Describe two different methods that can be used to assist in solving crimes and missing-person cases. Explain the benefits of each.


Answers

Answer 1

Answer:

Explanation:

The DNA fingerprinting technique and development and comparison of physical fingerprints can be the methods used for the purpose of solving crimes and identification of missing person.  

The DNA fingerprinting can be done from the physical evidences such as blood, sweat, hair, tissues, teeth and other material obtain at crime scene. These can be compared with the suspects, victim and missing persons so as to establish their identity.

The physical fingerprints can be developed on the scene of crime and compared with the requested specimen from suspect, victim and the missing person or in case of impersonation to establish the desired identity.

Answer 2

This is about methods of getting evidence from a crime scene.

The 2 major methods and their benefits are explained below.

There are two major methods used and they are;

DNA Fingerprinting Technique

Physical Fingerprinting

1) The DNA fingerprinting is carried out by the use of human physical evidences gotten at the crime scene such as hair, blood, sweat, teeth e.t.c. What this method does is to carry out genetic tests on these things to find out if they can be compared with that of the person or persons they are seeking to identify in relation with the crime scene.

The main benefit of this method is that it can be used to create genetic profiles for suspected offenders as well as storing these results indefinitely to aid in future investigations.

2) The physical fingerprinting is used to link one crime scene of someone to another one crime scene of same person. This is good because no two persons can have the same fingerprint.

Read More at; https://brainly.com/question/3375358


Related Questions

i’m supposed to draw something for advantage but have no idea what to draw it’s due 9/12 anyone has an ideaa

Answers

Answer:

Explanation:

Draw stick figures then have one standing higher than the rest to show they have an advantage while the others don’t

Answer:

For number eight draw a person that's wealthy and a person blow them that's poor. It's a real life example of someone that is at a disadvantage

where does cell produce atp​

Answers

Enzym
It is very correct

because of biochemical cycling
A human activity has no effect on elements, chemical chemical compounds, and and no other form of living matter
B, living living organisms are not limited by any one nutrient
C nutrients are circulated throughout the biosphere
D, many nutrients do not reach toxic contractions in the biosphere
whoever is correct I will name brainliest​

Answers

Nutrients are circulated throughout the biosphere because of biochemical cycling.

Answer: Option C

Explanation:

Apart from vitality, water and a few other chemical components spin through biological systems and impact the rates at which life forms develop and duplicate. Around 10 noteworthy supplements and six minor nutrients are basic to all creatures and plants, while others assume significant jobs for chosen species.

The most significant biochemical cycles influencing environment well being of the water, carbon, nitrogen, and phosphorus cycles. Thus it is due to biochemical cycling, nutrients are circulated through out the biosphere.

define hydraphilic. which portion of the bilayer is hydrophilic?​

Answers

Answer:

hydrophilic is when something has the tendency to mix with water or be wetted by it.

lipids and phospholipids are hydrophilic

A girl carried a box of books up two flights of stairs to her attic. Her father carried a box the same weight up a ladder directly to the attic. The girl says she did more work on the box than her father because she walked further up the stairs, is she correct?

Answers

Answer:

The girl is correct because her father only went the distance of the ladder, whereas she went to the extension of two flights of stairs.

Explanation:

Final answer:

The work done by the girl and her father is the same. The discrepancy arises from the difference in perceived effort, not actual work done. In physics, work done against gravity for the same weight over the same vertical distance is equal, regardless of the path taken.

Explanation:

The question asked pertains to the concept of work in physics. According to the definition of work in physics, work is equal to the force applied to an object times the distance the object is moved in the direction of the force. The force in this scenario is the same, as the same weight box is being lifted. The distance is also the same (the vertical distance from the ground to the attic). Therefore, regardless of the path taken (flight of stairs or directly using a ladder), the work done is the same.

It might seem that more effort is required to carry the box up the stairs due to the longer path, however, this is likely due to the additional force required to fight against gravity while taking the longer route, but this doesn't constitute to additional work done in terms of physics. Work Done Against Gravity is the significant concept here. The energy changed from one form to another to overcome gravity remains the same in both cases

Learn more about Work and Energy here:

https://brainly.com/question/17290830

#SPJ2

Which statements describe what will most likely occur when warm air cools and the temperature drops to the dew point? Check all that apply.

A) Clouds form.
B) Air becomes more humid.
C) Solid ice forms on leaves.
D) Cumulus clouds disappear.
E) Water droplets form on grass.

Answers

Answer:

The correct choices are A,C AND E.

Explanation:

The formation of clouds occurs when the warm air cools and the temperature drops to dew point. The dew point can be describes as the temperature which occurs when the air becomes saturated into water vapour. The air becomes cooler and when humidity of 100% is acquired, water droplets form which lead to the formation of clouds. The formation of clouds has always been  known to occur when temperature drops to the dew point.

As the warm air cools, it also results in forming tiny water droplets on the grass especially in the morning times. This most likely happens when the day has been warm followed by a cold night. The water droplets formed on the grass are known as dew.

Final answer:

When air cools to the dew point, the moisture it holds condenses forming clouds and dew on grass surfaces. The air's humidity does not increase, rather, the relative humidity does. The process does not result in freezing nor make clouds disappear.

Explanation:

When warm air cools and the temperature drops to the dew point, certain phenomena occurs. The dew point is the temperature at which the air cannot hold all the moisture in it and some of it condenses as water vapor, leading to the formation of small droplets. The statements A 'Clouds form' and E 'Water droplets form on grass' best describe what will most likely happen, since clouds are formed due to condensation of water vapor in the air, and dew forms on grass for the same reason. Statement B 'Air becomes more humid' could be misleading; while it's true that the relative humidity increases (since it is defined as the ratio of the actual amount of water vapor in the air to the maximum amount of water vapor the air could hold at that temperature), the actual amount of water vapor does not increase. Statements C 'Solid ice forms on leaves' and D 'Cumulus clouds disappear' are not accurate as cooling to the dew point results in condensation, not freezing, and this process tends to create, not dissipate clouds.

Learn more about Dew Point here:

https://brainly.com/question/33345309

#SPJ6

A(n) _____ bond joins these two oxygen atoms.

Answers

Answer:

Covalent bond

Explanation:

which of these groups is the smallest level of classification

A. Phylum

B. Family

C. Order

D. Genus

Answers

Answer: Number D. Genus

Explanation:

Answer:

D. Genus

Explanation:

This is the smallest classification level because of all those named it is the one that covers the least organisms. This taxonomic level is between the level of species and family, that is, it covers only several related species. In order from largest to smallest the levels of organization are domain, kingdom, phylum, class, order, family, gender and species

A scientist observes plant roots growing through the mountain side. This is evidence for which type of natural process?

Answers

Answer:The answer is erosion

Explanation:

A scientist observes plant roots growing through the mountain side. This is evidence of Weathering

Explanation:

Weathering is the breaking down of rocks, soil, minerals. Weathering happens in the same place silently not happening as a sudden slide caused by erosion. Weathering is the natural process that takes place in the mountains.

Roots of lichens are pushed between the rocks. These slowly let their roots grow through the rocks. Then they slowly produce crack in the rocks and splits it. This happens slowly and gradually that it causes withering of the rocks.


Which of the following is an inference instead of an observation? Please answer correctly and show how it's correct maybe

A. The squirrel is gathering acorns in his cheeks

B. The boat is sailing on the lake in circles

C. The sun is hot today as it shines down on us at the park

D. Deer walked down the path earlier because of the prints in the mud

Answers

Answer:

D

Explanation:

A, B, and C, are all observing the situations, while D states the deer walked down the path earlier because of the tracks, this is hardly obersavable, and you would have to infere the deer took the path early.

Final answer:

'Deer walked down the path earlier because of the prints in the mud' is an inference, not an observation, as it is a conclusion made based on the observed deer prints. The correct option is D.

Explanation:

The answer to the question which statement is an inference rather than an observation is option D: 'Deer walked down the path earlier because of the prints in the mud.'

An observation refers to something that one directly sees, hears, or experiences, while an inference is a conclusion or assumption drawn from those observations. Options A, B and C are observations as they directly describe actions that are immediate and visible.

Option D, on the other hand, makes a prediction or inference about past events (deer walking) based on current observations (prints in the mud).

Learn more about Inference here:

https://brainly.com/question/33136743

#SPJ2

will mark brainliest

Answers

Answer:

The second one

Explanation:

As it says, there has been a rapid increase in global temperatures. Looking at the charts, we look at the year, then the temperature. In the first one, It goes from high, to higher, then to lower. So that one is incorrect. The third one, we start really high, then go lower. So that one is wrong. The last one starts high, then goes low, then high again. So that one is obviously wrong. The second one stars low, then goes higher. So, that one is the correct one. Does this help?

Answer:

I would go with option b while it is increasing at a more of a linear rate than exponential; it seems to be the only one really increasing.

What characteristics do all living things share

Answers

I had biology last year and these are the 8 things that make something a living thing


Here is the list of characteristics shared by living things:
Cellular organization.
Reproduction.
Metabolism.
Homeostasis.
Heredity.
Response to stimuli.
Growth and development.
Adaptation through evolution.

2. You consume a piece of candy that contains 150 glucose
molecules. Calculate the number of
1. carbon atoms you consumed:
Il hydrogen atoms you consumed:
ill. oxygen atoms you consumed:

Answers

When we consume a piece of candy we gain about 900 carbon atoms, 1800 hydrogen atoms and about 900 oxygen atoms.

Explanation:

The glucose molecule has a structure that contains 6 carbon atoms, 12 hydrogen atoms and about 6 oxygen atoms. The glucose is the only chemical that can go through the glycolysis, kerb cycle and the electron transport chain to yield ATP molecules.

This ATP molecules provide as a source of energy to the entire organism. The excess of glucose is stored in the form of glycogen in our body.

Which is associated with divergent boundaries?
a)ocean mountain chains
b)volcanic island ares
c)folded mountains
d)horsts and grabens

Answers

Volcanic island areas is associated with divergent boundaries

Answer: B. Volcanic island areas

Explanation:

Divergent boundaries in the middle of the ocean leads to the spreading of the seafloor. As the plates of the ocean separate and move apart, they produce breaks in the sea depths. Magma ascends from the mantle and overflows out from the breaks like a long, flimsy volcano.

This magma cools and ultimately forms igneous rock. Most dynamic plate boundaries happen between plates of the ocean and exist as mid-oceanic edges. Divergent boundaries likewise structure volcanic islands.

Answer:

B. Volcanic island areas

If a gene has only one allele, how many different traits can the allele produce?

Answers

Answer:

If you have 2 dominant alleles, the gene will be dominant, if you have 2 recessive alleles, the gene will be recessive. But if you have 1 recessive and 1 dominant, the Dominant allele will mask the recessive one.

Explanation:

Final answer:

If a gene has only one allele, it can produce one specific trait in an individual organism. However, within a population, multiple alleles for the same gene can exist, allowing for a range of traits to be expressed among the individuals in that population. The ABO blood type system in humans is an example of multiple alleles influencing various traits.

Explanation:

If a gene has only one allele, it can typically produce only one trait in an individual organism. This is because an allele is a specific version of a gene, and without an alternative allele to combine with, there is no variation at that gene locus in the individual's genotype. However, at a population level, multiple alleles may exist for the same gene, giving rise to various combinations of two alleles and hence multiple traits within the population.

An example of this phenomenon is the ABO blood type system in humans, where there are three alleles (IA, IB, and i) that can combine in different ways. These combinations result in the A, B, AB, or O blood types, showcasing how multiple alleles contribute to genetic diversity.

Still, it's important to note that while an individual organism with a single allele for a gene can typically only express one trait, the presence of multiple alleles at the population level allows for the range of observable traits (phenotypes) to expand beyond that single manifestation.

which of Thomas hunt Morgan‘s hypothesis was valid
white eyes are lethal in female Drosophila
white eyes are lethal in male Drosophila
white eyes are homozygous recessive in femal Drosophila
white eyes are the dominate trait in female Drosophila

Answers

Answer:

Option C, white eyes are homozygous recessive in femal Drosophila

Explanation:

Morgan's in his initial study crossed a white-eyed male fly with red-eyed females to see of the next generation has white eye. To his surprise, all the offspring in the next generation have red eye but somewhere he believed that might be these red eyed species have recessive white allele.  So he crossed the F1 generation species among themselves and found that in F2 generation 3 red eyed and 1 white eyed species is produced. The results were matching with the results obtained by Mendel’s pea plant experiment. But in case of Morgan, only males has white eye so to his surprise he first time observed a co-relation between a non sexual trait and gender of an individual . Later he crossed a white eyed male to a heterozygous red eyed female and found that the next generation has white eyed female

From this he concluded the following –  

a) The allele for white eye is not lethal neither in male nor in female and all sort of combinations are possible.

Answer:

C

Explanation:

Identify the organelle where photosynthesis takes place. Image of a plant cellshown with letters A to H showing various organelles. A points to the mitochondria. B points to the Golgi apparatus. C points to the nucleus. D points to endoplasmic reticulum. E points to the chloroplast. F points to the cell wall. G points to the cell membrane. H points to the vacuole. B C D E

Answers

Answer:

E

Explanation:

A chloroplast is the organelles in which photosynthesis takes in plants. The chloroplast has thylakoid lamellae that occasionally arrange itself into stacks called grana where there are photosystem units that have chlorophyll pigment. The chlorophyll pigments tap energy from the photons of sunlight and use it for photophosphorylation.

Chloroplast  is the organelle where photosynthesis takes place.

The correct option is E .

The chloroplast is the organelle where photosynthesis takes place in plant cells. It contains chlorophyll, a green pigment that captures sunlight and converts it into chemical energy through the process of photosynthesis. During photosynthesis, the chloroplasts use light energy, carbon dioxide, and water to produce glucose (a type of sugar) and oxygen. This process is crucial for plants as it provides them with the energy they need to grow and carry out various cellular functions.

Chloroplasts are specialized organelles found in plant cells and some other eukaryotic organisms, such as algae. They are the key sites for photosynthesis, a vital process that converts light energy from the sun into chemical energy in the form of glucose.

Hence , E is the correct option

To learn more about Chloroplast , here

brainly.com/question/11136550

#SPJ6

Cell Parts and Functions
Select the correct cell parts listed below to fill the blanks of the sentences or spaces that follow
cell membrane
cell wall
mitochondria
nuclear envelope
cytoplasm
nucleolus
vacuole
centriole
Golgi apparatus
lysosomes
ribosomes
chloroplast
smooth ER
nucleus
1. The
is the place where genes (DNA instructions for traits) are stored._____
2. The rough endoplasmic reticulum is studded with ribosomes and functions in the production of protein,
whereas the
functions in the synthesis of lipids and detoxification of harmful
substances._____
3. Structures normally found in animal cells that are involved in animal cell reproduction (aka, cell division)._____
4. Involved in making ribosomes in the cell, this structure is located in the nucleus._____
5. The structure is the outer covering of a cell and is involved in regulating the movement of materials (food,
gases, elements) in and out of the cell._____
6. Cellular respiration occurs in this organelle. Cellular respiration produces ATP for cell activities.
Therefore, the
is sometimes called the powerhouse of the cell."_____
7. The double membrane surrounding the nucleus that controls what enters and leaves it through nuclear
pores) is called the nuclear membrane or_____
8. Vesicles that contain digestive enzymes are_____
9. Outside the cell membrane of a plant cell is the
that also serves as
support and protection for the cell._____
10. Enzymes are proteins, and proteins are produced in this organelle_____
11. Sacs storing water, wastes and food are storage chambers in the cell called_____
12. Structure found in plants, but not animal cells, that carries out photosynthesis is the_____
13. The
is everything outside the nuclear membrane but inside the cell membrane
including the cytosol and structures within the cytosol._____
14. The structure of the cell that prepares and packages proteins for use within the cell for shipment outside
the cell._____

Answers

Answer:1 = nucleus,2= smooth endoplasmic reticulum,3=centrioles,4=nucleolus,5= cell membrane,6=mitochondria,7= nuclear envelope,8= lysosomes,9= cell wall,10= ribosomes,11= vacuole,12= chloroplast,13= cytoplasm and 14= Golgi apparatus

Explanation:

One function of the hematic system is to _____.

cause voluntary and involuntary motion
protect the body
transport substances in the body
distribute blood through the body

Answers

distribute blood through the body

The hematic system, or circulatory system, is crucial in transporting substances and distributing blood to all parts of the body. It enables nutrient and oxygen delivery, waste removal, defense mechanism operation, and helps in maintaining the body temperature and acid-base balance. The system also influences both voluntary and involuntary motions.

The function of the hematic system, also known as the circulatory system, primarily involves transporting substances in the body and distributing blood throughout the body. It reaches almost every cell, tissue, organ, and system in the body. The circulatory system is responsible for the transportation of materials, such as nutrients and oxygen, to different parts of the body, allowing our cells to function properly. Furthermore, it plays a critical role in our body's defense mechanism, distributing white blood cells and immune system antibodies to maintain our health. It also contributes to controlling body temperature and maintaining the acid-base balance.

Moreover, the circulatory system works closely with other body systems. For instance, it moves in conjunction with our body muscles, enabling us to perform both voluntary and involuntary motions. It also provides the physical site for the exchange of gases, nutrients, and other substances with body cells, ensuring effective metabolism and cellular processes.

Learn more about Hematic System here:

https://brainly.com/question/32155332

#SPJ6

There is a single Scientific Method that all scientists follow.
True False

Answers

Answer:

True

Explanation:

I did some research and all of it says that all scientists follow one scientific method

Yes scientist follow a set of procedures that is Make an observation.
Ask a question.
Form a hypothesis, or testable explanation.
Make a prediction based on the hypothesis.
Test the prediction.
Iterate: use the results to make new hypotheses or predictions.
AND WHEN THE HYPOTHESES FAILS THEY FORM A NEW HYPOTHESIS AND REPEAT THE SAME STEPS JUST TECHNICALLY A NEW QUESTION AND IF THE HYPOTHESIS IS TRUE ANOTHER SCIENTIST CAN FOLLOW THE SAME METHODS AND GET THE SAME RESULTS

Silver has two naturally occurring isotopes. Ag-107 has an abundance of 51.82% and a mass of 106.9 amu. Ag-109 has a relative abundance of 48.18% and a mass of 108.9 amu. Calculate the atomic mass of Silver.​

Answers

Answer:

The atomic mass of silver is 107.86 amu

Explanation:

The atomic mass is calculated by formula

Atomic mass = (Mass of first isotope x Abundance of first isotope) + (Mass of Second isotope x Abundance of second isotope)

In case of silver, the formula will be as

Atomic mass = (Mass of Ag-107 x Abundance Ag-107) + (Mass of Ag-109 x Abundance Ag-109)

Mass of Ag- 107 = 106.9

Mass of Ag- 109 = 108.9

Abundance of Ag-107 = 51.82/100 = 0.5182

Abundance of Ag-109 = 48.18/100 = 0.4818

Putting these values in the formula

Atomic mass of silver = (106.9 x 0.5812) + (108.9 x 0.4818) = 107.86 amu

Final answer:

To calculate the average atomic mass of silver, the masses of its isotopes are multiplied by their relative abundances and summed up, resulting in an atomic mass of 107.841428 amu.

Explanation:

The average atomic mass of an element can be calculated by taking the weighted average of the masses of its naturally occurring isotopes, based on their relative abundances. For silver, we have two isotopes: Ag-107 with a mass of 106.9 amu and an abundance of 51.82%, and Ag-109 with a mass of 108.9 amu and an abundance of 48.18%. To find the atomic mass of silver, we perform the following calculation:


Atomic mass = (Percentage abundance of Ag-107 × Mass of Ag-107) + (Percentage abundance of Ag-109 × Mass of Ag-109)

Atomic mass = (0.5182 × 106.9 amu) + (0.4818 × 108.9 amu)

Atomic mass = 55.359866 amu + 52.481562 amu


Atomic mass = 107.841428 amu

Therefore, the average atomic mass of silver is 107.841428 amu.

Review the following DNA sequences .
Original DNA Sequence: ATTGCTAAGTCA
Mutated DNA Sequence: ATTGATAAGTCA
Which type of mutation occurred ?
A) insertion
B) there is no mutation
C) substitution
D) deletion

Answers

Answer:

C) Substitution

Explanation:

C has been substituded by A from the DNA sequence so it is Substitution mutation.

Substitution mutation is shown in the ATTGATAAGTCA,  DNA sequence.

The correct option is C.

What is mutation?

Mutation is the changing in DNA or chromosome which cause genetic change in an organism.

Mutation sometimes leads to death.

In the given sequence

Original DNA Sequence: ATTGCTAAGTCA

Mutated DNA Sequence: ATTGATAAGTCA

The C is substituted or replaced by A

Thus, it is a substitution mutation. The correct option is C, substitution.

Learn more about mutation, here:

https://brainly.com/question/17106056

5. How do
eagles depend on sunlight for their
energy?

Answers

Because An eagle's average daily food consumption is from 250-550 grams per day, or between 5-10% of an eagle's body weight. Bald Eagles, like other animals, get all their energy from the sun. ... Sunlight is the source of energy for plants. Using the sun's energy, green plants produce food through photosynthesis.
The plants make energy from the sun. Smaller animals eat the plant, and absorb the energy. When the Eagle eats the smaller animal, it’s consuming the energy the small animal got from the plant

There’s a lot . I also need help

Answers

Answer to question one-
The equation for density is mass/volume. Therefore, if we follow these steps, we can easily figure out which has the lowest density. The following is the math and densities for each sample

Sample 1- Volume 13 Mass 30
Equation is 30/13
Our density is about 2.3

Sample 2- Volume 20 Mass 72
Equation is 72/30
Our density is 2.4

Sample 3- Volume 2 Mass 22
Equation is 22/2
Our density is 11

Sample 4- Volume 41 Mass 103
Equation is 103/42
Our density is about 2.5

With our equation, we are able to find all of our densities. These are 2.3,2.4,11, and 2.5. The lowest or smallest number is 2.3.

Therefore the sample with the lowest density is sample A.

Question 5-
The answer is 14.

This is because the rock raises the water by 5. Using our equation from the last problem (Density=Mass/Volume). We can again find the answer.

The problem states that then mass is 70. We found out the volume is 5.
Our equation: 70/5
Our density: 14

The answer is C,14

Increase in the worlds population will require a. Increase in sustainable practices. True or false

Answers

Increases in the world's population will require an increase in sustainable practices: True

Answer:

True

Explanation:

Edge 2021


True testing means that a serious effort is made to falsify ("disprove") each possible
explanation.

True or false?

Answers

the answer is ( true )
Answer:

The statement given about the true testing mechanism is false.

Explanation:

Testing is the way toward assessing a framework or its component(s) with the plan to discover whether it fulfills the predefined necessities or not. It is a process of executing a framework so as to distinguish any holes, blunders, or missing prerequisites in as opposed to the real necessities.  

The concept of true testing is not to falsify all possible explanation. It means to come up with a solution which is true in all aspects.

When Stephanie’s light bulb did not turn on after she wired a circuit board, she asked her brother to use the same procedure to see if he got the same results.
Which important step of scientific design is being modeled?

a. reevaluating

b. repetition

c. replication

d. revising

Answers

Answer:

Revising (D)

Explanation:

Answer:

d

Explanation:

i just got it right on the test

Which of the following is NOT a major concept involved in the study of Earth Science?
a Earth's History
C Earth in the Solar System
b. The Structure of the Earth System
d. All are major concepts
Please select the best answer from the choices provided

Answers

Answer:

D

Explanation:

All are major concepts.

-Jarvis

based on the model of cellular transport, the hydrolysis of ATP and ADP provide a mechanism for

Answers

Answer:

B

Explanation:

They move against the gradient : this is coming directly from USAtestprep

Based on the model of cellular transport, the hydrolysis of ATP and ADP provides a mechanism for moving against the gradient.

What is active transport?

Active transport is a type of cellular transport that involves the use of ATP to move substances across membranes.

Active transport can move substances and ions against a concentration gradient.

Conversely, passive transport moves substances in favor of a concentration gradient.

In conclusion, based on the model of cellular transport, the hydrolysis of ATP and ADP provides a mechanism for moving against the gradient.

Learn more in:

https://brainly.com/question/25802833

Which of the following best describes a nuclear fusion reaction?
a reaction that forms chemical bonds
a reaction that breaks chemical bonds
a reaction that joins the nuclei of two atorns into one
a reaction that splits the nucleus of an atom into two
LATINU
ISK OP UP

Answers

Answer:

A reaction that joins the nuclei of two atoms into one  

Explanation:

Think of the words "nuclear fusion".

Nuclear = "relating to a nucleus"

Fusion = "joining"

So, nuclear fusion is the joining of two nuclei into one.

A and B are wrong, because chemical reactions involve electrons.

D is wrong, because the splitting of a nucleus is fission.

Final answer:

Nuclear fusion is the combination of light atomic nuclei to form a heavier nucleus, releasing energy, and it is the fundamental process that fuels stars.

Explanation:

Nuclear fusion is best described by option : a reaction that joins the nuclei of two atoms into one. This process involves two or more light atomic nuclei colliding at high speed and combining to form a heavier nucleus. Nuclear fusion releases energy when these light nuclei fuse to form medium-mass nuclei; this is the same process that powers stars like our Sun. The simplest example of this is the fusion of hydrogen isotopes to form helium in the proton-proton cycle, which happens at the extreme temperatures and pressures found in the core of stars.

Other Questions
An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph? Consider a river flowing toward a lake at an average velocity of 3 m/s at a rate of 500m3/sat a location 90 m above the lake surface. Determine the total mechanical energy of the river water per unit mass and the power generation potential of the entire river at that location. Angelo made the decision to outsource the software components of his consulting company so he could focus on the companys ________, which are sources of competitive advantage, make a contribution to perceived customer benefits, have application in a wide variety of markets, and are difficult to imitate. Food web starting with sun and pointing to grasshopper and squirrel; Grasshopper pointing to squirrel, wolf, and snake; squirrel pointing to wolf, snake, and bird; wolf pointing to decomposition with worms and mushrooms; snake pointing to wolf and decomposition with worms and mushrooms; bird pointing to decomposition with worms and mushrooms; decomposition pointing to the sun stating soil nutrients.If we removed the decomposers from this food web, how would it affect the balance of the ecosystem? There would be an increase in dead matter and a lack of nutrients in the soil. There would be a decrease in dead matter and a lack of nutrients in the soil. There would be an increase in dead matter and an increase in nutrients in the soil. There would be a decrease in dead matter and an increase in nutrients in the soil. Which of the following would NOT be considered an investment in human capital?Aobtaining a college degreeBpurchasing a new computerCattending a first-aid classDpaying for cooking lessons For a class Foo, one difference between a variable declared Foo * and a variable declared Foo & is that only the variable declared Foo & can potentially have the value NULL.Select one:a. FALSEb. TRUE how do chemicals affect our lives? what is the region of very calm seas and little to no wind on either side of equator? Which was not one of the major disagreements that the framers faced at the Constitutional Convention?The process for adding future states to the union.Balancing the power of the large and small states.Balancing the power between the state governments and the federal government.What should be done about slavery. A construction company has built 30 houses so far this year at a total cost to the company of $7.5 million. If the company builds a 31st house, its total cost will increase to $7.76 million. Which of the following statements is correct?a. For the first 30 houses, the average cost per house was $250,000.b. The marginal cost of the 31st house, if it is built, will be $260,000.c. If the company can experience a marginal benefit of $275,000 by building the 31st house, then the company should build it.d. All of the above are correct. Adriana is a member of a culture that does not believe in birth control, but she recognizes that another culture has the right to decide about birth control because they are different. What is this an example of? At what distance from a long straight wire carrying acurrentof 5.0A is the magnitude of the magnetic field due to thewireequal to the strength of the Earth's magnetic field of about5.0 x10^-5 T? An object, initially at rest, moves with a constant acceleration of 10 m/s2. How far will it travel in (a) 2.0 s and (b) 4.0 s? If this object had an initial velocity of 4 m/s, how far will it travel in (C) 2.0 s and (d) 4.0 s? Glucose is a carbohydrate that contains carbon, hydrogen, and oxygen. The empirical formula of glucose is CH2O and its molar mass is 180.12 g/mol. Find the molecular formula of glucose. If the molality of a NaBr(aq) solution is 2.50 m, what is the weight percent of NaBr? The molar mass of NaBr is 1029 g/mol 20.5% 25.0% 25.7% 34.6% 65.4% ent Navigator J K L