Early maturation in girls is associated with: high levels of self-esteem throughout life. high levels of self-efficacy, especially in the adolescent years. high levels of sexual abstinence when compared to late maturing girls. high levels of vulnerability for depression and eating disorders.

Answers

Answer 1
I believe the answer is: . high levels of self-efficacy, especially in the adolescent years

Many teenagers have high self esteem even though they are still immature (which explains why many 'popular kids' choose to bully some of their fellow students). High level of self-efficacy on the other hand shows the overall competence that the girls had before they compete in real world.

Related Questions

Dr. green is studying intellectual development in adulthood. in order to generate the most accurate view of intellectual development, dr. green should use a _____ research design. cross-sequential longitudinal case study cross-sectional

Answers

Dr. Green should use a "cross-sequential" research design.

A cross-sequential design is an research technique that consolidates both a longitudinal outline and a cross-sectional plan. It expects to revise for a portion of the issues inborn in the cross-sectional and longitudinal outlines.
Hey user☺

Cross sequential is the right answer.

Hope this will help☺☺

The most stringent standard of judicial review of a government's actions in which the government must show that the law serves a "compelling state interest" is called

Answers

This is called Strict Scrutiny.

Abigail's mother recently died after a long illness. although abigail has not attended religious services since she was a child, it is likely that she will _____.

Answers

It is likely that Abigail will become more religious after her mother's death. Adopting a religious or a spiritual practice is a common way of coping with death or trauma. There are positive and negative ways religion can affect the grieving process- it can either offer comfort or become a source of inner conflict, for example when a person develops issues with faith.  

When the dollar appreciates, u.s.
a. exports and imports increase.
b. exports and imports decrease.
c. exports decrease, while imports increase.
d. exports increase, while imports decrease?

Answers

I believe the answer is: C. exports decrease, while imports increase.

When a dollar apprecaites, it means that our dollar become higher in value.

This would make foreign nations will obtain smaller number of goods with the same amount of currency, which would cause the decrease in our exports.
Since we could obtain larger number of goods with our currency, we would import more goods from other country.




On santiago's last night alive, what did he spend some time calculating and why is that a haunting memory for those who know considering what it reminded him of ?

Answers

Referring to chronicle of a death foretold

On his last night alive, Santiago was calculating the cost of how much the wedding was going to be.
 This haunted people's memory because It reminded them that If they give Santiago helps even only a little, that innocent man would probably still alive and obtain happiness with his family.

When the president proposes the annual federal budget, he is acting as the
a. chief citizen.
b. chief legislator.
c. chief administrator
d. chief of state?

Answers

C. Chief administrator

((Sociology))What is meant by the phrase "the graying of America"?

A. Life expectancy has increased in the United States.

B. The size of the average American family has decreased.

C. The cost of medical care in the United States has remained constant.

D. Americans are having children at an older age.

Answers

The answer is A. Lol I just had that question like a few hours ago.

Answer:

A

Explanation:

A p e x

A major reason why the majority of supreme court justices have had political experience prior to appointment to the court is that

Answers

The answer is "Presidents seek to place individuals on the Court whose policy views are similar to their own".

Political contemplations ordinarily assume a critical part in Supreme Court arrangements. It is regularly accepted, for instance, that Presidents will be slanted to choose a candidate whose political or ideological perspectives seem perfect with their own. The political idea of the arrangement procedure turns out to be particularly obvious when a President presents a chosen one with dubious perspectives, there are sharp factional or ideological contrasts between the President and the Senate, or the result of essential established issues under the steady gaze of the Court supposedly is in question.

Final answer:

The majority of Supreme Court justices have political experience because they shape public policy and reflect the ideologies of the appointing President and party, and their nominations are often a reflection of political partisanship.

Explanation:

A major reason why the majority of Supreme Court justices have had political experience prior to appointment to the court is the recognition that they play a pivotal role in shaping public policy, often reflecting the ideological leanings of the appointing President and party. Justices are nominated by the President and confirmed by the Senate, two entities which may reflect partisan views rather than the popular will.

This politico-legal dynamic is a result of the historical practices and the current high stakes involved in Supreme Court decisions, which have long-lasting impacts on society and can strengthen or shift the ideological balance of the court. Moreover, federal judiciary appointments, including those to the Supreme Court, have been influenced by political shifts and congressional partisanship, resulting in strategic nominations by Presidents aiming to ensure their policies are upheld by sympathetic justices.

_____ is an anxiety disorder in which an individual has an intense fear of being humiliated or embarrassed in public. thanatophobia xenophobia social phobia gamophobia

Answers

social phobia is the answer. if you know anyone who has it they should seek medication to treat it. SAD (Social Anxiety Disorder) because of this intense fear many teens and adults turn to bad things like alcohol and drugs to cope.

"The correct answer is social phobia.

Social phobia, also known as social anxiety disorder, is characterized by an intense fear of being judged, negatively evaluated, or rejected in a social or performance situation. Individuals with social phobia may experience significant distress in situations such as public speaking, meeting new people, or eating in front of others due to fears of embarrassment or humiliation.

To clarify the other options:

- Thanatophobia is the fear of death.

- Xenophobia is the fear or dislike of strangers or foreigners.

- Gamophobia is the fear of marriage or commitment.

Social phobia is distinct in that it specifically relates to social situations where the individual fears they may act in a way that will be embarrassing or humiliating, leading to scrutiny by others."

Bryce, brad, and kyle are three close friends and co-workers who have gone to a happy hour after work. they are likely to sit at a _________ from one another. public distance

Answers

The correct answer is personal distance.

Personal distance refers to a space of around 2-5 feet between two or more people who interacting. Personal space is seen between individuals who are family members and friends.Since Bryce, Brad and Kyle are close friends and comfortable with each other, they are likely to sit at a personal distance (2-5 feet) from each other.  
They are likely to sit at a "personal distance" from one another.

The physical or enthusiastic space that people keep up amongst themselves as well as other people; the level of remoteness that is either wanted or felt between a man and others; additionally called personal distance. 

Which term applies to the process by which our political attitudes are formed by our environment? political diversity political socialization political demography random factors?

Answers

The answer is "Political socialization".

Political socialization is a deep rooted process by which individuals shape their thoughts regarding governmental issues and obtain political qualities. The family, instructive framework, peer gatherings, and the broad communications all assume a part.

I just took the same quiz and the answer is political socialization.

The ability to keep working when faced with obstacles that impede progress toward a goal is

Answers

The ability to keep working when faced with obstacles that impede progress toward a goal is imperative when working to achieve your goals. It is important to make sure you have a clear head and focus on what you want to achieve as challenges always rise to the occasion. 

The ability to keep working when faced with obstacles that impede progress towards a goal is essential in order to achieve the set goal.

Explanation :

When a person is determined towards the fulfillment of a set goal, any hindrances in the due course of progression towards the goal do not prove to be big enough to stop the person from reaching the goal.

This ability of the person refers to his skills in coming over the obstacles and consistently keep moving ahead.



Who are the individuals who violate tort statutes or laws

Answers

The tortfeasors commits those acts

Jill's friends tell her they think she has a really good memory. she finds this interesting so she decides to purposefully test her memory. jill receives a list of to-do tasks each day at work. usually, she checks off each item as the day progresses, but this week, she is determined to memorize the to-do lists. on monday, jill is proud to find that she remembers 95 percent of the tasks without referring to the list. on tuesday, her memory drops to 80 percent, and by thursday, she is dismayed to see her performance has declined to 20 percent. jill's memory is declining over the course of the week because other information she encounters is "competing" with that which she memorized on monday. this process is called

Answers

I believe the answer is: proactive interference.

proactive interference Refers to a situation when our old memory is interfering with the process of acquiring new memories.
Because of this proactive interference, we often make a mistake in recalling an old information and treating it as new information.

Vanessa has been diagnosed with scabies. her education would include:

Answers

Vanessa has been diagnosed with scabies, her education would include:
All members of the household and close personal contacts should be treated. Scabies is not an infection but infestation. Tiny mites called Sarcoptes scabiei set in the outer layer of human skin. They lay eggs inside the skin, the infestation leads to relentless itching.

Having freedom to make choices about issues that affect one's life is which ethical principle?

Answers

 the principle is autonomy.

An unofficial career path that firms use for women who want to divide their attention between work and family is known as ________.

Answers

I believe the correct answer is: mommy track.

 

     An unofficial career path that firms use for women who want to divide their attention between work and family is known as mommy track. This technique can’t be applied to all women and it also implies that men are not interested in maintaining balance between work and family.

If a researcher introduced a suspected pathogen into many healthy hosts, but none of them became sick, what could this indicate?

Answers

This would demonstrate this isn't the right pathogen that has been causing illness.It could imply that the hosts have a characteristic insusceptibility or the pathogen is a symbiont, or not harmful microscopic organisms. 
The suspected pathogen must be found for each situation of ailment and not be found in healthy people. It can be isolated and developed in pure culture.

Promelute, a pharmaceutical company, conducts a research on participants for its new drug for obsessive-compulsive disorder. but the experimenter is unclear about the conclusions of the study because he is not sure if the improvement has been caused by the properties of the drug or by the participants' expectations about the effect of the drug. such an effect is known as a(n) _____ effect.

Answers

Such an effect, in which  the experimenter is unclear about the conclusions of the study because he is not sure if the improvement has been caused by the properties of the drug or by the participants' expectations about the effect of the drug  is known as a placebo  effect.
Placebos do not contain an active substance meant to affect health. They can sometimes improve a patient's condition simply because the person has the expectation that it will be helpful.

Which federal agency conducts research and makes recommendations on how the federal court system could be improved?

Answers

 Federal Judicial Center is the federal agency conducts research and makes recommendations on how the federal court system could be improved.
The Federal Judicial Center is agency of the United States federal courts responsible for education and research for the federal courts.
It was established by an Act of Congress in 1967.

how did eleanor roosevelt contribute to women's right

Answers

she worked hard and made many speeches for women's rights

To avoid experiencing anxiety, logan is attributing his own unacceptable aggressive impulses to another individual. logan is using a defense mechanism called:

Answers

Logan is using a defense mechanism called "Projection".

Projection is a type of resistance in which undesirable sentiments are dislodged onto someone else, where they at that point show up as a danger from the outside world. A typical type of projection happens when an individual, undermined by his own furious sentiments, blames another for harboring unfriendly considerations. 

Which type of tax places a heavier burden on low-income people?

Answers

Thank you for posting your answer on Brainly! We love to help you with your questions, so feel free to ask some more! :)

Regressive Tax is a tax imposed in such a manner that the tax rate decreases as the amount subject to taxation increases.
Main taxation that could be extremely depressing to a lower-income home/family would be Poll Taxation.

Have a very wonderful day, and may Gob bless you! :D

Regressive tax, a type of tax places a heavier burden on low-income people.

What is tax?

The term tax refers to the government charge the extra money for goods and services. The tax is also called as financial charge. The amount of tax are collect to government account as spent on public welfare. The public pay tax is compulsory. There are two types of tax, such as direct tax and indirect tax.

A tax is said to be regressive if it is levied in a way that the tax rate drops as the amount based on taxation rises. Payroll taxes are levied on salaries and wages and are used to pay for Social Security and Medicare. It is a flat tax that is not dependent on income, hence it is regressive in that it imposes a higher burden on those with lower incomes.

As a result, the significance of the type of tax places a heavier burden on low-income people are the aforementioned.

Learn more about on tax, here:

https://brainly.com/question/23347326

#SPJ2

Brittany came to a therapist complaining that she just doesn't enjoy life lately. she says that for the past couple of months, she finds she just doesn't feel like doing the things that she used to love to do. she has also lost a lot of weight and sleeps much more than usual but still feels tired all the time. she says she just can't concentrate on anything. however, she denies feeling sad. brittany's most likely diagnosis is _________

Answers

Brittany's most likely diagnosis is major depressive disorder.

Brittany came to a therapist complaining that she just doesn't enjoy life lately. she says that for the past couple of months, she finds she just doesn't feel like doing the things that she used to love to do. However, she denies feeling sad. Brittany's most likely diagnosis is major depressive disorder.

Losing weight, getting more sleep, feeling exhausted all the time, and having difficulties focusing are some of the symptoms that Brittany suffers. These symptoms and indicators of serious depression are typical.

Major depressive disorder is a complex mental ailment that can affect anyone. People can take efforts to reduce their risk and seek help if they start to develop depressed symptoms by being aware of these risk factors.

As a result, the significance of the Brittany's most likely diagnosis is most are the aforementioned.

Learn more about on depressive disorder, here:

https://brainly.com/question/32810400

#SPJ4

To reduce the stress of losing her job, alicia enrolled in a work retraining program that led to full-time employment. alicia's behavior best illustrates:

Answers

Alicia's behavior best illustrates "problem-focused coping."

-focused coping focuses on the reasons for worry in useful ways which handles the issue or distressing circumstance that is causing pressure, subsequently specifically lessening the pressure. Issue centered methodologies expect to expel or diminish the reason for the stressor.

Americans and britons speak the same language, yet they have different meanings for the same words. this is a problem of

Answers

I believe the answer is: Denotative meaning

Denotative meaning Refers to the literal meaning of the word rather than the true intention. 
For example, in England, the word braces is used to describe a part of clothing while in America the word braces is used to describe the steel that we use for teeth alignment. 

Final answer:

The question pertains to differences in word meanings and spellings between American English and British English, which is a reflection of cultural and historical developments in the English language. Differences in vocabulary, spelling, and pronunciation contribute to these variations.

Explanation:

The phenomenon where American and British speakers have different meanings for the same words or use different spellings for the same concept is linked to variations within the English language. Despite speaking the same language, cultural and historical developments have led to distinct forms of English in the United States and the United Kingdom. For example, Americans use 'color' and 'flavor' without the 'u', while the British spell these words as 'colour' and 'flavour', respectively. Such differences can be attributed to historical spelling reforms and the influence of other languages on English.

Vocabulary differences between American and British English extend beyond spellings to include words that convey similar concepts but differ in use. For instance, in Britain, one might say 'I shall have a biscuit', whereas in America, one would say 'I'll take a cookie'. Additionally, pronunciation differences further complicate understanding. American English speakers may find the Scottish dialect challenging to comprehend due to its unique pronunciation and lexical choices.

Language does not only communicate but also shapes our understanding of the world around us. Variations in dialects and language affect not only personal communication but also cultural identity and societal norms. As the English language evolves, it reflects the dynamic nature of culture and continues to add new words to accommodate technological and societal changes.

Public opinion matters in democracy because of the concept of

Answers

Popular Sovereignty should be your answer. Have a great day.

_____ was a wealthy businessman, whose execution caused riots in Saint-Domingue.

Answers

The answer is: Vincent Ogé


Vincent Ogé was a mix-raced 'free man' who was wealthy and educated, a rarity at the time for someone from mixed ethnicity.


He made his money through plantation and was well traveled in Europe. On a trip to Paris, he saw the French revolution take place before his eyes.

However, he saw how the benefits of the revolution were only for the 'white people'.

With the help of the British he wanted to end slavery in Saint-Domingue.


He was eventually executed by the French and he became a symbol of the slave struggle. His death caused huge riots for days.





Answer:

Vincent Ogé

Explanation:

Around age 85, a life expectancy crossover occurs in that
a. surviving members of low-ses ethnic minority groups live longer than members of the white majority.
b. surviving members of the white majority live longer than members of low-ses ethnic minority groups.
c. differences in rates of chronic illness between high-ses and low-ses groups increase with age.
d. men outnumber women by a ratio of about 3 to1.

Answers

I believe the answer is: A. surviving members of low-SES ethnic minority groups live longer than members of the white majority.

Surviving members of low SES status tend to live in poor unhygienic neighborhood with little access to proper nutrient.
But, if these people survived until the age of 85, it indicates that their body possess a great capabilities of self-protection/repairment, which help them to elongate their ife span.

There have been a greater number of ____________ presidents of the united states than of any other religion.

Answers

they are either christian or protestant 
Other Questions
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other Polands energy resources can be described as _____. a. based on large deposits of coal b. rich in petroleum c. large deposits of sulfur d. large deposits of copper If a circle has a radius of 18 feet what's the closest approximation for circumference Has complete control of the laws rules and affairs of a country Plz jphelp me answer this year 7 question and explain how u got the answer. If the most industrialized countries all signed a climate-change treaty with the goal of keeping the sea at its current level, which would be a free rider benefiting from a positive externality of the treaty America wanted to end japan's aggression by placing a(n) _______ to cut off the oil and scrap metal supply. Eva is jumping on a trampoline. Her height h at time t can be modeled by the equation h=-16t^2+20t+6. Would Eva reach a height of 14 feet? A traveler's budget and needs are considered by a _________ when arranging a trip. Which antibiotic was most effective in inhibiting the growth ofe. coli? Length of side AB??? your recipe calls for 1/2 a pound of potatoes. You use 1/6 of the bag of potatoes. whats the number of pounds per bag how many gallons of 20% alcohol solution and 50% alcohol solution must be mixed to get 9 gallons of 30% alcohol solution ____ is the science that deals with the description, distribution, and interaction of the diverse physical, biological, and cultural features of Earth's surfaceA. EcologyB. ConservationC. TopographyD. Geography Which number replaces the box to make this a true sentence? 3 (6 2) = (? 6) (3 2)