Find the midpoint of A and B where A has coordinates (2, 4)
and B has coordinates (-3, -9).

Find The Midpoint Of A And B Where A Has Coordinates (2, 4)and B Has Coordinates (-3, -9).

Answers

Answer 1

Answer:

(-0.5,-2.5)

Step-by-step explanation:

(x1 + x2) / 2 = x midpoint

(y1 + y2) / 2 = y midpoint

x)

2 + -3 = 5

5 / 2 = -0.5

y)

4 + -9 = -5

-5 / 2 = -2.5

= (-0.5, -2.5)

Answer 2

The midpoint of A and B where A has coordinates (2, 4) and B has coordinates (-3, -9) is (-1/2, -5/2)

What is Coordinate Geometry?

A coordinate geometry is a branch of geometry where the position of the points on the plane is defined with the help of an ordered pair of numbers also known as coordinates.

We have to find the midpoint of A and B where A has coordinates (2, 4)

and B has coordinates (-3, -9).

Midpoint = (2-3/2, 4-9/2)

=(-1/2, -5/2)

Hence, the midpoint of A and B where A has coordinates (2, 4) and B has coordinates (-3, -9) is (-1/2, -5/2)

To learn more on Coordinate Geometry click:

brainly.com/question/27326241

#SPJ2


Related Questions

here are the ingredients needed to make 8 pancakes
250ml milk
1 egg
140 g flour
5 g butter
a) simon makes 4 pancakes
workout how much milk he needs
b) craig makes 12 pancakes
workout how much butter he needs

Answers

To calculate milk needed for a different number of pancakes and determine the amount of butter for a varied pancake quantity.

To calculate the amount of milk needed for 4 pancakes that Simon is making:

Divide the amount of milk needed for 8 pancakes (250ml) by 2 since 4 is half of 8. 250ml ÷ 2 = 125ml.

To determine the amount of butter for the 12 pancakes that Craig is making:

Since the recipe calls for 5g of butter for 8 pancakes, we can calculate the amount needed for 12 pancakes by setting up a proportion: (5g/8 pancakes) = (x/12 pancakes). Solving for x gives x = 7.5g.

An automobile manufacturer claims that its car has a 28.0 miles/gallon (MPG) rating. An independent testing firm has been contracted to test the MPG for this car since it is believed that the car has an incorrect manufacturer's MPG rating. After testing 270 cars, they found a mean MPG of 27.8. Assume the variance is known to be 6.25. A level of significance of 0.02 will be used. Make a decision to reject or fail to reject the null hypothesis. Make a decision.

Answers

Answer:

The calculated value z = 1.3145 < 2.326 at  0.02 level of significance

The null hypothesis is accepted

Hence An automobile manufacturer claims that its car has a 28.0 miles/gallon (MPG) rating.

Step-by-step explanation:

Step(i):-

An automobile manufacturer claims that its car has a 28.0 miles/gallon (MPG) rating.

The mean of the Population 'μ' = 28.0miles/gallon

Given data after testing 270 cars, they found a mean MPG of 27.8. Assume the variance is known to be 6.25.

The sample size 'n' = 270

Mean of the sample 'x⁻' = 27.8

Given Population variance 'σ² = 6.25

The standard deviation of Population 'σ' = √6.25 = 2.5

Step(ii):-

Null hypothesis :H₀: 'μ' = 28.

Alternative hypothesis :H₁: 'μ' ≠28.

The test statistic

[tex]Z = \frac{x^{-}-mean }{\frac{S.D}{\sqrt{n} } }[/tex]

[tex]Z = \frac{27.8-28 }{\frac{2.5}{\sqrt{270} } } = \frac{-0.2}{0.15214}[/tex]

Z = -1.3145

|Z| = |-1.3145|= 1.3145

Step(iii):-

The tabulated value  of z-score at 0.02 level of significance = 2.326

The calculated value z = 1.3145 < 2.326 at a t 0.02 level of significance

The null hypothesis is accepted

Hence An automobile manufacturer claims that its car has a 28.0 miles/gallon (MPG) rating.

solve this system using a systems of equations. Discount Rental Cars charges a daily fee plus a mileage fee for renting its cars. Barney was charge 145.00 for 3 days and 310 miles, while Mary was charge 250.00 for 5 days and 600 miles. What does discount Rental Cars charge per day and mile?

Answers

Answer:

Barney 145 3 Days 310 Miles

Mary   250 5 Days 600 Miles

A)  3 D + 310 M = 145

B) 5 D + 600 M = 250

Multiplying A) by -5/3

A) -5 D - 516.6666M = -241.66666666

B) 5D + 600M = 250

Adding A) and B)

83.3333 M = 8.3333333333

M = .10 per mile

3 D = 114

Daily Rate = 38 dollars per day

Step-by-step explanation:

The minimum length L of a highway sag curve can be computed by where θ 1 is the downhill grade in degrees (θ 1 < 0°), θ 2 is the uphill grade in degrees (θ 2 > 0°), S is the safe stopping distance for a given speed limit, h is the height of the headlights, and α is the alignment of the headlights in degrees. Compute L for a 55-mph speed limit, where and Round your answer to the nearest foot.

Answers

Answer:

The answer to the nearest foot is = 15 feet

Step-by-step explanation:

Solution

The first set taken is to  Compute L for a 55-mph speed limit

Given that

L =(θ2 -θ1)/200 (h +S Tan ∝) =

= ( u + 5) 336²/200 (1.9 +336 tan 0.7°)

= 9° (336)²/200 (1.9 +336 tan 0.7°) = 14.7652094

= 15 feet  { 9° = 9*π/180 = π/20}

Note: Kindly find an attached image for the complete question given and answered

The table shows the results of a poll of 200 randomly selected juniors and seniors who were asked if they attended prom. Find the probability of each of the events.

juniors seniors
yes 28 97
no 56 19

Express your answer as a fraction, using the backslash. Example: 17 would be written as 1/7.


a) P (a junior who did not attend prom)

b) P (did not attend prom | senior)

c) P (junior | attended prom)

Answers

Answer:

(a)[tex]\frac{7}{25}[/tex]

(b)[tex]\frac{19}{116}[/tex]

(c)[tex]\frac{28}{125}[/tex]

Step-by-step explanation:

Number of juniors who attended prom,n(J)=28

Number of seniors who attended prom,n(S)=97

Total of those who attended prom=125

Number of juniors who did not attend prom,n(J')=56

Number of seniors who did not attend prom,n(S')=19

Total of those who attended prom=75Total Number of students=200

(a) P (a junior who did not attend prom)

[tex]P(J')=\frac{56}{200}= \frac{7}{25}[/tex]

(b)

[tex]P(Senior)=\frac{116}{200}[/tex]

[tex]P ($did not attend prom$ | senior)=\frac{\text{P(seniors who did not attend prom)}}{P(Senior)} \\=\frac{19/200}{116/200} \\=\frac{19}{116}[/tex]

(c)P (junior | attended prom)

[tex]P(Senior)=\frac{84}{200}[/tex]

[tex]P (Junior|$ attended prom$)=\frac{\text{P(juniors who attended prom)}}{P(\text{those who attended prom)}} \\=\frac{28/200}{125/200} \\=\frac{28}{125}[/tex]

Answer:

A. P = 7/25

B. P = 19/116

C. P = 28/125

Step-by-step explanation:

1. Let's review the information given to us to answer the question correctly this way:

      Juniors  Seniors   Totals

Yes       28         97          125

No       56         19           75

Totals   84        116          200

2. Find the probability of each of the events.

Let's recall that the formula of probability is:

P = Number of favorable outcomes/Total number of possible outcomes

A. P (a junior who did not attend prom)

P = Juniors who did not attend prom/Total number of students surveyed

P = 56/200

P = 7/25 (Diving by 8 numerator and denominator)

B. P (did not attend prom | senior)

P = Seniors who did not attend prom/Total number of seniors surveyed

P = 19/116

C. P (junior | attended prom)

P = Juniors who attend prom/Total number of students attended prom

P = 28/125

What is the area of a triangle with a base of 7 cm and a height of 4cm

Answers

Answer:

14 sq cm

Step-by-step explanation:

7 × 4 = 28

28 ÷ 2 = 14

brainliest?

What is the median number of pairs of shoes owned by the children ?

Answers

Answer:

3

Step-by-step explanation:

The Movie Haven is planning to order new medium-size popcorn containers. It has a choice of four different containers. It costs the company $0.02 per cubic inch of popcorn to fill a container. The company does not want the new container to cost more than $3.00 to fill. Which container should the company use? Use 3.14 for Pi.

Answers

Answer:

the answer is container c

b=11.14in2

12in

Step-by-step explanation:

Answer:

Answer is C

Step-by-step explanation:

A simple random sample of 120 vet clinics in the Midwest reveals that the vast majority of clinics only treat small pets (dogs, cats, rabbits, etc.) and not large animals (cows, horses, etc.). Of the 120 clinics sampled, 88 responded that they do not treat large animals at their clinic. If a 95% confidence interval were calculated instead of 90% confidence interval, what would happen to the width of the confidence interval?

Answers

Answer:

the interval would get bigger.

Step-by-step explanation:

if you wanted to be more confident in the interval you're giving, you would make more of the answers fit under the umbrella you're hypothetically creating.

n a study of cell phone use and brain hemispheric​ dominance, an Internet survey was​ e-mailed to 2472 subjects randomly selected from an online group involved with ears. 1022 surveys were returned. Construct a 99​% confidence interval for the proportion of returned surveys.

Answers

Answer:

0.3876<p<0.4389

Step-by-step explanation:

-Given [tex]n=2472, \ x=1022 , \ CI=0.99[/tex]

-We calculate the proportion of surveys returned:

[tex]\hat p=\frac{1022}{2472}\\\\=0.4134[/tex]

For a 99% confidence interval:

[tex]z_{\alpha/2}=2.576[/tex]

#The margin of error is calculated as;

[tex]ME=z_{0.005}\times \sqrt{\frac{\hat p(1-\hat p)}{n}}\\\\=2.576\times \sqrt{\frac{0.4134(1-0.4134)}{2472}}\\\\=0.0255[/tex]

The confidence interval are then:

[tex]CI=\hat p\pm ME\\\\=0.4134\pm 0.0255\\\\=[0.3876,0.4389][/tex]

Hence, the confidence interval is 0.3876<p<0.4389

A bag contains 3 white balls, 4 green balls, and 5 red balls. A ball is drawn at random. How many total number of outcomes are there?

Answers

Answer:

12.

Step-by-step explanation:

Given that,

Number of while balls are 3

Number of green balls are 4

Number of red balls are 5

We need to find the total number of outcomes. We know the total number of outcomes in is number of choices.

In this case, total number of outcomes are the sum of all color balls i.e. 3 + 4 + 5 = 12 balls.

Hence, the total number of outcomes are 12.

Final answer:

The total number of outcomes when one ball is drawn at random from a bag containing 3 white, 4 green, and 5 red balls is 12.

Explanation:

A bag contains 3 white balls, 4 green balls, and 5 red balls. The total number of possible outcomes when a ball is drawn at random is simply the sum of all the balls in the bag. Since each ball can be selected in one distinct way, we calculate the total number of outcomes by adding the number of white balls, the number of green balls, and the number of red balls.

So, the total number of outcomes is:

3 (white) + 4 (green) + 5 (red) = 12 (total outcomes)

Therefore, there are 12 different possible outcomes when one ball is drawn at random from this bag.

The following stem-and-leaf plot represents the test scores for 22 students in a class on their most recent test. Use the data provided to find the quartiles.

Test Scores by Student
Stem Leaves
6 1 6 6 6
7 1 3 4
8 1 1 5 5 7 8 8 9
9 1 3 3 3 7 7 7
Key: 6||1=61

Step 1 of 3 : Find the second quartile.

Answers

Using the median concept, it is found that the second quartile is of 86.

What is the median of a data-set?

The median of the data-set separates the bottom half from the upper half, that is, it is the 50th percentile. The median is also called the second quartile, as [tex]\frac{2}{4} \times 100 = 50[/tex].

In this problem, there are 22 scores, which is an even number, hence the median is the mean of the 11th and the 12th scores.

From the stem-and-leaf plot, we have that:

The 1st score, in an increasing way, is 61.The 2nd, 3rd and 4th is 66.The 11th score is 85.The 12th score is 87.

Then:

(85 + 87)/2 = 86

The second quartile is of 86.

You can learn more about the median concept at https://brainly.com/question/25215461

Final answer:

To find the quartiles of a dataset, arrange the data in ascending order, determine the median (Q2), split the data into a lower half and an upper half (excluding the median if the number of data points is odd), and find Q1 and Q3 as the medians of these subgroups.

Explanation:

To find the quartiles for a set of test scores, first arrange the data from lowest to highest and then divide the dataset into four equal parts. The second quartile (Q2), also known as the median, separates the data into two halves. In this case, because we have 22 data points, the median will be the average of the 11th and 12th data points.

To calculate the first quartile (Q1), we find the median of the lower half of the data, which consists of the 10 scores below the overall median. Since we have an even number of data points in the lower half, Q1 will be the average of the 5th and 6th smallest scores.

Similarly, the third quartile (Q3) is the median of the upper half, consisting of the 10 scores above the overall median. Q3 will be the average of the 5th and 6th highest scores within this upper half.

True or False: The megaspore that develops into the megagametophyte leaves the flower when it
reaches maturity

Answers

Answer: gang in la

Step-by-step explanation:

Question 3
4 pts
(03.05)
What does 7 >-2 indicate about the positions of 7 and -2 on the number line? (4 points)
0
7 is located on the right of -2, and -2 is located on the right of o
0
7 is located on the left of -2, and -2 is located on the right of o
04
7 is located to the right of -2
7 is located on the left of -2
Question 4
4 pts

Answers

Answer:

  7 is located to the right of -2

Step-by-step explanation:

Larger numbers are to the right on a number line, so the statement that 7 is larger than -2 means ...

  7 is located to the right of -2

A company manufactures and sells x television sets per month. The monthly cost and​ price-demand equations are ​C(x)equals72 comma 000 plus 70 x and p (x )equals 300 minus StartFraction x Over 20 EndFraction ​, 0less than or equalsxless than or equals6000. ​(A) Find the maximum revenue. ​(B) Find the maximum​ profit, the production level that will realize the maximum​ profit, and the price the company should charge for each television set. ​(C) If the government decides to tax the company ​$4 for each set it​ produces, how many sets should the company manufacture each month to maximize its​ profit? What is the maximum​ profit? What should the company charge for each​ set?

Answers

Answer:

Part (A)

1. Maximum revenue: $450,000

Part (B)

2. Maximum protit: $192,5003. Production level: 2,300 television sets4. Price: $185 per television set

Part (C)

5. Number of sets: 2,260 television sets.6. Maximum profit: $183,8007. Price: $187 per television set.

Explanation:

0. Write the monthly cost and​ price-demand equations correctly:

Cost:

      [tex]C(x)=72,000+70x[/tex]

Price-demand:

     

      [tex]p(x)=300-\dfrac{x}{20}[/tex]

Domain:

        [tex]0\leq x\leq 6000[/tex]

1. Part (A) Find the maximum revenue

Revenue = price × quantity

Revenue = R(x)

           [tex]R(x)=\bigg(300-\dfrac{x}{20}\bigg)\cdot x[/tex]

Simplify

      [tex]R(x)=300x-\dfrac{x^2}{20}[/tex]

A local maximum (or minimum) is reached when the first derivative, R'(x), equals 0.

         [tex]R'(x)=300-\dfrac{x}{10}[/tex]

Solve for R'(x)=0

      [tex]300-\dfrac{x}{10}=0[/tex]

       [tex]3000-x=0\\\\x=3000[/tex]

Is this a maximum or a minimum? Since the coefficient of the quadratic term of R(x) is negative, it is a parabola that opens downward, meaning that its vertex is a maximum.

Hence, the maximum revenue is obtained when the production level is 3,000 units.

And it is calculated by subsituting x = 3,000 in the equation for R(x):

R(3,000) = 300(3,000) - (3000)² / 20 = $450,000

Hence, the maximum revenue is $450,000

2. Part ​(B) Find the maximum​ profit, the production level that will realize the maximum​ profit, and the price the company should charge for each television set.

i) Profit(x) = Revenue(x) - Cost(x)

Profit (x) = R(x) - C(x)

       [tex]Profit(x)=300x-\dfrac{x^2}{20}-\big(72,000+70x\big)[/tex]

       [tex]Profit(x)=230x-\dfrac{x^2}{20}-72,000\\\\\\Profit(x)=-\dfrac{x^2}{20}+230x-72,000[/tex]

ii) Find the first derivative and equal to 0 (it will be a maximum because the quadratic function is a parabola that opens downward)

Profit' (x) = -x/10 + 230 -x/10 + 230 = 0-x + 2,300 = 0x = 2,300

Thus, the production level that will realize the maximum profit is 2,300 units.

iii) Find the maximum profit.

You must substitute x = 2,300 into the equation for the profit:

Profit(2,300) = - (2,300)²/20 + 230(2,300) - 72,000 = 192,500

Hence, the maximum profit is $192,500

iv) Find the price the company should charge for each television set:

Use the price-demand equation:

p(x) = 300 - x/20p(2,300) = 300 - 2,300 / 20p(2,300) = 185

Therefore, the company should charge a price os $185 for every television set.

3. ​Part (C) If the government decides to tax the company ​$4 for each set it​ produces, how many sets should the company manufacture each month to maximize its​ profit? What is the maximum​ profit? What should the company charge for each​ set?

i) Now you must subtract the $4  tax for each television set, this is 4x from the profit equation.

The new profit equation will be:

Profit(x) = -x² / 20 + 230x - 4x - 72,000

Profit(x) = -x² / 20 + 226x - 72,000

ii) Find the first derivative and make it equal to 0:

Profit'(x) = -x/10 + 226 = 0-x/10 + 226 = 0-x + 2,260 = 0x = 2,260

Then, the new maximum profit is reached when the production level is 2,260 units.

iii) Find the maximum profit by substituting x = 2,260 into the profit equation:

Profit (2,260) = -(2,260)² / 20 + 226(2,260) - 72,000Profit (2,260) = 183,800

Hence, the maximum profit, if the government decides to tax the company $4 for each set it produces would be $183,800

iv) Find the price the company should charge for each set.

Substitute the number of units, 2,260, into the equation for the price:

p(2,260) = 300 - 2,260/20p(2,260) = 187.

That is, the company should charge $187 per television set.

A major home improvement store conducted its biggest brand recognition campaign in the company's history. A series of new television advertisements featuring well-known entertainers and sports figures were launched. A key metric for the success of television advertisements is the proportion of viewers who "like the ads a lot". A study of 1,189 adults who viewed the ads reported that 230 indicated that they "like the ads a lot." The percentage of a typical television advertisement receiving the "like the ads a lot" score is believed to be 22%. Company officials wanted to know if there is evidence that the series of television advertisements are less successful than the typical ad (i.e.. if there is evidence that the population proportion of "like the ads a lot" for the company's ads is less than 0.22) at a 0.01 level of significance. Referring to the above, the null hypothesis will be rejected if the test statistic is:

Answers

The null hypothesis will be rejected if the test statistic is: greater than -2.33

The null hypothesis will be rejected if the test statistic falls within the critical region, which is determined by the significance level (0.01 in this case).

To determine the test statistic, calculate the z-score for the sample proportion and compare it to the critical value.

The formula to calculate the z-score for the sample proportion is:

[tex]z = (\hat{p} - p) / \sqrt(p * (1 - p) / n)[/tex]

Where:

[tex]\hat{p}[/tex] is the sample proportion (230/1189 = 0.193)

p is the population proportion (0.22)

n is the sample size (1189)

Calculating the z-score:

z = (0.193 - 0.22) / [tex]\sqrt[/tex](0.22 * (1 - 0.22) / 1189)

z = -2.25

To determine if the null hypothesis is rejected or not, compare the absolute value of the z-score to the critical value for a one-tailed test at a 0.01 significance level.

The critical value for a one-tailed test at a 0.01 significance level is approximately -2.33.

If the absolute value of the calculated z-score is greater than 2.33, we reject the null hypothesis.

Since absolute value of the calculated z-score is not greater than 2.33, null hypothesis is not rejected.

The design of a concrete mix requires 2,314 lb/yd3 of gravel having a moisture content of 3.5% and absorption of 4.2%, and 899 lb/yd3 of sand having a moisture content of 5.7% and absorption of 1.4%, and 244 lb/yd3 of free water. What is the weight of the mixing water per cubic yard that should be used at the job site?

Answers

Answer:

Weight of mixing water=224.541 lb

Step-by-step explanation:

Taking 1 cubic yard of concrete

Mass of gravel = 2314 lb

Moisture content = 3.5% Absorption 4.2%

Extra water needed = (4.2-3.5)*2314/100= 16.198 lb

Mass of sand= 899 lb

Moisture content = 5.7% Absorption =1.4%

Water released = (5.7-1.4)*899/100= 38.657 lb

Free water = 244 lb

Weight of mixing water = free water + extra water needed-water released = 244+16.198-38.657=224.541 lb

Weight of mixing water=224.541 lb

Which expression(s) have a greatest common factor (GCF) of 3xy2 with 42xy4

Answers

Final answer:

None of the provided expressions have a greatest common factor of 3xy² with 42xy⁴ because they do not contain the necessary factors of 3, x, and y².

Explanation:

The student is asking for expressions that have a greatest common factor (GCF) of 3xy² with 42xy⁴. To find expressions with a GCF of 3xy², we need to look for expressions that include multiples of 3xy² in their factorization.

Looking at the provided expressions:

8ry (2x-1) does not have a GCF of 3xy² because it does not contain the necessary factors of 3 and y².3y similarly lacks x and has only y to the first power, not y².6(22-1) provided also does not contain the full factor of 3xy².4xp(y-2) has the x and p factors, but not 3y².The expression 3(4) simply equals 12, which is not a multiple of 3xy².None of the remaining provided expressions contain the necessary factors of 3xy² either.

Therefore, none of the provided expressions have a GCF of 3xy² with 42xy⁴.

Let X denote the courtship time for a randomly selected female-male pair of mating scorpion flies (time from the beginning of interaction until mating). Suppose the mean value of X is 120 min and the standard deviation of X is 110 min (suggested by data in the article "Should I Stay or Should I Go? Condition- and Status-Dependent Courtship Decisions in the Scorpion Fly Panorpa Cognate"†).

Answers

Final answer:

The question is a college-level mathematics problem focusing on statistics related to normal distribution, particularly the calculation of probabilities, defining a random variable, and understanding hypothesis testing and p-values.

Explanation:

The student's question pertains to the concept of normal distribution and statistics as applied to biological data. Specifically, it involves analysis using the mean and standard deviation of a dataset, and proper understanding of hypothesis testing and p-values in scientific research.

Understanding the Random Variable X

The random variable X, in this context, represents the duration of criminal trials. The question requires defining X and calculating related probabilities using the normal distribution properties. A probability statement and sketching of the graph would aid in visual understanding of the probabilities in question.

In statistical hypothesis testing, a p-value less than the level of significance (e.g., 0.01) typically leads to rejection of the null hypothesis, indicating evidence supporting the alternative hypothesis. The data on fruit flies' fecundity and genetic traits provided is an example of such an analysis.

Reina is buying a house either with brick or with siding, with 1 floor or with 2 floors, and in the city, the suburbs, or the
country. On top of that she can choose from 6 different interior paints and 9 different exterior paints.
Using the fundamental counting principle, simplify the expression
combinations
to determine the number of possible
There are possible combinations.
Reina decides she definitely wants a brick house with one floor. Now the number of possible combinations is

Answers

Answer:

1. There are 648 total combinations that can be chosen.

2. After she choses two possiblilities the total number changes to 108 total posibilities to chose from

Step-by-step explanation:

possibility: 1/2 x 1/3 x 1/2 x 1/6 x 1/9 = 648

then you remove the first two because she chose those ones

1/2 x 1/6 x 1/9 = 108 possibilities left

Answer:

Step-by-step explanation:

1.       C

2.        C

3.         B

Engineers must consider the breadths of male heads when designing helmets. The company researchers have determined that the population of potential clientele have head breadths that are normally distributed with a mean of 6.1-in and a standard deviation of 1-in. Due to financial constraints, the helmets will be designed to fit all men except those with head breadths that are in the smallest 4.3% or largest 4.3%.

Answers

Final answer:

The question involves Mathematics and requires understanding of statistics and normal distribution to find z-scores for designing helmets to fit a specific range of male head breadths, accommodating all except the smallest and largest 4.3%.

Explanation:

The subject of this question is Mathematics, specifically focusing on statistics and the concept of normal distribution. Engineers designing helmets need to consider the breadths of male heads, which are normally distributed with a given mean and standard deviation. The design requirements stipulate that the helmets should fit all men except for those in the extremities of the distribution (smallest 4.3% and largest 4.3%).

To address such a problem, one would typically use the z-score to identify the cutoff points on a standard normal distribution that correspond to these percentages. The z-score represents the number of standard deviations a data point is from the mean. Therefore, the engineers must calculate the z-scores that correspond to the smallest and largest 4.3% of the distribution to determine the range of head breadths the helmets must accommodate.

A certain university has 8 vehicles available for use by faculty and staff. Six of these are vans and 2 are cars. On a particular day, only two requests for vehicles have been made. Suppose that the two vehicles to be assigned are chosen at random from the 8 vehicles available. (Enter your answers as fractions.)
a.) Let E denote the event that the first vehicle assigned is a van. What is P(E) ?
b.) Let F denote the probability that the second vehicle assigned is a van. What is P(F|E)?
c.) Use the results of parts(a) and (b) to calculate P(E and F)

Answers

Answer:

a) [tex]P(E) = \frac{6}{8}[/tex]

b) [tex]P(F|E) = \frac{5}{7}[/tex]

c) [tex]P(E \cap F) = \frac{15}{28}[/tex]

Step-by-step explanation:

We use the conditional probability formula to solve this question. It is

[tex]P(B|A) = \frac{P(A \cap B)}{P(A)}[/tex]

In which

P(B|A) is the probability of event B happening, given that A happened.

[tex]P(A \cap B)[/tex] is the probability of both A and B happening.

P(A) is the probability of A happening.

We have that:

8 vehicles, of which 6 are vans.

a.) Let E denote the event that the first vehicle assigned is a van. What is P(E) ?

8 vehicles, of which 6 are vans.

So

[tex]P(E) = \frac{6}{8}[/tex]

b.) Let F denote the probability that the second vehicle assigned is a van. What is P(F|E)?

P(F|E) is the probability that the second vehicle assigned is a van, given that the first one was.

In this case, there are 7 vehicles, of which 5 are vans. So

[tex]P(F|E) = \frac{5}{7}[/tex]

c.) Use the results of parts(a) and (b) to calculate P(E and F)

[tex]P(F|E) = \frac{P(E \cap F)}{P(E)}[/tex]

[tex]P(E \cap F) = P(F|E)P(E)[/tex]

[tex]P(E \cap F) = \frac{6}{8}\frac{5}{7}[/tex]

[tex]P(E \cap F) = \frac{15}{28}[/tex]

Final answer:

The probability of the first vehicle assigned being a van is 3/4, and the conditional probability of the second vehicle being a van given the first was a van is 5/7. The probability that both vehicles assigned are vans is 15/28.

Explanation:

The subject of this question is probability, a topic in Mathematics. We are asked to find the probability of a certain event occurring under certain conditions.

P(E), the probability that the first vehicle assigned is a van. Since there are 6 vans out of 8 vehicles, the probability is 6/8 or 3/4.P(F|E), the conditional probability that the second vehicle assigned is a van given that the first vehicle assigned was a van. After the first van has been assigned, there are now 5 vans left out of 7 vehicles. Therefore, the probability is 5/7.Finally, to find P(E and F), which is the probability that both vehicles assigned are vans, we multiply the probabilities we found in parts (a) and (b), so (3/4) * (5/7) = 15/28.

Learn more about Probability here:

https://brainly.com/question/22962752

#SPJ3

What is 1/3x1/3x1/3[/tex]?

Answers

Answer:

i believe the answer is 1/27

Step-by-step explanation:

you take the fractions and multiply them all together.

1x1x1 equals 1

and 3x3x3 equals 27

meaning the answer is 1/27 :)

Final answer:

To calculate 1/3 x 1/3 x 1/3, you're effectively cubing 1/3, which results in (1/3)^3 or 1^3/3^3, simplifying to 1/27.

Explanation:

The student is asking about the multiplication of fractions and exponentiation rules in algebra. To solve 1/3 x 1/3 x 1/3, you multiply the fractions normally. When multiplying identical fractions, we simply raise the fraction to the power of the number of times it is being multiplied by itself. So 1/3 x 1/3 x 1/3 is equivalent to (1/3)^3. When you raise a fraction to an exponent, you raise both the numerator and the denominator to that power. Therefore, (1/3)^3 equals 1^3/3^3, which simplifies to 1/27.

The example given with 3².35 relates to the rules of exponents, which state that when multiplying exponential terms with the same base, you can add the exponents (x^p x x^q = x^(p+q)). For the concept of cubing of exponentials, you would cube the base and multiply the existing exponent by 3 to execute the operation effectively.

Solve for x. Write both solutions, separated
by a comma.
5x2 + 2x - 7 = 0

Answers

Answer:

it equals 1

Step-by-step explanation:

(5)(2)+2x−7=5

Step 1: Simplify both sides of the equation.

(5)(2)+2x−7=5

10+2x+−7=5

(2x)+(10+−7)=5(Combine Like Terms)

2x+3=5

2x+3=5

Step 2: Subtract 3 from both sides.

2x+3−3=5−3

2x=2

Step 3: Divide both sides by 2.

2x

2

=

2

2

x=1

What is the common difference in the following arithmetic sequence?
7,3,-1,-5​

Answers

Answer:

-4

Step-by-step explanation:

Each term is 4 less than the term before it, so the common difference is -4.

Answer:

B. -4 on edge !!

Step-by-step explanation:

Got it right :)

The director of a radio broadcasting company wants to determine whether the mean length of commercials on his station is equal to 24 seconds. He samples 200 commercials, and finds that the average length of these commercials is 26.3 seconds, with a standard deviation of 7.2 seconds. He uses a significance level of 5%. What is the value of the test statistic?

Answers

Answer:

The value of t test statistics is 4.518.

Step-by-step explanation:

We are given that director of a radio broadcasting company wants to determine whether the mean length of commercials on his station is equal to 24 seconds.

He samples 200 commercials, and finds that the average length of these commercials is 26.3 seconds, with a standard deviation of 7.2 seconds.

Let [tex]\mu[/tex] = mean length of commercials on his station.

So, Null Hypothesis, [tex]H_0[/tex] : [tex]\mu[/tex] = 24 seconds     {means that the mean length of commercials on his station is equal to 24 seconds}

Alternate Hypothesis, [tex]H_A[/tex] : [tex]\mu\neq[/tex] 24 seconds     {means that the mean length of commercials on his station is different from 24 seconds}

The test statistics that would be used here One-sample t test statistics as we don't know about the population standard deviation;

                        T.S. =  [tex]\frac{\bar X-\mu}{\frac{s}{\sqrt{n} } }[/tex]  ~ [tex]t_n_-_1[/tex]

where, [tex]\bar X[/tex] = sample average length of these commercials = 26.3 seconds

            s = sample standard deviation = 7.2 seconds

            n = sample of commercials = 200

So, test statistics  =  [tex]\frac{26.3-24}{\frac{7.2}{\sqrt{200} } }[/tex]  ~ [tex]t_1_9_9[/tex]  

                               =  4.518

The value of t test statistics is 4.518.

rectangle 2 is a scale drawing of rectangle b and has 25% of its area if rectangle A has side lengths of 4cm and 5cm what are the side lengths of rectangle b ?​

Answers

Answer:

24 324

Step-by-step explanation:

21334 fda  adf

Answer: 24, 324

Step-by-step explanation:

Find the perimiter of both sides

what is the equation of the horizontal line that passes through ( 2 -2 )

Answers

Answer:

  y = -2

Step-by-step explanation:

The equation of a horizontal line is ...

  y = constant

In order to make it go through a point with a y-coordinate of -2, the value of the constant must be -2.

Your line is y = -2.

There are 3 paper clips and 5 erasers in a paper stack. If 2 items are drawn at random without replacement what is the probability that one draw a paper clip and then an eraser?

Answers

Answer:

15/56

Step-by-step explanation:

Total = 8

3/8 × 5/7

15/56

The Highway Safety Department wants to study the driving habits of individuals. A sample of 37 cars traveling on a particular stretch of highway revealed an average speed of 70.7 miles per hour with a standard deviation of 6.3 miles per hour. Round to 4 decimal places. 1.Calculate a 90% confidence interval for the true mean speed of all cars on this particular stretch of highway

Answers

Answer:

90% confidence interval for the true mean speed of all cars on this particular stretch of highway is [68.9517 miles per hour , 72.4483 miles per hour].

Step-by-step explanation:

We are given that a sample of 37 cars traveling on a particular stretch of highway revealed an average speed of 70.7 miles per hour with a standard deviation of 6.3 miles per hour.

Firstly, the pivotal quantity for 90% confidence interval for the true mean is given by;

                            P.Q. = [tex]\frac{\bar X-\mu}{\frac{s}{\sqrt{n} } }[/tex]  ~ [tex]t_n_-_1[/tex]

where, [tex]\bar X[/tex] = sample average speed of cars = 70.7 miles per hour

             s = sample standard deviation = 6.3 miles per hour

             n = sample of cars = 37

             [tex]\mu[/tex] = true mean speed

Here for constructing 90% confidence interval we have used One-sample t test statistics as we know don't about population standard deviation.

So, 90% confidence interval for the true mean, [tex]\mu[/tex] is ;

P(-1.688 < [tex]t_3_6[/tex] < 1.688) = 0.90  {As the critical value of t at 36 degree of

                                 freedom are -1.688 & 1.688 with P = 5%}  

P(-1.688 < [tex]\frac{\bar X-\mu}{\frac{s}{\sqrt{n} } }[/tex] < 1.688) = 0.90

P( [tex]-1.688 \times {\frac{s}{\sqrt{n} } }[/tex] < [tex]{\bar X-\mu}[/tex] < [tex]1.688 \times {\frac{s}{\sqrt{n} } }[/tex] ) = 0.90

P( [tex]\bar X-1.688 \times {\frac{s}{\sqrt{n} } }[/tex] < [tex]\mu[/tex] < [tex]\bar X+1.688 \times {\frac{s}{\sqrt{n} } }[/tex] ) = 0.90

90% confidence interval for [tex]\mu[/tex] = [ [tex]\bar X-1.688 \times {\frac{s}{\sqrt{n} } }[/tex] , [tex]\bar X+1.688 \times {\frac{s}{\sqrt{n} } }[/tex] ]

                    = [ [tex]70.7-1.688 \times {\frac{6.3}{\sqrt{37} } }[/tex] , [tex]70.7+1.688 \times {\frac{6.3}{\sqrt{37} } }[/tex] ]

                    = [68.9517 miles per hour , 72.4483 miles per hour]

Therefore, 90% confidence interval for the true mean speed of all cars on this particular stretch of highway is [68.9517 miles per hour , 72.4483 miles per hour].

The interpretation of the above interval is that we are 90% confident that the true mean speed of all cars will lie between 68.9517 miles per hour and 72.4483 miles per hour.

Other Questions
What are two causes of soil loss? Jana made a table to help her review the types of mutations for an exam. She started with the sequence THE MAN SAT TALL. Which statement best describes Janas error in the table? The insertion sequence should be the deletion sequence. The substitution sequence should be the insertion sequence. The insertion and deletion sequences should be switched. The substitution and deletion sequences should be switched. This group was formed in the Georgia General Assembly in 1960 for the purpose of gathering public reaction to Federal orders to integrate public schools within the state. From the Khan Academy Video on Impact of Media Evolution on Politics (Slide #2), what example of early newspapers influenced the ratification (passing) of our US Constitution? (Hint: we learned this earlier in the yearwhat group believed in a Strong Central Government?) What are the three domains of life?Plantae, Animalia, and Fungiclass, kingdom, and phylumEubacteria, family, and EukaryaBacteria, Archaea, and Eukarya 5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in