line B: y = 2 x + 3 The slope of line A Equals negative 5. The slope of line B Equals 2. The slope of line A Equals negative 2. The slope of line B Equals 3. The slope of line A Equals 5. The slope of line B Equals negative 2. The slope of line A Equals 3. The slope of line B Equals negative 2.

Answers

Answer:

A. -5, 2

Step-by-step explanation:

I got it right.

The slope of line A equals negative 5 and the slope of line B equals 2. Then the correct option is A.

What is the equation of line?

The equation of line is given as

y = mx + c

Where m is the slope and c is the y-intercept.

The slope is the ratio of rising or falling and running. The difference between the ordinate is called rise or fall and the difference between the abscissa is called run.

The equations of line are given below.

Line A: y = –5x – 2

Then the slope of the line A will be

Slope A = –5

Line B: y = 2x + 3

Then the slope of the line B will be

Slope A = 2

The slope of line A equals negative 5.

The slope of line B equals 2.

Then the correct option is A.

More about the equation of line link is given below.

https://brainly.com/question/21511618

#SPJ2

How would you dilate the point (-3,2) by a scale factor of 1/2

Answers

you would multiply each value by the scale factor

Well there is a few ways

NEED HELP ASAP
which set of numbers could represent the lengths of the sides of right triangle

A. 7,9,11

B. 12,18,22

C. 10,15,20

D. 8,15,17​

Answers

We have to use Pythagorean Theorem to solve this. We square the two smallest sides, then add. If the sum is the square of the largest side, then it's our answer.

A. 7, 9, 11

49 + 81 = 130 121

B. 12, 18, 22

144 + 324 = 468 484

C. 10, 15, 20

100 + 225 = 325 400

D. 8, 15, 17

64 + 225 = 289 = 289

So, our answer is D

PLZ HELP!!!!!
3x/2 − 5/12
= 1/4

Answers

Answer:

x=4/9

Step-by-step explanation:

you have to multiply both sides by 12 to get 18x-5=3 then add 5 to both sides which would get you 18x=8, then divide both sides by 18 and you will get 4/9.

Complete the point-slope equation of the line through (-1,6) and (1,5).
Use exact numbers.
Y= 6

Answers

Answer:

Y-6=-1/2(x-(-1) )

Step-by-step explanation:

The Equation for the point-slope of the line is y - 6 = -1/2(x + 1).

What is the slope of a line?

A line's slope is defined as the ratio of the change in y coordinates to the change in x coordinates.

Both the net change in the y-coordinate and the net change in the x-coordinate are denoted by y and x, respectively.

Given coordinates (-1,6) and (1,5).

the slope of line is given by,

m = (y₂- y₁)/(x₂ - x₁)

y₂- y₁ = 5 - 6 = -1

x₂ - x₁ = 1 - (-1) = 2

m = -1/2

to find the equation at y = 6

when y = 6, x = -1

the equation is given by

y - y₁ = m(x - x₁)

y - 6 = -1/2(x -(-1))

y - 6 = -1/2(x + 1)

Hence equation of a line is y - 6 = -1/2(x + 1).

Learn more about the slope of a line;

https://brainly.com/question/16180119

#SPJ5



Suppose you only look at the height of the bars on the graph. Which conclusion would you MOST LIKELY reach?
A) Twice as many Democrats as Republicans agreed with the court.
B) Twice as many Republicans as Independents agreed with the court.
C) Three times as many Democrats as Republicans agreed with the court.
D) The total number of Republicans and Independents agreeing with the court is half the number of the Democrats that agreed.

Answers

Answer:c

Step-by-step explanation:

PLZZ HELPPP!!! Each edge of a wooden cube is 6 centimeters long. The cube has a density of 0.71 g/cm3
.

What is the mass of the wooden cube?

Enter your answer in the box.
g

Answers

Answer:

153.36g

Step-by-step explanation:

Density is defined as the ratio of mass per unit volume of a material.

Density = Mass/Volume

Given the edge of a cube which is equivalent to its length L to be 6cm.

Density of the cube = 0.71g/cm³

Volume of the cube = L³

Volume = 6³

Volume of the cube = 216cm³

Mass = Density × Volume

Mass of the cube = 0.71×216

Mass of the cube = 153.36grams

Answer:

153.36 grams

Step-by-step explanation:

Density is mass divided by volume: d = m/v.

Here, we already know that d = 0.71 g/cm³.

We can find the volume of hte cube. The volume of a cube is denoted by:

V = s³, where s is the side length

The cube's length is 6, so plug this in:

V = s³

V = 6³ = 216 cm³

Plug these values in:

d = m/v

0.71 g/cm³ = m / 216 cm³

m = 0.71 * 216 = 153.36 grams

The answer is 153.36 grams.

d equals 0.5+ 5T do you equals distance in miles and T equals time what are the independent and dependent variables

Answers

Answer:

Jillian walked 0.5 miles before she started jogging at an average pace of 5 miles per hour. The equation d = 0.5 + 5t can be used to relate the total distance, ...

Step-by-step explanation:

A sphere is cut into 8 congruent pieces. The radius of the sphere is 8 centimeters. One piece is shown in the diagram. What is the surface area of one piece of the sphere, as shown in the diagram? Express the answer in terms of π. 64π cm2 80π cm2 256π cm2 384π cm2

Answers

Answer:

B. 80pi cm^2

Step-by-step explanation:

Answer:

Option number 2

Step-by-step explanation:

Lucia has $600 in her checking account. She wants to spend part of this money on a computer. She wants to have exactly $250 left in her checking account after buying the computer. The equation shown can be used to find t, the amount of money in dollars that Lucia can spend on the computer: t + 250 = 600 Which solution represents the correct answer? *

Answers

Answer:

t = 350

Step-by-step explanation:

subtract 250 from each side, and then you'll have t = 350

Answer:

350

Step-by-step explanation:

600 minus 250 =350

350 plus 250 =600

I basically did the inverse operation to solve this equation    

lol2
Where's the Lie?
Here are three statements that Tiana wrote about this
exponential
One of the statements is a lie. Which is it?
A. For very large values of x, the exponential has very large
values of y.
OB. The y-intercept of the exponential is (0,1).
C. The point (-2,4) is on the exponential.
Explain how you know it's a lie.

Answers

Answer:

A.

Step-by-step explanation:

As the x value is increasing the y is decreasing because the graph shows exponential decay.

The graph of a simple exponential function always pass through (0,1)

The statement that is a lie is (a) For very large values of x, the exponential has very large  values of y.

From the graph, we have the following highlights

The graph passes through point (0,1); this means that the y-intercept is (0,1).The graph passes through (-2,4)

The above highlights mean that options (b) and (c) are true, while option (a) is a lie

Option (a) is a lie because, as the value of x increases, the value of y increases.

Read more about exponential functions at:

https://brainly.com/question/11487261

Alex puts his spare change in a jar every night. If he has $11.09 at the end of January, $22.27 at the end of February, $44.35 in April, $75.82 in July, $89 in August, and $114.76 at the end of October, perform a linear regression on this data to complete the following items. What does the value of the correlation coefficient tell you about the correlation of the data? Write the equation of the best-fitting line. On average how much money does Alex add to the jar each month? Alex wants to buy a video game console at the end of December for $140. Will he have enough for this purchase. Show equation. THANK YOU!

Answers

the answer is about $22 each month and no he will not have enough

What is the upper quartile in the box plot? A box-and-whisker plot. The number line goes from 100 to 125. The whiskers range from 104 to 125, and the box ranges from 107 to 122. A line divides the box at 119.

Answers

Answer: cncnnc

Step-by-step explanation:

true false no my

Answer:

Ya'll the answer is 122

Step-by-step explanation:

I checked in with the AI helper and he would always help me, also I got the answer from the AI.

:) hope this helps

      and if your ever stuck on a question,

       Ginny the AI will come to help u Byeeeee :D

Estimate by rounding each number to the nearest ten thousand and then subtract

Answers

Answer:

50,000

Step-by-step explanation

80,000 - 30,000 = 50,000

80,000-30,000=50,000

A square in a rectangle have the same perimeter. The length of a side of the square is 4x-1. The length of the rectangle is 2x+2 and the width is 2x

Answers

The value x is 1, if the perimeter of square and rectangle are same. The perimeter of square and rectangle is 12 units.

Step-by-step explanation:

The given is,

                A square in a rectangle have the same perimeter

                The length of a side of the square is 4x-1

                The length of the rectangle is 2x+2 and width is 2x

Step:1

                Let, a - Side of square

                        l - Length of the rectangle

                       w - Width of the rectangle

Step:2

                Formula for perimeter of square is,

                                    [tex]p=4a[/tex].............................(1)

                Formula for perimeter of rectangle is,

                                   [tex]p=2(l+w)[/tex]....................(2)

Step:3

                From given,

                            Equation (1) = Equation (2)

                                 [tex]4a = 2 (l+w)[/tex]

               where,

                         a = 4x-1

                          l = 2x+2

                         w = 2x

               Substitute the values,

                       4 ( 4x-1 ) = 2 ( 2x+2+2x )

                            16x - 4 = 2 (4x + 2)

                            16x - 4 = 8x + 4

                          16x - 8x = 8                      

                                   8x = 8

                                     x = 1

Step:4

         Substitute the values of x,

                   a = 4(1)-1 = 3

                     l = 2(1)+2) = 4

                   w = 2(1) = 2

          Perimeter of square and rectangle is 12 units

Result:

           The value x is 1, if the perimeter of square and rectangle are same. The perimeter of square and rectangle is 12 units.

whats the solution to the model below?

X=3
x=1
x=2
x=7​

Answers

Answer:

[tex]2x + 4 = 10[/tex]

[tex]2x = 6[/tex]

[tex]x = 3[/tex]

Slope is found by dividing the change in ____ by the change in ____. x; y y; x

Answers

Answer:

Change in Y by the Change in X.

Step-by-step explanation:

Slope can be found by dividing the rise (change in y) by the run (change in x).

[tex]m =\frac{rise}{run} = \frac{y_{2}-y_{1}}{x_{2}-x_{1}}[/tex]

Answer: y;x

Step-by-step explanation: USATESTPREP

You’re welcome :)

Point A (-3, 5) is rotated 180º about the origin. What are the coordinates of A' after the rotation?

Answers

Final answer:

A point when rotated 180º about the origin flips the sign of the coordinates. Thus, point A' after rotating point A (-3,5) 180º about the origin would have coordinates (3,-5).

Explanation:

A rotation of 180º about the origin essentially changes the signs of the coordinates. If we have Point A as (-3, 5), after a 180° rotation about the origin, you'll get Point A', which will be the opposite of Point A. That means it turns (-3, 5) to (3, -5).

Rotation about the origin flips the point across both axes. This is based on a rule in mathematics: When we rotate a point 180° about the origin, (x, y) becomes (-x, -y).

The coordinates of A' after the 180° rotation are (3, -5).

Learn more about Rotation here:

https://brainly.com/question/34828607

#SPJ2

Kayla randomly surveyed the eight-grade classes at her school and found that 12 out of 50 own a pet. Based on these data, how many of the 150 eight-grade students in kayla’s school would be expected to own a pet?

Answers

Answer: The answer should be 36

Answer:

36 students

Step-by-step explanation:

Set up a proportion

12/50=x/150

Cross multiply

50x=1800

Divide by 50 on both sides

x=36

So 36 out of 150 8th grades students would be expected to own a pet

Hope this helps! :)

22. There are 31 girls and
25 boys in the marching band. When
the band marches, they are in 7 rows.
How many people are in each row?

Answers

Answer:

8

Step-by-step explanation:

To solve this problem, you need to divide the total number of people the by the amount of rows you have to see how many people can fit in each row.

With 31 girls and 25 boys, you have a total of 56 people.  Divide 56 by 7 to get 8.

You will have 8 people in each row.

Answer:

8 people.

Step-by-step explanation:

31 + 5 = 36. 36 + 20 = 56.

56 divided by the number of rows which is 7 in this case = 8.

There will be 8 people per row. Consisting of males and females.

P.S

Have an Amazing Day, I Hope this Helps and Good Luck!!

-Faker/Tosrel

2.65 multiply by 100

Answers

Answer:

265

Step-by-step explanation:

Answer:

265

Step-by-step explanation:

gimme brainliest plz

Graph the line x = -3

Answers

Answer:

Draw a vertical line passing through (-3,0)

I really need help on this sooo yeah​

Answers

Answer:

XVW

Or

WVX

Step-by-step explanation:

Since it's an isosceles triangle, it can either be:

XVW

Or

WVX

Select the correct answer. If the graph of function g is 6 units below the graph of function f, which could be function g? f(x) = -2x + 7
A. g(x) = -2x − 6
B. g(x) = -2x + 20
C. g(x) = -6x + 7
D. g(x) = -2x + 1

Answers

D. g(x) = -2x + 1
this is because if you wanted the function to be six below, the slope would not change but the y-intercept would go down 6

Answer:

D

Step-by-step explanation:

Eric is reading a book that has 144 pages. He reads 8 pages a day. How many days will it take Eric to finish reading the book?

Answers

Answer:

It will take him 18 days to finish the book.

Step-by-step explanation:

[tex]144/8=18[/tex]

Answer:

18

Step-by-step explanation:

You divide 144 by 8 and get the answer.

Martina is currently 12 years older than her cousin Joey. In 4 years she will be 3 times as old
as Joey. Use this information to answer the following questions.

Answers

[tex]\Huge{\underline{\underline{\sf{\red{AnSwEr:}}}}}[/tex]

[tex]\boxed{\sf{Martina's \: Present \: age = 14 \: years}}[/tex]

[tex]\boxed{\sf{Her \: cousin's \: Present \: age = 2\: years}}[/tex]

[tex]\Huge{\underline{\underline{\sf{\green{ExpLaNaTion:}}}}}[/tex]

= Let Martina's cousin's age be = n

= Let her age be = n+12

After four years,

Cousin's age = n+4

Her age = n+12+4=n+16

But according to the question her age = 3(n+4) = 3n+12

Thus,

3n+12=n+16

3n-n=16-12

2n=4

n=4/2

[tex] \boxed{ \sf {n = 2}}[/tex]

Thus ,

Her cousin's present age = n = 2

Her cousin's present age = n = 2Her present age = n+12 = 2+12=14

An icicle is in the shape of an inverted cone with a diameter of 9 mm and a height of 27 mm. In cubic millimeters, how much frozen water is in the icicle? Use 3.14 for . Round your answer to the nearest hundredth.

Answers

Answer:

volume ≈ 572.27 mm³

Step-by-step explanation:

The icicle is in the shape of an inverted cone with a diameter of 9 mm and a height of 27 mm. To find how much in cubic millimetres the frozen water is in the icicle can be calculated below.

In other words the question want us to find the volume of the cylinder. The volume of the cone can be represented as follows:

volume of a cylinder = 1/3πr²h

where

r = radius

h = height

diameter =  9 mm

height = 27 mm

r = diameter/2 =  9/2 = 4.5

volume = πr²h

volume = 1/3 × 3.14 × 4.5² × 27

volume = 1/3 × 3.14 × 20.25 × 27

volume = 1/3 × 63.585 × 27

volume = 1716.795/3

volume = 572.265 mm³

volume ≈ 572.27 mm³

Answer:

572.27 mm³

Step-by-step explanation:

What is the volume (in cubic feet) of the composite shape rounded to the nearest whole number.
https://lh4.googleusercontent.com/vUIfZHaKxbdifO93idzlasRKfEgvrv14A-EqM3jgStNqNpMzpBqIf2mI5R_S4juEGlQnyVlZfDxjJFMkbmYu5Gt7LyBl241M1XtOtKLHXRidvyOygtO4tvdkcTuU=w147

Answers

Answer:

109.956

Step-by-step explanation:

Formula for Volume of Cylinder: V = (pi)r^2H

84.823 + 25.133 = 109.956 (in cubic feet)

15 Points! Can someone help me with this?

Answers

Given:

Spinning top is in the shape of a square pyramid.

Side length of the base = 32 mm

Height of the pyramid = 32 mm

To find:

Volume of the spinning top

Solution:

Volume of the square pyramid:

[tex]$V=\frac{1}{3} b^{2} h[/tex]

[tex]$V=\frac{1}{3} \times (32)^{2} \times 32[/tex]

[tex]$V=1024 \times 32[/tex]

[tex]V=10922.66[/tex] cubic millimeter

The volume of the spinning top is 10922.66 cubic millimeter.

For a class project, a teacher cuts out 15 congruent circles from a single sheet of paper that measures 6 inches by 10 inches. How much paper is wasted?

Answers

Answer:

60 – 15π square inches

Step-by-step explanation:

Assuming a diameter of 2 inches for each circle, then because the height of the sheet is 6 inches and the length is 10 inches, 5 columns of 3 circles each, are formed (see picture attached).

The area of each circle is: (π*D^2)/4 = (π*2^2)/4 = π square inches

The area of the 15 circles is: 15π square inches

The area of the sheet is = 6*10 = 60 square inches

The wasted paper is equal to the difference between the area of the sheet and the area of all circles, that is, 60 – 15π square inches

Answer:

60 – 15π square inches

Step-by-step explanation:

Other Questions
Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings? What made Jake suspicious about the man with the camera?he was wearing dark glasseshe took a photo of themhe was the same man who sold Jake the maphe had followed them all dayIts C A researcher has developed a measure of a person's ability to detect colors. He finds the measure is not related to a person's spelling ability, which is a different type of measure. This finding is an example of _______ validity.a. convergentb. discriminantc. faced. concurrent Put in the counts under the notesPlease me help me The impact of the foot-in-the-door phenomenon is most clearly illustrated by What is the area of a rectangle 15 feet by 2 feet's rectangle. The shape of a flag is a rectangle. The length is 15 ft. And the width is 2 feet. What is the total area of the rectangle? Under what condition were Roman women allowed to run businesses?