Find the quotient of 3 2/5 and 3 2/6. Express your answer in simplest form.

Answers

Answer 1
32/5÷32/6=32/5×6/32=6/5

Related Questions

Two trains leave stations 216 miles apart at the same time and travel toward each other. one train travels at 85 miles per hour while the other travels at 95 miles per hour. how long will it take for the two trains to meet

Answers

Final answer:

The two trains traveling towards each other at 85 mph and 95 mph respectively, will meet after 1.2 hours, as they have a combined approach rate of 180 mph.

Explanation:

To find out how long it will take for two trains to meet when they start 216 miles apart, moving toward each other at speeds of 85 miles per hour and 95 miles per hour, respectively, we can add their speeds to determine their approach rate. The sum of their speeds is the relative speed at which they are moving towards each other. Therefore, we calculate:

85 mph + 95 mph = 180 mph.

This means that the two trains cover 180 miles of the distance between them in one hour. To find the total time until they meet, we divided the total distance by their approach rate.

216 miles ÷ 180 mph = 1.2 hours.

Therefore, it will take 1.2 hours for the two trains to meet.

Given the piecewise function shown below, select all the statements that are true.

A.f(-2)=0
B.f(-1)=2
C.f(4)=7
D.f(1)=0

Answers

C
because it is the only logical answer

Heather is a cashier. She can ring up 12 customers in 9 minutes. At this rate, how many minutes does it take her to ring up 4 customers?

Answers

9 minutes / 12 customers = 0.75 minutes per customer

4 customers x 0.75 minutes per customer = 3 minutes total for 4 customers

First of all, let's compare the statements. That will be;
12 customers=9 minutes
4 customers= Y minutes.
I represented the unknown with Y. Next, you need to cross multiply. 4 will multiply 9 to give 36 and 12 will multiply Y to give 12Y. That will be;
12Y=36
Divide both sides by 12
Y=36/12
Y=3
It takes 3 minutes to ring up 4 customers. Hope that helped. Have a nice day

a national park has two options: a $50 pass for all admissions during the year, or a $4 entrance fee each time you enter. Write an equation to model the cost of going to the park for a year using the pass and another equation for paying a fee each time

Answers

With the variable "y" being used to represent the total cost of going to the park for a year, the first equation would read "y = 50" since it is a one-time, flat cost. The second equation would be "y = 4x", with "x" being used to represent the number of times the person visited the park during the year multiplied by the $4 cost per visit.

Pls help I’m getting really frustrated with this question

Answers

an  x intercept is where the blue line meets both the x and y coordinates given

 in this graph the only one of the 4 answers that the blue line meets is (-1,0)

What value of f makes -35 - (-15) = f a true sentence?

Answers

Answer:

-20

Step-by-step explanation:

The two negatives will cancel each other out, so you will have -35 + 15 =  f. If you add 15 to -35, you will have a smaller negative number since you are getting closer to 0.

Boats can travel anywhere between 50 and 150 kilometers per hour. Choose a speed between 50 and 150. Convert the speed you chose into meters per second

Answers

Take 75 kilmoeters That is 1250 meters per second

/: You work out. /: You practice your free throws in basketball. /: You are a starting player. Write the following compound statement in symbolic form. If you work out and practice your free throws in basketball, then you will be a starting player.

Answers

The symbolic form for If you work out and practice your free throws in basketball, then you will be a starting player should be

If p and q then r
(p V q) -> r

Final answer:

To convert the compound statement into symbolic form using propositional logic, we assign P to 'You work out', Q to 'You practice your free throws', and R to 'You are a starting player', resulted in the symbolic representation \((P \land Q) \rightarrow R\).

Explanation:

To write the compound statement 'If you work out and practice your free throws in basketball, then you will be a starting player.' in symbolic form, you can use propositional logic symbols. Let's define the simple statements first:

P: You work out.

Q: You practice your free throws in basketball.

R: You are a starting player.

The compound statement combines these simple statements using the logical connective 'and', symbolized by \(\land\), and the implication 'then', symbolized by \(\rightarrow\). The symbolic form of the compound statement is:

\((P \land Q) \rightarrow R\)

This reads as 'If P and Q are true, then R will also be true.'

If a cookie recipie cals for 4, 1/4 cups if flour and you cut the ricipie in half ,how much flour would you nuse

Answers

The answer is:  " 2 ⅛  cups " .  {or;  "2 cups plus 2 Tablespoons" .}.
_______________________________________________________
Explanation:
_______________________________________________________
4 ¼  ÷ 2 = (17/4) ÷ (2/1) = (17/4) * (1/2) = (17 * 1) / (4*2) = (17 / 8) =

                2 ⅛  cups .
____________________________
Also, note that 16 Tablespoons = 1 cup.

So, ⅛ cup = (⅛ * 16) Tablespoons = 2 Tablespoons.
________________________________________
So,  2 ⅛  cups = 2 cups PLUS 2 Tablespoons.
________________________________________

divide  4 1 /4 cups by 2

4/2 = 2

1/4 / 2 = 1/8

 so 2 1/8 cups are needed

Write The Equation Of The Line.

Answers

Good morning!

I believe the answer is zero, because a slope that is going straight across is called a zero slope. (Possibly helpful tip: A line going straight up is called undefined slope.)

Hope this helps! ☺♥

Denise is constructing A square in which two of its vertices are points M and N. She has already used her straightedge and compass to construct the lines and arcs shown.

What should Denise do for her next step?

A) use a straightedge to draw a horizontal line that contains point O.

B) use a straightedge to draw MO.
C) place the point of the compass on point M and draw any arc above it.

D) place the point of the compass on point N and draw an arc that intersects N O, using MN as the width for the opening of the compass.

Answers

I'm thinking the answer maybe D) but I'm not 100% sure.

I hope that helps.

Denise is constructing A square.

Note: A square has all sides equal.

We already given two vertices M and N of the square.

And another edge of the square is made by from N.

Because a square has all sides of equal length, the side NO should also be equal to MN side of the square.

Therefore, Denise need to place the point of the compass on point N and draw an arc that intersects N O, using MN as the width for the opening of the compass. That would make the NO equals MN.

Therefore, correct option is :

D) place the point of the compass on point N and draw an arc that intersects N O, using MN as the width for the opening of the compass.

The sum of 5 consecutive integers is 265. What is the fifth number in this sequence?

Answers

Final answer:

To find the fifth number in a sequence of 5 consecutive integers with a sum of 265, you can use the formula for the sum of an arithmetic series. The fifth number is 53.

Explanation:

To find the fifth number in a sequence of 5 consecutive integers where the sum is 265, we can use the formula for the sum of an arithmetic series. The formula is: Sum = (n/2)(2a + (n-1)d), where n is the number of terms, a is the first term, and d is the common difference. In this case, we have n = 5, so:

265 = (5/2)(2a + 4d)265 = 2.5a + 10da + 4d = 53

Since we are looking for the fifth term, we can use the formula a + (n-1)d = 53 to solve for the fifth number:

a + 4d = 53a + 4(a+d) = 532a + 4d = 532a + 8d = 1062a + 8d - 2a - 4d = 106 - 534d = 53d = 13.25

Substituting the value of d back into the equation a + 4d = 53, we can find the value of a:

a + 4(13.25) = 53a + 53 = 53a = 53 - 53a = 0

Therefore, the fifth number in the sequence is a + 4d = 0 + 4(13.25) = 53.

11

Number 35 Plz someone help me in this problem ❤️

Answers

Greetings!

This can be solved by creating an algebraic equation:
[tex]8.75(30)+11x=400[/tex]

Solve for x.
[tex]262.5+11x=400[/tex]
Add -262.5 to both sides.
[tex](262.5+11x)+(-262.5)=(400)+(-262.5)[/tex]
[tex]11x=137.5[/tex]
Divide both sides by 11.
[tex](11x)/11=(137.5)/11[/tex]
[tex]x=12.5[/tex]

You must work 12.5 hours as landscaper to earn $400 a month.

Hope this helps.
-Benjamin

The domain of the function given below is the set of all real numbers greater than 1 F(x) =(1/2)^x A. True B false

Answers

it is false for APEX


Answer:

The given statement is False.

Step-by-step explanation:

We have been given the function [tex]f(x)=(\frac{1}{2})^x[/tex] and the domain of this function is all real numbers greater than 1.

We know that the domain is the set of x values for which the function is defined.

We can see that for any real values of x, the function is defined. Therefore, the domain of the given function is the set of all real numbers.

Therefore, the given statement is False.

List the intercepts, vertex, and axis of symmetry for each quadratic function whose graph is shown.

Answers

do you have a picture of the actual graph?

331 students went on a field trip. Six buses were filled and 7 students traveled in cars. How many students were in each bus?

Answers

54 students travelled in each bus
331 = 6x + 7

331 (-7) = 6x + 7 (-7)

324 = 6x

324/6 = 6x/6

x = 54

There are 54 students per bus

hope this helps

Use the information given to enter an equation in standard form. Slope is -6, and (7, 5) is on the line.

Answers

point-slope formula; 

y - y1 = m(x - x1)       slope(m) = -6     point(7, 5)

y - 5 = -6(x - 5)

y - 5 = -6x + 30

y = -6x + 30 + 5

y = -6x + 35    <<< the equation.

hope this helps, God bless!

To find the standard form of a line with a given slope and a point, use the point-slope formula, plug in the values, and rearrange into Ax + By = C.

To enter an equation in standard form using the given information that the slope is -6 and the point (7, 5) is on the line, we start by using the point-slope formula:

y - y1 = m(x - x1)

Where (x1, y1) is the given point and m is the slope. Plugging in the values, we have:

y - 5 = -6(x - 7)

Now we distribute the slope on the right side:

y - 5 = -6x + 42

Adding 5 to both sides to solve for y gives us:

y = -6x + 47

To get the standard form, Ax + By = C, we add 6x to both sides:

6x + y = 47

This is the equation in standard form

the area of a circle is 78.5 square centimeters, and a subtending arc on the circle has an arc length of 6 pie. what is he measure of the angle subtended by the arc?

Answers

Area of the circle = pi * (radius)^2
78.5 = 3.14 * (radius)^2
radius = 5 cm
circumference of circle = 2*pi*radius = 2*3.14*5 = 10*pi cm

Now, we can get the subtended angle by the arc using the proportionality rule which states that:
(subtended angle / 360) = (arc length / circumference)
360 is a constant
arc length = 6 * pi
circumference = 10*pi cm

Substitute in the proportionality rule to get the angle as follows:
(angle / 360) = (6pi / 10pi)
(angle / 360) = 0.6
angle = 360 * 0.6 = 216 degrees

Help!!!!

I’ll mark you brainliest !!!

Answers

f(x) = 3^x

f(x) = 27

3^x = 27

3^x = 3^3

x = 3

Please help. I'm horrible at equations

Solve for x. 2x/3+1=3
x = 1 1/3
x = 2 2/3
x = 3
x = 6

Answers

you'll have to probably do 4 equations
substitute all your possible answers for x in different equations
first you would times 2 by whatever is in the x
next you would divide that by 3
then you'd add 1
and lastly you see what your answer is, when your substitute comes out as this 3=3 that x is the answer

Solve x ym = y x3 for m.

Answers

xym=yx^3
xym/xy=yx^3/yx
m=x^2

The price of an item has been reduced by 40% . the original price was $65 . what is the price of the item now?

Answers

65×(1-40%)
=$39
the price of the item is $39 now


Convert each number to scientific notation or standard notation.

1. 2,000

2. 91,007,500

3. 1.0395 x 1000000000

4. 4 x 100

5. 0.02

6. 0.000701

7. 8.9 x 100000

8. 4.41 x 100

Answers

ok. i got this.

1. 2 x 10^2
2. 9.10075 x 10^7
3. 1.0395 x 10^9
4 .400
5. 2 x 10^-2
6. 7.01 x 10^-4
7. 890000
8. 441

Final answer:

Scientific and standard notation conversion for a variety of numbers.

Explanation:

1. The number 2,000 can be written in scientific notation as 2 × 103. In standard notation, it remains as 2,000.

2. The number 91,007,500 can be written in scientific notation as 9.10075 × 107. In standard notation, it remains as 91,007,500.

3. The number 1.0395 × 109 is already in scientific notation. In standard notation, it would be 1,039,500,000.

4. The numbers 4, 100, and 5 are already in standard notation. In scientific notation, 4 can be written as 4 × 100, 100 can be written as 1 × 102, and 5 can be written as 5 × 100.

0.026 can be written in scientific notation as 2.6 × 10-2. In standard notation, it remains as 0.026.

0.0007017 can be written in scientific notation as 7.017 × 10-4. In standard notation, it remains as 0.0007017.

8.9 × 106 is already in scientific notation. In standard notation, it would be 8,900,000.

4.41 × 102 is already in scientific notation. In standard notation, it would be 441.

Learn more about Scientific and Standard Notation here:

https://brainly.com/question/28438534

#SPJ12

12=-4(-6x-3)+2x work it out for me and tell me how many solutions

Answers

12 = -4(-6x - 3) + 2x

Distribute the -4 on the right side.

12 = 24x + 12 + 2x

Combine like terms on the right side.

12 = 26x + 12

Subtract 12 from both sides.

0 = 26x

Divide both sides by 26

0 = x

Switch sides.

x = 0

There is one solution.

A dance academy charges $24 per class and a one-time registration fee of $15. a student paid a total of $687 to the academy. find the number of classes the student took.

Answers

28 is the correct answer

Final answer:

The student took 28 classes at the dance academy.

Explanation:

The question is asking us to find out the number of dance classes the student took. This is a problem of linear equation where the total cost is the sum of the one-time registration fee and the total cost for the classes attended.

We are given the total amount paid, $687, and we know that $24 is charged per class plus a one-time fee of $15. We can represent this information in a linear equation [tex]687 = $15 + $24x[/tex], where x is the number of classes the student took.

Subtract the one-time fee from both sides of the equation you get $672 = $24x. Finally, solve for x by dividing by 24 you get x = 28. This means the student took 28 classes at the dance academy.

Learn more about Linear Equation here:

https://brainly.com/question/32634451

#SPJ2

Find the value of 3 + 4(16 - 9)
Dont forget to use order of operations btw

31
49
58

Answers

Work out the parentheses first:-
3 + 4(7)
Now the multiplication
= 3 + 28
=  31 answer
Hey!

To solve this, to the parenthesis first.

3 + 4(16 - 9) --> 3 + 4 * 7.

To the multiplication next..

3 + 4 * 7 ---> 3 + 28.

Do the addition. 

3 + 28 ---> 31.

Your answer is A.

Hope this helps!!

Ruth borrowed $2000, part from each of two different sources, for a 6-month period. One charged 6% interest and the other 8% interest. When she paid them off, she paid a combined total of $68 in interest. How much did she borrow at each rate? Show how you got it

Answers

X is 6% interest
Y is 8% interest

X+Y=2000 or 0.08X+0.08Y=160
0.06X+0.08Y=68*2
Subtract the two equations:
0.08X-0.06X+0.08Y-0.08Y=160-68*2
0.02X=92
X=1200
Y=800

Write an equation for the line parallel to y= -7x+15 that contains p(9,-6)

Answers

The slope of the line we seek must me the same as the slope of the given line because THE LINES ARE PARALLEL.

The two lines never meet.

The slope of the given line is -7.

See it?

Plug -7 and the given point into the point-slope formula.

y - (-6) = -7(x - 9)

Solve for y.

y + 6 = -7x + 63

y = -7x + 63 - 6

y = -7x + 57

Did you follow?
Final answer:

The equation of a line parallel to y = -7x + 15 that passes through the point (9,-6) is y = -7x + 57.

Explanation:

The question asks for an equation of a line parallel to y = -7x + 15 that passes through the point p(9,-6). Parallel lines have the same slope. Thus, the slope of our new line is also -7. In the form y = mx + b, 'm' represents the slope and 'b' is the y-intercept.  We know the slope and a point on the line, but we don't know the y-intercept. We can plug the point p' s coordinates (9,-6) into the equation and solve for 'b'.

Therefore, -6 = -7(9) + b results in b = 57. So, the equation of the requested line is y = -7x + 57.

Learn more about Parallel lines here:

https://brainly.com/question/29762825

#SPJ3

Consider the parabola: y=−2x2−16x−27. what is the linear equation for the axis of symmetry for this parabola?

Answers

The axis of symmetry would be -4
If you graph it the coordinates would be Negative 4 and Positive 5 and draw the U facing you and not away

The linear equation for the axis of symmetry for the parabola y = -2x² - 16x - 27 is x = -4.

What is Parabola?

A parabola is a U-shaped curve this is drawn for a quadratic function,

f(x) = ax² + b x + c. The graph of the parabola is downward (or opens down), when the price of a is much less than 0, a < 0. The graph of the parabola is upward (or opens up) when the value of a is more than 0, a > 0.

Consider the parabola: y=−2x²−16x−27.

The axis of symmetry of a parabola is a line that divides the parabola into two mirror images.

For a parabola in the form y = ax² + b x + c, the axis of symmetry is a vertical line that passes through the vertex of the parabola.

The x-coordinate of the vertex is given by -b/(2a), so the equation of the axis of symmetry for the given parabola is :

x = -(-16)/(2×-2) = -4.

Therefore, the required axis of symmetry for the parabola is x = -4.

Learn more about the parabola here:

brainly.com/question/4074088

#SPJ5


50 POINTS 


What statement correctly describes the key features of the graph of f(x) = 4(one half)x + 1 − 3?

A. Y-intercept of (0, −1), starts up on the left, gets closer to y = −3 on the right
B. Y-intercept of (0, −1), starts down on the left, gets closer to y = −3 on the right
C. Y-intercept of (0, 1), starts up on the left, gets closer to y = −3 on the right
D. Y-intercept of (0, 1), starts down on the left, gets closer to y = −3 on the right

Answers

Answer:

Option D correctly describes the key features of the graph of the function.

Explanation:

To analyze the given function [tex]\( f(x) = 4(0.5x) + 1 - 3 \)[/tex], let's break it down:

1. The function is in the form [tex]\( f(x) = mx + b \)[/tex], where [tex]\( m \)[/tex] represents the slope and [tex]\( b \)[/tex] represents the y-intercept.

2. The coefficient of [tex]\( x \), \( 0.5 \)[/tex], represents the slope of the line. Since it's positive, the line is increasing from left to right.

3. The y-intercept occurs when [tex]\( x = 0 \)[/tex]. Substituting [tex]\( x = 0 \)[/tex] into the function, we find [tex]\( f(0) = 4(0.5 \times 0) + 1 - 3 = 1 - 3 = -2 \).[/tex] So, the y-intercept is (0, -2).

Now, let's consider the options:

A. Y-intercept of (0, −1), starts up on the left, gets closer to y = −3 on the right - Incorrect.

B. Y-intercept of (0, −1), starts down on the left, gets closer to y = −3 on the right - Incorrect.

C. Y-intercept of (0, 1), starts up on the left, gets closer to y = −3 on the right - Incorrect.

D. Y-intercept of (0, 1), starts down on the left, gets closer to y = −3 on the right - Correct.

Other Questions
What is the primary mode of transportation for Manaus 1.9r+0.1r=0.6 what s the value of r which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some?