can someone help with this

Can Someone Help With This

Answers

Answer 1
A graph shows the percentage is less than 3% before t=0.437 and after t=22.897.

In Set Notation, this might be written as
  {x | (x ≤ 0) ∪ (x ≥ 23)}

In Interval Notation, this might be written as
  (-∞, 0] ∪ [23, ∞)

Related Questions

What is the scale factor of figure ABCD?

a. 1/3

b. 4/3

c. 3

d. the figure isn't dilated properly

Answers

we know that
measure ABCD=scale factor*[measure A1B1C1D1]

in the axis of the y coordinate
we have
scale factor=measure ABCD/measure A1B1C1D1
scale factor=3/1----->3

in the axis of the x coordinate
we have
scale factor=measure ABCD/measure A1B1C1D1
scale factor=8/6----->4/3

therefore

the answer is the option
d. the figure isn't dilated properly

The data set below shows the weights of some puppies, in pounds, at a kennel: 10, 11, 11, 12, 13, 13, 13, 14, 15 Which histogram represents the data set?

Answers

The sample size of the data set is 9.The range of the data is 10 - 15.
Group the data into 5 bins according to the table shown below.
Bin   Count-----  --------- 10      3 11       1 12      2 13      0 14      2 15      1
A plot of the histogram n shown in the figure.The data is skewed toward a value of 10, which has the largest frequency of 3.The average is 12, and the median is 12.

Answer:

I think it is C

Step-by-step explanation:

NEED HELP ASAP PLEASE

Answers

Divide any term by the previous term.

For example,

(3/28) / (-1/4) = 3/28 * (-4/1) = -12/28 = -3/7

Answer: -3/7

Josefina spent 20 + 3b dollars on a pair of earrings and three blouses that cost b dollars each how much did she spend in all if each blouse cost 15 $

Answers

She spent $65.

Step by Step-

She spent $15 on 3 blouses, so you would multiply and get that she spent $45 on blouses.

You would then add that to the $20 she spent before, and get $65.

Therefore, she spent $65.

Hope this helps!!

Josefina spent $65 in total, with $20 on earrings and $45 on three blouses at the cost of $15 each.

Calculating Total Cost

Josefina spent a certain amount of money on a pair of earrings and three blouses. The cost of the pair of earrings is separate from the blouses and is a fixed amount of $20. Each blouse costs $15, and she bought three blouses. Therefore, the total cost for the blouses is 3 times $15, which equals $45. To find the total amount Josefina spent, we need to add the cost of the earrings to the cost of the blouses.

Total spent on blouses = 3 * $15 = $45

Cost of the earrings = $20

Total amount spent = Cost of the earrings + Total spent on blouses

Total = $20 + $45 = $65

Therefore, Josefina spent a total of $65 on her purchase.

A lifeboat can carry up to 24 people. Write an inequality to represent this situation

Answers

the inequality is n<24
hoped it helped
brainlist plz
If x represents the number of people that the lifeboat is carrying, and the lifeboat can be empty at the very least, then the inequality would be: 0[tex] \leq [/tex]x[tex] \leq [/tex]24

2.
Find the annual percentage rate, using the annual percentage rate table.
Amount Financed: $8,900

Finance Charge: $1,030.62

Number of Payments: 24

Answers

Amount Financed: $8,900
Finance Charge: $1,030.62
Number of Payments: 24

(Finance Charge)/(Amount Financed)*100$=($1,030.62)/($8,900)*100$
(Finance Charge)/(Amount Financed)*100$=(0.1158)*100$
(Finance Charge)/(Amount Financed)*100$=$11.58

In the row of number of Payments 24, we look for:
(Finance Charge)/(Amount Financed)*100$=$11.58, and we to which annual porcentage rate it corresponds in the first row

Answer: The annual percentage rate is 10.75%

Two trucks started traveling from the same place at 9:00 a.m. One truck traveled North going 45 mph and the other traveled South going 50 mph. What time will it be when the trucks are 380 miles apart?

Answers

Short Answer 1 PM
Givens
South bound truck's rate = 50 mph
North bound truck's rate = 45 mph
Distance apart = 380 after time t
The time that passes = t

Equations
d = r * t
d1 + d2 = 380
d1 = r_south * t 
d2 = r_north * t

Substitute and solve.
r_south * t + r_north * t = 380
50*t + 45*t  = 380 Combine like terms.
95t = 380  Divide by 95
t = 380 / 95
t = 4 hours

Answer
t = 9:00 + 4 hours = 1300 hours = 1:00 PM  <<<< answer

Answer: 1:00 PM

Step-by-step explanation:

Leon deposited $30000 in a bank which paid 2% interest per year. After 1 year, Leon withdrew all his money including the interest. how much money did Leon withdraw?

Answers

The amount of money Leon had after 1 year will be given by:
A=P(1+r)^n
where:
P=principle
r=rate
n=time
But from the information given:
P=$30,000, r=2%, n=1 year
thus
A=30000(1+2/100)^1
A=30000(1.02)^1
A=$30600
Thus amount after 1 year was $30600

Find the greatest common factor of 30 and 60

Answers

The greatest common factor of 30 and 60 is 15 because 15 times 2 is 30 and 15 times 4 is 60.

I hope this helped

A collection of dimes and quarters worth $9.25. There are 46 coins in all. Find how many of each there are. How many dimes are there?

Answers

If all were quarters, the value would be 46*$0.25 = $11.50. The actual value is $2.25 less than that. Replacing a quarter with a dime reduces the value by $0.15, so there must be $2.25/$0.15 = 15 dimes

There are 15 dimes.

Identify one characteristic of exponential growth.

A. A graph that is an increasing curve
B. A common ratio between 0 and 1
C. A common ratio less than 0
D. A common difference greater than 0

Answers

A. Exponential growth is called growth because it increases, so A is correct.
B. A common ratio between 0 and 1 would result in decay, not growth
C. A common ratio less than one would just reflect the graph across the x-axis. It does not give any information about whether or not it is exponential growth.
D. Exponential growth functions have no common differences.

Thus, A is the correct answer.

Exponential growth features a quantity increasing at a constant growth rate. The correct answer is Option A.

Exponential growth is characterized by a situation where a quantity increases at a constant growth rate. It is often represented graphically by an increasing curve.

This means that as time progresses, the rate at which the quantity grows also increases. For example, the population of a species might grow slowly at first, but as it becomes larger, the growth rate accelerates.

Given the options in the question, the correct answer is:

Option A. A graph that is an increasing curve

Sam entered three functions into a graphing calculator, y1 = x + 2, y2 = x2 + 2, and y3 = 2x. A portion of the table created by those functions is shown below.

Answers

We have the following functions:
 y1 = x + 2
 y2 = x ^ 2 + 2
 y3 = 2 ^ x

 For x = 0:
 y1 = 0 + 2 = 2
 y2 = 0 ^ 2 + 2 = 0 + 2 = 2
 y1 = y2

 For x = 5
 
y2 = 5 ^ 2 + 2 = 25 + 2 = 27
 y3 = 2 ^ 5 = 32
 y3> y2

 For x = -1:
 y1 = -1 + 2 = 1
 y2 = (-1) ^ 2 + 2 = 1 + 2 = 3
 y3 = 2 ^ (- 1) = 1/2 = 0.5
 y3 <y1 <y2

 Answer:
 y1 = y2
 
y3> y2
 
y3 <y1 <y2

Find the area in the first quadrant under the curve y = 1 / (x^2+6x+10)

Answers

The area is given by

[tex]\displaystyle\int_0^\infty\frac{\mathrm dx}{x^2+6x+10}[/tex]

Complete the square in the denominator:

[tex]x^2+6x+10=x^2+6x+9+1=(x+3)^2+1[/tex]

then substitute [tex]x+3=\tan y[/tex], so that [tex]\mathrm dx=\sec^2y\,\mathrm dy[/tex]. Then as [tex]x\to0^+[/tex], we have [tex]y\to\arctan3[/tex]; as [tex]x\to\infty[/tex], we have [tex]y\to\dfrac\pi2[/tex]. So the integral becomes

[tex]\displaystyle\int_{\arctan3}^{\pi/2}\frac{\sec^2y}{\tan^2y+1}\,\mathrm dy=\int_{\arctan3}^{\pi/2}\mathrm dy=\dfrac\pi2-\arctan3[/tex]

Hey can you please help me posted picture of question

Answers

Answer: option C. Emily got 12 text messages, adn 5 were from Jasmine. The probability a text message is from Jasmine is 5/12.

Explanation:

All the other options are theoretical probabilities because they were determined using the equation:

probablity = number of positive events / total number of possible events.

While, experimental probabilities are determined from actual results of an experiment (test). That is what the option C. describes. It compares the number of times that she actually got a message (5) with the number of trials (12). It is not determined theoretically.

Multiple 3/4 times 16/9

Answers

3/4 times 16/9 is equal to 1 1/3.
Short Answer: 4/3
Remark
Before doing the multiplication, you should do a cancellation. You can cancel fractions by dividing any numerator by the same thing that will go into any denominator or vica versa.

3 goes into 9 = 3
4 goes into 16 four times.

So the fraction cancellation looks like this.
[tex] \frac{ \frac{16}{4} }{ \frac{9}{3} } = \frac{ \frac{4}{1} }{ \frac{3}{1} } = \frac{4}{3} [/tex]

BRAINLIEST!!!!


Triangle Z' is the image of triangle Z after a series of transformations.
Aliyah and Ivan described the sequence of transformations in different ways.
Which sequence or sequences are correct and why?

GRID AND ANSWERS PROVIDED IN IMAGES!

Answers

Both Aliyah and Ivan are correct because both chose the correct scale factor for the dilation and both describe other transformations that would produce triangle .  

Answer:

The third option is correct.

Step-by-step explanation:

PLEASE HELP ASAP Arrange the expressions in increasing order of their values.

(10⁰x 10¹ x 1¹⁰) (10 x 10¹) (10⁰+10¹+1¹⁰) (10⁰+10¹x 1¹⁰)

Answers

For this case we have the following expressions:
 (10⁰x 10¹ x 1¹⁰)
 (10 x 10¹)
 (10⁰ + 10¹ + 1¹⁰)
 (10⁰ + 10¹x 1¹⁰)
 Rewrite we have:
 (1x 10 x 1) = 10
 (10 x 10) = 100
 (1 + 10 + 1) = 12
 (1 + 10x 1) = 11
 Answer:
 
In increasing order we have:
 
(10⁰x 10¹ x 1¹⁰)
 
(10⁰ + 10¹x 1¹⁰)
 
(10⁰ + 10¹ + 1¹⁰)
 
(10 x 10¹)

Final answer:

After calculating the values of the expressions, they can be arranged in increasing order of their values as follows:

(10⁰x 10¹ x 1¹⁰), (10⁰ + 10¹x 1¹⁰), (10⁰ + 10¹ + 1¹⁰), (10 x 10¹).

Explanation:

To arrange the expressions in increasing order of their values, we must first calculate the value of each expression.

(10⁰ x 10¹ x 1¹⁰): Here, 10⁰ = 1, 10¹ = 10, and 1¹⁰ = 1 (since any number to the power of zero is 1). Multiplying these together, we get 1 x 10 x 1 = 10.(10 x 10¹): This equals 10 x 10 = 100.(10⁰+10¹+1¹⁰): Adding these values together gives us 1 + 10 + 1 = 12.(10⁰+10¹ x 1¹⁰): Following the rules of operations (multiply before adding), first calculate 10¹ x 1¹⁰ which equals 10 x 1 = 10, then add 10⁰ which is 1. So, this gives 1 + 10 = 11.

Now we can arrange the expressions in increasing order:

(10⁰x 10¹ x 1¹⁰) (10⁰ + 10¹x 1¹⁰) (10⁰ + 10¹ + 1¹⁰) (10 x 10¹)

A 10-ounce container of chocolate chips can be used to make 3 desserts. Each dessert has the same amount of chocolate chips. Which equation shows how to find the number of ounces in each dessert? 10÷3=310 ounce 10÷3=103 ounces 3÷10=310 ounce 3÷10=103 ounces

Answers

The answer is 10 ÷ 3 = 3.33

Answer:

10 divided by 4 =10 over 4 is the correct answer guys if your doing think through math

Step-by-step explanation:

A rectangular table is six times as long as it is wide. If the area is 294 ftsquared​, find the length and the width of the table.

Answers

42 length   7 width
please respond back if it was correct

the width of a rectangular table is 7 feet and the length of a rectangular table is 42 feet.

The area of a rectangular table is 294 ft².

What is the area of a rectangle?

The area occupied by a rectangle within its boundary is called the area of the rectangle. The formula to find the area of a rectangle is Area = Length × Breadth.

Let the width of a rectangular table be x.

Then, six times as long as it is wide = 6x

Area of a rectangular table = 6x × x

⇒ 6x²=294

⇒ x²=49

⇒ x=7 feet

So, length=6x=42 feet

Therefore, the width of a rectangular table is 7 feet and the length of a rectangular table is 42 feet.

To learn more about the area of a rectangle visit:

brainly.com/question/20693059.

#SPJ2

# 14. Q. find the area of rectangle

Answers

The answer is 112 ft^2

You must multiply the height and the width.

8 x 14 = 112
Area of a rectangle is the product of its Length and Width.

Area = Length x Width

From figure we can see,

Length = 14 ft
Width = 8 ft

So, Area = 14 x 8 = 112 ft²

Thus, the option third gives the correct measure of Area for given rectangle 

15 + (-18) =
Please help quick

Answers

-3



hope this help........................

Factor completely a2 - 9a + 20

Answers

(a - 5)(a - 4)
You can check, the numbers add up, because -5 - 4 is 9, and 5 * 4 is 20
a^2-9a+20=a^2-5a-4a+20=(a^2-5a)+(-4a+20)
a^2-9a+20=a(a^2/a-5a/a)+(-4)(-4a/(-4)+20/(-4))
a^2-9a+20=a(a-5)-4(a-5)
a^2-9a+20=(a-5)[a(a-5)/(a-5)-4(a-5)/(a-5)]
a^2-9a+20=(a-5)(a-4)

WANT TO BE THE BRAINLIEST PLZ ANSWER STEP BY STEP

Answers

A and C, because the others are incorrect, if you look at the chart you can see that B and D are not true as its the complete opposite.
The answer is c because hip hop is preferred more than country in the 9-11 age group

Find the area of the circle r= 7

Answers

Area = π r² = π (7)² = 49π = 153.94 unit²

Which properties are necessary to claim that the two prisms are congruent? Check all that apply. The lengths of corresponding edges are in a 1:1 ratio. The volumes are equal. Corresponding angles have different measures. Corresponding faces are not congruent. The base areas are equal. The prisms have the same height.

ANSWER IS:
The base areas are equal.The prisms have the same height.
The lengths of corresponding edges are in a 1:1 ratio.The volumes are equal.

Answers

The base areas are equal.The prisms have the same height. The lengths of corresponding edges are in a 1:1 ratio.The volumes are equal.

The two prisms are congruent means that they have the same measures of bases, height, faces and angles.

Angles are congruent when they are the same size (in degrees or radians). Sides are congruent when they are the same length.

So, for congruent prisms, the corresponding angles are expected to be of the same sizes and the corresponding sides are expected to be of the same length.

Therefore the correct statements are:

The base areas are equal.

The prisms have the same height.

The lengths of corresponding edges are in a 1:1 ratio.

The volumes are equal.

Learn more:https://brainly.com/question/16202542

the hall family garden is 3/4 of an acre. if they divide their garden into 1/8 acre sections, how many sections will they have?

Answers

we know that
The hall family garden is ------------> 3/4 of an acre
if they divide their garden into 1/8 acre sections
so
(3/4)/(1/8)-------> (3/4)*(8)--------> 8*3/4------> 24/4-----> 6 sections

the answer is
6 sections

Answer:

6 sections

Step-by-step explanation:

GETS BRAINLIEST AND 11 PTS!

Maggie has 7 tiles with pictures of plants and 2 tiles with pictures of animals. Maggie keeps all the tiles on a mat with the pictures hidden and mixes them up. She then turns one tile face up and finds the picture of a plant on it. She removes this tile from the mat and turns over another tile without looking. What is the probability that the second tile that Maggie turns over has a plant on it? 22.2% 28.6% 65.0% 75.0%

@musiclover10045

Answers

I believe the answer to this one would be 75.0%

Analyze the diagram below and complete the instructions that follow.

Solve for y.

Answers

Y= 10 because you have a 180 degree angle split in half which equals 90 degrees so 3•30=90 the the other side has to equal 90 degrees so 2•30=60 then 3•10=30 so then just add 60 and 20 and there is your 90

how many lines of symmetry does the figure have??

Answers

Zero because its slanted

Answer: The given figure does not have any line of symmetry.

Explanation:

Since, Given figure seems a parallelogram.

And, a line of a symmetry is an imaginary line through which we get two same figure or unchanged figure. Or, we can say that Line of symmetry makes a reflection of a figure in which the size or shape of the figure does not change.

In the case of parallelogram diagonals must be the line of symmetry. But  any diagonal in parallelogram does not make symmetry. Therefore, there is no line of symmetry in parallelogram.

12% of 250 is what answer

Answers

The answer is 30.

Hope this helped :)
alisa202
Other Questions
Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure Summarize the narrative Churchill present