Elio Makes candles that are 14 cm tall. Each candle burns eight hours before going out. He is wondering how many hours a 21 cm tall candle can burn for.

Answers

Answer 1

Final answer:

A 21 cm tall candle should burn for 12 hours, as it is 1.5 times taller than a 14 cm candle which burns for 8 hours.

Explanation:

The problem is one of direct proportion where the height of the candles is directly proportional to the burning time. If a 14 cm tall candle burns for 8 hours, then a 21 cm tall candle, which is 1.5 times taller, should burn for 1.5 times longer. Hence, to calculate the burning time for the 21 cm candle, we multiply 8 hours by 1.5.

Calculation:

21 cm / 14 cm = 1.5

8 hours × 1.5 = 12 hours

Therefore, a 21 cm tall candle should burn for 12 hours.


Related Questions

PLEASE HELP ASAP!!!! 10 POINTS!!!

what is the solution to the proportion

5/x =2/8

Answers

5/x=2/8, so to solve the proportion cross multiply, try to have no fraction basically, 2x=40, now solve for x, x=20 
The answer is x=20 because when cross multiplied (40=2x) and divided (40/2=2x/2) you get 20=x

Hope this helps!

How do you join the bar you left weighs 45 pounds you add weight to the bar that are 10 pounds each if you add six weights to the bar how many pounds will you left

Answers

Hello!

45 + 10 + 6 = 61

So, your answer is 61.

I hope that was helpful! c:

If 3 onions weigh 0.75 lb,how much do 10 onions weigh

Answers

Use a proportion:

.75 / 3 = x /10

Solve for x

So if you do, 0.75 × 9 =6.75
Then, 0.75 ÷ 3 =0.25
Lastly, 6.75 + 0.25 = 7
Your final answer is 7.

How do you determine if a set of ordered pairs is a function or not?

Answers

You could set up the relation as a table of ordered pairs. Then, test to see if each element in the domain is matched with exactly one element in the range. If so, you have a function! Watch this tutorial to see how you can determine if a relation is a function.
A function is a set of ordered pairs in which no 2 pairs with the same first element have a different second element. 

If you think about it, it makes sense. Think about  f(x) = x + 1. The pairs (x, f(x)) look like (1,2), (2,3), (3,4), (4,5), etc. If you also had (1,3) in the set, then there'd be two different answers for 1+1. The same applies to any function. There can only be one result for a given input value. Your welcome!!

When a coordinate grid is superimposed on a map of harrisburg the highschool is located at (17,21) and the town park is located at (28,13) . If each unit represents 1 mile, how many miles apart are the highschool and the town park? round your answer to the nearest tenth

Answers

To find the distance between the high school at (17,21) and the town park at (28,13), use the distance formula which yields a result of approximately 13.6 miles apart, rounded to the nearest tenth.

When looking at the coordinates of the high school at (17,21) and the town park at (28,13) on a coordinate grid where each unit represents 1 mile, we need to use the distance formula to calculate the distance between the two points. The distance formula is derived from the Pythagorean theorem and is given by:

[tex]Distance = \sqrt{(x2 - x1)^2 + (y2 - y1)^2}[/tex]

Substituting the values -

[tex]Distance = \sqrt{{(28 - 17)^2 + (13 - 21)^2}[/tex]

Calculate the differences and square them:

Distance = [tex]\sqrt{{(11)^2 + (-8)^2}\\[/tex]

Distance = [tex]\sqrt{{121 + 64}[/tex]

Distance = [tex]\sqrt{{185[/tex]

Take the square root to find the distance:

Distance = 13.6 miles

Therefore, the high school and the town park are approximately 13.6 miles apart, rounded to the nearest tenth.

How do you solve these 2 problems

Answers

11.The answer is -13
13.The answer is -108

Troys recipe for bagels makes 18 bagels per batch. Troy makes 2/3 batch of bagels. How many bagels does Troy make

Answers

 18/3=6. There is two parts so 6x2=12.
he made 12.

When 12.393 and t are added together, the result is 20.463. What is the value of t?

Answers

t= 8.043 because 20.436 - 12.393 = 8.043                                                                                                                       
                        
12.393+t=20.463
subtract 12.393 by both sides
t=8.07

Advantage Airlines has a set fee for each checked bag, plus an additional charge for each pound the bag weighs. The cost is a linear fund of the weight?

What is the rate of change of this function?

Answers

Change in cost = 40 - 25 = 15 dollars

Change in weight = 50 - 20 = 30 pounds

Divide the two results to get 15/30 = 0.5

The rate of change is 0.5 dollars per pound meaning that each time you add a pound, the cost goes up by $0.50 (50 cents)

The rate of change of this function is 0.50.

Rates

Since Advantage Airlines has a set fee for each checked bag, plus an additional charge for each pound the bag weighs, to determine what is the rate of change of this function, knowing that 20 lbs cost $25 and 50 lbs cost $40, you must perform the following calculation:

25 / 20 = X1.25 = X40 / 50 = X0.8 = X1.25 - 0.8 = 0.45

Therefore, the rate of change of this function is 0.50.

Learn more about rates in https://brainly.com/question/25565101

Is 3.2 a rational number?

Answers

The number is between integers, so it can't be an integer or a whole number. It's written as a ratio of two integers, so it's a rational number and not irrational. Allrational numbers are real numbers, so this number is rational and real.
Yes , all rational numbers are real numbers, so this number is rational and real

evaluate n/6 when n=12

Answers

When asked to evaluate, you have to plug in the given value of n (in this case), into the given equation.

n/6 = ?
In order to find out ?, we need to know what n is.
Well, n = 12
So, plug in 12 for n
n/6 would now be written as 12/6 in order to be evaluated
Now, simplify.... What you get for 12/6 is the answer

Answer:

When [tex]\( n = 12 \), \( \frac{n}{6} \)[/tex]  equals [tex]\( 2 \).[/tex]

Explanation:

To evaluate [tex]\( \frac{n}{6} \)[/tex]  when [tex]\( n = 12 \)[/tex] , simply substitute [tex]\( n = 12 \)[/tex] into the expression:

[tex]\[ \frac{n}{6} = \frac{12}{6} \][/tex]

[tex]\[ \frac{n}{6} = 2 \][/tex]

So, when [tex]\( n = 12 \)[/tex], [tex]\( \frac{n}{6} \)[/tex] equals [tex]\( 2 \).[/tex]

The population of a town decreased from 15,925 people to 8759 people. What was the approximate percent decrease?

Answers

fourty four. nine percent so fourty five
65%

% change = 15925 / (15925 + 8759) 

Simplify: % change = 15925 / 24684 = 0.645 = 64.5% which is 65% rounded. 

PLEASE HELP ANSWER WITH ALL STEPS PLS

NUMBER 3 WILL BE A PICTURE

QUESTION 4

Solve for n.
–2.34n = –12.168



n = 5.2

n = 9.828

n = –5.2

n = –9.828


QUESTION 5


Use a transformation to solve the equation.


–8c = 56



c = –48

c = 7

c = –7

c = 48

Answers

Hello.

Question 4:

-2.34n = -12.168
Divide both sides by -2.34;

n = 5.2 is your answer to #4 (Answer choice "C.)"

For Question 5:

-8c = 56
Divide both sides by -8 to solve for c;

c = -7 (remember your signs!) is your answer for #5 (Answer choice "C.)"

[tex] \frac{n}{-12.168} [/tex] = -2; To solve for this, we need to multiply both sides by -12.168 to isolate and solve for our variable.

[tex] \frac{n}{-12.168} [/tex] = -2; Multiply by -12.168

n = 24.336 (A negative multiplied by a negative results in a positive product.);

Your answer for #3 is n = 24.336 (Answer choice "B.)")

I hope this helps!
Answers: 
3.) n = 24.336 

4.) n = 5.2 

5.) c = – 7 

Explanations: 

What is the relationship between the values of the two 4s in 3.441

Answers

The first 4 (.4) is 10x bigger than the second 4 (.04)

Answer:

The given number is 3.441

The first 4 is in the tenth place that is written like [tex]\frac{4}{10}[/tex] or 0.4

The second 4 is in the hundredth place that is written like [tex]\frac{4}{100}[/tex] or 0.04

We can see that the second 4 is one tenth times the first 4. This is shown like = [tex]\frac{1}{10} \times\frac{1}{10}[/tex] = [tex]\frac{1}{100}[/tex]

Or we can say the opposite that the first 4 is ten times the second 4.

answer the question in the image

Answers

Answer:  The percentage of decrease is:  " 33 ⅓  %" .
_____________________________________________
Explanation:
____________________________________________
Given:
____________________________________________
  10 years ago, # of illiterate people = 150 lakhs;
 
   "Now" ;   # of illiterate people = 100 lakhs ;
____________________________________________
So; the decrease in the # of illiterate people = "(150 - 100) = 50 lakhs ;
____________________________________________
To calculate the "percentage of decrease" :
____________________________________________
   The "percentage of decrease" =

{"decrease in the # of illiterate people"} / {"# of illiterate people started with"] ; 

                                                                            ×  100 (percent). 
__________________________________________________
                                      =  [tex] \frac{50}{150} [/tex]  * 100 % ;

{Note that:  [tex] \frac{50}{150} [/tex] = [tex] \frac{5}{15}[/tex] ;
 → The "zeros" cancel out ;

→ [tex] \frac{50}{150} [/tex]  * 100 % ;
     
 = [tex] \frac{5}{15}[/tex] * 100 ; 

Note:  [tex] \frac{5}{15}[/tex] =  [tex] \frac{(5/5)}{(15/5)} [/tex] ;
                                              =  [tex] \frac{1}{3} [/tex] ;
__________________________________________________
[tex] \frac{1}{3}[/tex] * 100 = [tex] \frac{1}{3}[/tex] * [tex] \frac{100}{1}[/tex] ;
_________________________________________________________
      = [tex] \frac{(1*100)}{(3*1)} [/tex]  % ;
 
      = [tex] \frac{(100)}{(3)} [/tex]  % ;

      = "(100 ÷ 3) % ;

      =  " 33 ⅓  % " .
_____________________________________________________
Answer:  The percentage of decrease is:  " 33 ⅓  %" .
_____________________________________________________

Which of the following is a true statement?

A. When comparing integers, the integer with greater absolute value is always the greater integer.

B. When comparing two integers, the integer with greater absolute value is always the lesser integer.

C. When comparing two integers, the integer with the smaller absolute value is always the lesser integer.

D. When comparing two integers, the integer with the smaller absolute value is always the greater integer.

Answers

The answer could only be none of them, because they all depend on the numbers.

Answer:

The answer could be :

A. When comparing integers, the integer with greater absolute value is always the greater integer.

                                OR

B. When comparing two integers, the integer with greater absolute value is always the lesser integer.

A 5-pound bag of apples cost $3.50. Use that rate, to complete the table to identify equivalent ratios, and then answer the questions. Apples *? 5 ? 15 Cost 0.70 3.50 7 ? Apples cost $ __ per pound.

Answers

Answer:

Cost 0.70 per pound.

Step-by-step explanation:

If you see the cost and the weight you can get the price per pound, so if 5 pounds cost $3.50, you can evaluate doing a rule of three:

[tex]\frac{3.50}{5}=\frac{x}{1}[/tex]

So if you clear X you´d get this:

[tex]x=\frac{(3.5)(1)}{5}[/tex]

[tex]x=0.70[/tex]

So the cost per pound is $0.70.

Now that you have the cost per pound you can do the equivalent ratios:

Cost---------------Apples

0.70---------------1 pound

3.5--------------- 5 pounds

  7---------------  10 pounds

Answer:

0.70 per pound.

Jenna bought a golf club that was marked down 20% from an original price of $75. If she paid 5% sales tax, what was the total cost of the golf club?

Answers

$63. She pays $60 for the club and $3 in taxes.
She pays $63 all together

What property is this? if -5x-1=-11, then -5x=-10

Answers

I believe X is equal to 2 

Then, the answer would be x=-2.

(6.5/2) to the second power. Simplify

Answers

14 Bc 6.5 + 6.5 = 12 + 1/2+1/2 = 13

Write an expression to represent the perimeter of:
2a-3
2a
3a+1

Answers

I am assuming this is a triangle.....P = a + b + c

P = 2a - 3 + 2a + 3a + 1....combine like terms
P = 7a - 2 <==

HELP ASSAP WITH THIS QUESTION

Answers

If I remember correctly judging from the 30 in the top left all you would have to is subtract 180 which is the angle of a straight line and subtract it from the 30 and it would be 150
That would be 180 - 30  = 150 degrees

how many integers are greater than 9 37 and less than 37 9

Answers

The integer between this two given integer, If the two given interger in inclusive we will calculate it using 37 - 9 + 1 = 29. So we will have a total of 29 interger in the number line if both the given integer is included.

But if the two given integer in excluded we will subtract both,  we will calculate it by 37 - 9 - 1 = 27. So we will have a total of 27 integer if both the number is excluded.

Answer this pleaseeeeeeeee

Answers

first u have to do 5 exponent 10 then do the bottom than divide both answers

Ahmad drove 638 miles in 11 hours. At the same rate, how long would it take him to drive 522 miles?

Answers

It would take him 9 hours to drive 522 miles since if you divide 638 with 11 you would get 58 and if you divide 522 with 58 you'll get 9. 

Answer:

9

Step-by-step explanation:

What integer can be represented by 16 positive tiles and 26 negative tiles? (A) 10 (B) -10 (C) -6 (D) 42

Answers

the answer would be (B) -10  because 16 - 26 is -10


Final answer:

The integer that can be represented by 16 positive tiles and 26 negative tiles is -10.

Explanation:

One way to solve this problem is by considering the positive and negative tiles as positive and negative numbers, respectively. If we have 16 positive tiles and we subtract 26 negative tiles, we end up with a deficit of 10 negative tiles. Therefore, the integer that can be represented by these tiles is -10 (option B).

Learn more about Integers here:

https://brainly.com/question/15276410

#SPJ2

which of the following are equivalent to 0.625 625/1000 100/625 5/8 125/200 20/125

Answers

625/1000= 0.625

100/625= 0.16

5/8= 0.625

125/200= 0.625

20/125= 0.16

A 56-inch board is to be cut into three pieces so that the second piece is twice as long as the first piece and the third piece is 5 times as long as the first piece. If x represents the length of the first piece, find the lengths of all three pieces.

Answers

X+2x+5x = 56. Divide 56 by 8 to get 7 = x. First=7. Second=14, third=35

The length of all the three pieces x,y,z will be 7 in, 14 in. and 35 in. respectively .

What is proportion ?

A proportion is an equation based on the equality of two ratios.

Let the three pieces of 56 in. board are cut into ratio x : y : z than it is given that second piece that is y equals 2x and third piece z equals 5x. Now solving for value of x :

 [tex]\begin{aligned}x+y+z&=56\\x+2x+5x&=56\\8x&=56\\x&=7\end{aligned}[/tex]

Therefore, the length of all the three pieces x,y,z will be 7 in, 14 in. and 35 in. respectively .

Read more about ratio at:

https://brainly.com/question/17869111

#SPJ6

What’s 3x+6y=12 in the form y=mx+b

Answers

Hey there!

3x+6y=12

Divide both sides by 3 and your equation would now look like:
x+2y= 4
Move the x to the other side
2y= -x+4
Seprate the y by dividing both sides by 2
y= [tex] \frac{1}{2} [/tex]x+2
3x + 6y = 12

3x(-3x) + 6y = 12 (-3x)

6y = -3x + 12

6(y)/6 = (-3x + 12)/6

y = -1/2x + 2

hope this helps

What is k/4+2-k=10.

Answers

i hope this help answer that
Other Questions
Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Evaporation is ________. check all that apply. check all that apply. an endothermic process sometimes a warming process always a cooling process sometimes a cooling process an exothermic process always a warming process Why is it important that melanin is present in its highest concentration in the keratinocytes at or near the basale layer of cells? What conclusion can you draw from the fact that Spanish and Portuguese are the most commonly spoken languages in Latin America? A)Latin Americans have chosen to speak Romance languages. B)Latin Americans were born in Spain and Portugal and then moved. C)Spain and Portugal colonized Latin American nations during the 15th and 16th centuries. D)Many Latin Americans travel to Spain and Portugal and learn the language while visiting.