Find the surface area of the equilateral triangular pyramid.

Find The Surface Area Of The Equilateral Triangular Pyramid.

Answers

Answer 1
C is the correct answer



good luck
Answer 2

Answer:

i think the answer is C.

GOOD LUCK!!!


Related Questions

The perimeter of a rectangle is 68cm the length is 4cm less than three time its width write a system of equation to find the dimension of the rectangle

Answers

Check photo for details

What is the volume of the pyramid?
https://static.k12.com/eli/bb/1458/3_84696/2_59509_5_84702/7a4a0ad2c3db47a5bb13d74edb27ae71bb21609c/media/8ee1c253d3ddab3cb61cec6450534e7b590f7487/mediaasset_1422977_1.jpg


3192 cm3 12,768 cm3 19,152 cm3 6384 cm3

Answers

6384 is the correct answer.

The correct answer is 3192 cm3. I just did the test.

Will give brainliest answer if right!! Thank you please help

Answers

You are debating about whether to buy a new computer for $800.00 or a refurbished computer with the same equipment for $640.00. If a savings account earns 4.5% APR interest, how much do you really save with a refurbished computer if you put the difference into the savings account for a year?
Be sure to include the following in your response:

-The answer to the original question
-The mathematical steps for solving the problem demonstrating mathematical reasoning

$800 - $640 = $160 
So you invest $160 for one year and get 4.5 % interest on it. 
$160 * 1.045 = $167.20 in the bank after one years interst is added.

Cancelling a dance class after several students hurt themselves is an example of which risk management strategy?

Answers

Answer:
Avoid strategy as the threat/risk is directly related to identified threats and these sources of threats are cancelled

Explanation:
Risk management is defined as: 
The identification , analysis, control and possibly elimination of any undesired hazards or risks arising from a certain situation or activity

There are four risk management strategies which are:
1- Avoid: To eliminate the risk by totally avoiding the situation/activity
2- Mitigate: To try to reduce the expected hazards of the situation/activity
3- Accept: To accept the hazards and take your chances
4- Transfer: To outsource the risk (as in case of insurance)

In case of cancelling the dance class, we can note that the risks are directly related to identified threats and the threats are totally cancelled in order to avoid those risks. Therefore, the best strategy describing this situation is "avoid strategy"

Hope this helps :)
Final answer:

The scenario of cancelling a dance class due to student injuries is an example of the 'risk avoidance' strategy in risk management, which aims to avoid potential harm.

Explanation:

Canceling a dance class due to multiple students getting injured is a risk management strategy known as risk avoidance. This strategy eliminates the risk by not participating in the activity that could lead to the risk. In this context, the dance class risks injury to the students. In such a scenario, the dance instructor or school chooses to avoid the risk (moral hazard) by cancelling the activity (i.e., the dance class), thereby protecting the students from further harm. This is a common approach employed in situations where the potential adverse outcomes of risk outweigh any potential benefits of the activity.

Learn more about Risk Management here:

https://brainly.com/question/34947647

#SPJ3

Predict the vital capacity of a 20-year-old 5'5" female who weighs 120 pounds using the equation below: vc = (0.041) h - (0.018) a - 2.69

Answers

Final answer:

The predicted vital capacity of a 20-year-old, 5'5" female, using the provided equation, is approximately 3.97 liters.

Explanation:

To predict the vital capacity of this 20-year-old 5'5" female who weighs 120 pounds using the given equation, we first need to convert the height from feet to centimeters since standard medical measurements are usually in metric units. The conversion is 1 foot = 30.48 cm. Therefore, 5'5" = 5*30.48 cm + 5*2.54 cm = 165.1 cm. Now we can substitute the height (h) and age (a) into the equation: vc = (0.041) h - (0.018) a - 2.69 = (0.041*165.1) - (0.018*20) - 2.69 ≈ 3.97 Liters. Therefore, the predicted vital capacity of this 20-year-old 5'5" female is approximately 3.97 liters.

Learn more about Vital Capacity here:

https://brainly.com/question/31184355

#SPJ3

Patrick washes 21 cars per day. He is paid at a  rate of $7.50 for every 3 cars he washes. How much is Patrick paid for each car he washes?

Answers

$7.50/3 cars = $2.50/1 car
Answer: $2.50

i need help so bad asap

Answers

2x+3=3y+1

Substitute x=2 and y=2
2•2+3=3•2+1 ✔️

Substitute x=4 and y=4
11=13 ❌

Substitute x=3 and y= 3
9=10 ❌

Substitute x=5 and y= 5
13=16 ❌

Bruno is designing his next skateboard. the skateboard store has 333 types of grip tape, 131313 types of decks, 777 types of trucks, 4 types of bearings, and 2 types of wheels. how many different skateboards can bruno create

Answers

Did u make this up? Because there are would be loads

Answer:

2184 is what i got.

Step-by-step explanation:

What is the second term in the binomial expansion of (2r – 3s)12? –73,728r11s 73,728r11s 608,256r10s2 –608,256r10s2?

Answers

It is A, my friend. I have taken the test and got it right ;)


Solution:

A is the correct option.

Explanation:

We have been given that [tex](2r - 3s)^{12}[/tex]

The [tex]r^{th}[/tex] term of a binomial expansion [tex](a+b)^n[/tex] is given by

[tex]t_r=^{n}C_{r-1}a^{n-r+1}b^{r-1}[/tex]

For the given binomial expansion, we have

[tex]a=2r,b=-3s,r=2,n=12[/tex]

On plugging this value in the above formula, we have

[tex]t_2=^{12}C_{2-1}(2r)^{12-2+1}(-3s)^{2-1}\\\\t_2=^{12}C_1 (2r)^{11}(-3s)^{1}\\\\t_2=\frac{12!}{1!11!}(2)^{11}r^{11}(-3)s\\\\t_2=12\cdot (2)^{11}(-3)r^{11}s\\\\t_2=-73728r^{11}s[/tex]

Therefore, the second term is -73728r^11 s

A is the correct option.



I really need help with this!!

Answers

sine (x) = opp/hyp definition

             = wx/xy    substitute

             = 12/13    plug in wx

12 and xy= 13

Coach miller bought 5.15 pounds of ground beef to make burgers The cost of ground beef is $3.40 for each pound.What was the total cost for all of the ground beef?

Answers

The total cost of all the ground beef is $17.51.
Final answer:

The total cost of the ground beef bought by Coach Miller is calculated by multiplying the quantity (5.15 pounds) by the price per pound ($3.40). The total cost comes to $17.51.

Explanation:

The subject of the question is a practical application of multiplication in Mathematics. Coach Miller bought 5.15 pounds of ground beef at a rate of $3.40 per pound. To calculate the total cost, you simply need to multiply the quantity (5.15 lbs) by the price per unit ($3.40/lb).

So the calculation will be: 5.15 (pounds) × $3.40 (cost per pound) = $17.51 So, the total cost for all of the ground beef would be $17.51.

Learn more about Multiplication here:

https://brainly.com/question/5992872

#SPJ12

consider the enlargement of the pentagram

Answers

x/7=7/15

Solving for x:
7(x/7)=7(7/15)
x=(7)(7)/15
x=49/15

Answer: x=49/15

There are 7 performers who are to present their acts at a variety show. One of them insists on being the first act of the evening. If this request is granted, how many different ways are there to schedule the appearances?

Answers

For the first performer, there is only one choice
for the second, 6 choices
third, 5
fourth,4.....

You have to multiple them together :
1*6*5*4*3*2*1=720ways

there are 720 ways to schedule this show
Final answer:

Since one of the seven performers insists on being the first act, the remaining six performers can be arranged in '6!' (factorial of 6) ways. Therefore, there are 720 different ways to schedule the appearances of the variety show.

Explanation:

This problem is a permutation problem. Since one performer insists on being the first act of the evening, this leaves 6 other acts that can be arranged in any order. In permutation, if you have 'n' different items, they can be arranged in 'n!' (n factorial) ways. The factorial of a number n, denoted as 'n!', is the product of all positive integers less than or equal to n.

In this case, 6 performers can be arranged in '6!' ways. The factorial of 6 (6!) is 6 * 5 * 4 * 3 * 2 * 1 = 720. Therefore, there are 720 different ways to schedule the appearances of the remaining 6 acts after the first performer has gone on.

Learn more about Permutation here:

https://brainly.com/question/23283166

#SPJ2

Will constructed a figure on a graph using coordinates: M(2,3),N (8,3),AND
(5,2)
How long is the line segment M N in Will's graph?

Answers

When graphed it makes a straight line with the length of 6 units.

convert the following complex number into its polar representation 2+2i

Answers

To write 2+2i into polar form we proceed as follows:
2+2i
simplifying the above we get
2(1+i)
dividing through above through by √2
=2*√2(1/√2+i/√2)
but
1/√2=cos (π/4)=sin (π/4)
thus our expression will be:
=2√2(cos (π/4)+isin (π/4))

Answer:

[tex]z=2\sqrt{2}(cos{\frac{\pi}{4}}+isin{\frac{\pi}{4}})[/tex]

Step-by-step explanation:

The given complex number is:

[tex]2+2i[/tex]

Now, the polar from of the complex number [tex]z=a+ib[/tex] is [tex]z=r(cos{\theta}+isin{\theta})[/tex].

Finding the absolute value of r:

[tex]r=|z|={\sqrt{2^2+2^2}[/tex]

[tex]r=\sqrt8[/tex]

[tex]r=2\sqrt{2}[/tex]

Now, find the value of argument,

Using formula, [tex]{\theta}=tan^{-1}(\frac{b}{a})[/tex]

[tex]{\theta}=tan^{-1}({\frac{2}{2})[/tex]

[tex]{\theta}=tan^{-1}(1)[/tex]

[tex]{\theta}={\frac{\pi}{4}}[/tex]

Thus, the polar form is:

[tex]z=2\sqrt{2}(cos{\frac{\pi}{4}}+isin{\frac{\pi}{4}})[/tex]

which is the required polar form.

If there is a very strong correlation between two variables, then the coefficient of correlation must be

Answers

Final answer:

If there is a very strong correlation between two variables, then the coefficient of correlation must be close to 1 or -1.

Explanation:

The correlation coefficient measures the strength and direction of the relationship between two variables. If there is a very strong correlation between two variables, then the coefficient of correlation must be close to 1 or -1. A correlation coefficient of 1 indicates a perfect positive correlation, meaning the variables increase and decrease together.

A correlation coefficient of -1 indicates a perfect negative correlation, where one variable increases while the other decreases.

Find 2 positive real numbers that differ by 1 and have a product of 1

Answers

A) x -y =1
B) x * y =1
B) y = 1/x

A) x -(1/x) = 1
Multiplying both sides by "x"
A) x^2 -1 = x
A) x^2 -x -1 = 0

Solving by the quadratic formula
x = 1.618 and
y = .618

Interestingly, the number 1.6180339... is called the "phi ratio" or the "golden ratio".
https://en.wikipedia.org/wiki/Golden_ratio




A man has 28 coins in his pocket, all of which are dimes and quarters. if the total value of his change is 520 cents, how many dimes and how many quarters does he have?

Answers

Final answer:

To solve the problem, we can set up a system of equations. The solution is 12 dimes and 16 quarters.

Explanation:

To solve this problem, we can set up a system of equations. Let's say the number of dimes is x and the number of quarters is y. We know that the total number of coins is 28, so we can write the equation:

x + y = 28

We also know that the value of the dimes is 10 cents and the value of the quarters is 25 cents. The total value of the change is 520 cents, so we can write the equation:

10x + 25y = 520

We can solve this system of equations using substitution or elimination. Let's use substitution:

From the first equation, we can express x in terms of y:
x = 28 - y

Substitute this value of x into the second equation:
10(28 - y) + 25y = 520

Simplify and solve for y:
280 - 10y + 25y = 520
15y = 240
y = 16

Now substitute this value of y back into the first equation to find x:
x + 16 = 28
x = 12

Therefore, the man has 12 dimes and 16 quarters.

BRAINLIEST please help?
A graph that displays bivariate data is called _________ ?

Positive Association


Strength of Association


Bivariate Data


Scatterplot


Two-Way Table


Two-Way Relative Frequency Table


No Association


Relative Frequency


Association


Negative Association

Answers

Answer:

Scatterplot

Step-by-step explanation:

Bivariate data means that the data is in two variables. For example, if the height of the students is plotted against their age, this data will be the bivariate data.

A bivariate data is represented using the graph known as Scatter Plot. One variable is plotted along x-axis and second variable is plotted against y-axis. After plotting the two variables we can observe the relation(association) between the two variable using the line of best-fit which models the relation between the two variables.

So, the answer to this question is Scatterplot.

Final answer:

A graph that displays bivariate data is called a Scatterplot. It represents two variables and can indicate Positive Association, Negative Association, or No Association, based on the scatter pattern.

Explanation:

In the field of Statistics, a graph that displays bivariate data is referred to as a Scatterplot. Bivariate data represents two different variables, and a scatterplot is a graphical representation that uses dots to show the relationship, if any, between these two sets of data.

When looking at a scatterplot, the patterns of the dots can indicate associations. Positive Association is when as one variable increases, so does the other. Negative Association is when one variable decreases as the other increases. If the dots seem randomly scattered, it exhibits No Association.

Learn more about Scatterplot here:

https://brainly.com/question/34597785

#SPJ12

solve 4^x = 243 round to the nearest ten thousandth

Answers

x=ln(243)/2ln(2) which equals 3.96240625
your answer is 3.9624

Answer:

Value of x is 4.0

Step-by-step explanation:

Given:

[tex]4^x=243[/tex]

To find: Value of x.

We use the following rule,

[tex]log\,x^a=a.log\,x[/tex]

Consider,

[tex]4^x=243[/tex]

Take log on both sides.

[tex]log\,4^x=log\,243[/tex]

[tex]x\times log\,4=log\,243[/tex]

[tex]x=\frac{log\,243}{log\,4}[/tex]

[tex]x=\frac{2.386}{0.602}[/tex]

x = 3.962

x = 4.0   (nearest tenth)

Therefore, Value of x is 4.0

Which property is used in the problem below?

2(x+4)=2x+8

the associative property

the commutative property

the distributive property

the additive identity property

Answers

This is the distributive property.

the answer is The distributive property hoped I helped


AT a groyrey store salted peanuts in a shell cost 30 cents per ounce is 5$ enough money to buy 1 pound of peanuts if it is what amount of money will be leaft over

Answers

1 shell of slated peanuts = 30 cents of dollar/Ounce = $0.3/Ounce

Money available = $5
Required purchase = 1 pound of slated peanuts = 16 ounces of peanuts

Given the cost per ounce,

16 ounces pf peanuts = 0.3*16 = $4.8

Balance = $5-$4.8 = $0.2 = 20 cents

There, $5 can buy 1 pound of peanuts will a balance of 20 cents.

The volume of a cylinder is 1323pi cmcubed. The radius of the base of the cylinder is 7 cm. What is the height of the​ cylinder? The height of the cylinder is nothing cm. ​(Simplify your​ answer.)

Answers

V of cylinder = πr²h
h=V /(πr²)
h=27/π -exact value
h=1323/(3.14*(7)²)= 8.6 cm - approximate value

The height of the cylinder with a given volume of 1323
cmcubed and a radius of 7 cm, divide the volume by the area of the base. The correct height is 27 cm.

The height of a cylinder given its volume and the radius of its base. To find the height, we'll use the formula for the volume of a cylinder, which is V = ()h, where V is the volume,  is the radius and h is the height.

Step-by-step calculation:

The volume of the cylinder is given as 1323cmcubed.

The radius (r) of the base of the cylinder is given as 7 cm.

Plugging these values into the formula: 1323cm³= (7 cm)²  imes h.

Simplify the equation: 1323cm³ = 49cm²  imes h.

Divide both sides by 49cm² to find the height: h = 1323cm³ / 49cm².

The resulting height is therefore 27 cm, which is the solution to the problem.

The height of the cylinder is 27 cm.

Consumer reports stated that the sodium content, in milligrams, for a two tablespoon serving for 10 different brands is as follows: 120, 50, 120, 140, 150, 150, 110, 249, 171, 60 What is the mean of the data set? Type a numerical answer in the box. a0

Answers

To find the mean (fair share/average) of the data set, you will combine all the numbers (add) and then split them into the same number of groups you started with (divide by 10).

1320/10 = 132

The mean is 132.

Which box plot represents the data?
30, 35, 25, 5, 5, 25, 40, 45, 50, 10, 15, 40

Answers

It's the first box plot
Final answer:

The box plot representing the data set 5, 5, 10, 15, 25, 25, 30, 35, 40, 40, 45, 50 will have the values at 5 (minimum), 12.5 (Q1 - 25th percentile), 25 (median), 37.5 (Q3 - 75th percentile), and 50 (maximum). The data is arranged in ascending order, divided into quartiles, and the median of each quartile is found.

Explanation:

To determine which box plot represents the data, we need to obtain the five-number summary of the data which includes the minimum, Q1 (25th percentile), median (Q2 - 50th percentile), Q3 (75th percentile), and the maximum.

Arrange the data in ascending order: 5, 5, 10, 15, 25, 25, 30, 35, 40, 40, 45, 50Determine the minimum and maximum: Minimum is 5, Maximum is 50 Find the median (Q2): With 12 numbers, the median is the average of the 6th and 7th value, so (25+25)/2 = 25 Q1 is the median of the lower half of data (not including Q2): The median of 5, 5, 10, 15, 25, 25 is (10+15)/2 = 12.5 Q3 is the median of the upper half of data (not including Q2): The median of 30, 35, 40, 40, 45, 50 is (35+40)/2 = 37.5

Therefore, the box plot that represents this data will have values at 5 (minimum), 12.5 (Q1), 25 (median), 37.5 (Q3), and 50 (maximum).

Learn more about Box plot here:

https://brainly.com/question/31856042

#SPJ11

Find the volume of the following solid figure. Use = 3.14. V = 4/3r3. A sphere has a radius of 5.7 inches. Volume (to the nearest tenth) = cubic inches.

Answers

Answer:

the answer is 775.3


Answer : The volume of sphere will be, [tex]775.3\text{ inches}^3[/tex]

Step-by-step explanation :

To calculate the volume of sphere, we use the formula:

[tex]V=\frac{4}{3}\pi r^3[/tex]

where,

r = radius of sphere  

Given :

Radius of sphere = 5.7 inches

Now put all the given values in the above formula, we get:

[tex]V=\frac{4}{3}\pi r^3[/tex]

[tex]V=\frac{4}{3}\times 3.14\times (5.7inches)^3[/tex]

[tex]V=775.3\text{ inches}^3[/tex]

Thus, the volume of sphere will be, [tex]775.3\text{ inches}^3[/tex]

Video games are on sale for 35% off if a particular game regularly sells for $99.50 what is the sales price

Answers

Final answer:

To find the sales price, multiply $99.50 by 35% to get the discount amount of $34.83, then subtract that from the original price, resulting in a sales price of $64.67.

Explanation:

To calculate the sales price of a video game that has a discount of 35%, first determine the amount of the discount by multiplying the original price by the percentage of the discount. The original price of the video game is $99.50. Therefore, you calculate $99.50 × 0.35 to find the discount amount.

The discount amount is $34.825. Next, subtract the discount amount from the original price to find the sales price: $99.50 - $34.825 equals the sales price.

It's also important to round the discount to the nearest cent as currency, resulting in a discount of $34.83. Thus, the sale price of the video game will be $99.50 - $34.83, which equals $64.67.

Learn more about Sales Price Calculation here:

https://brainly.com/question/16939551

#SPJ2

Which number is irrational A)25.23 B) 8 C)square root of 48

Answers

Ans:- √48

Reason:

=> √48 = √(2×2×2×2×3) = 4√3

As, we know√3 is irrational therefore √48 is also irrational no.

Hope this helps!
Hello there, and thank you for posting your question here on brainly.

Short answer: C.

Why?

When a number is irrational, that means it goes on forever. It can't be A, because we know the end is .23. It can't be B because that is just a whole number. The only one that would make sense is answer choice C. √48.

Hope this helped you! ♥

A distribution reasonably well described by the normal curve has a mean of 60.00 with a standard deviation of 10.00 points. basing your prediction on the normal (z) curve, approximately what percent of the population would you predict will score within 10.00 points of the mean (between 50.00 and 70.00)?

Answers

68% will be within 10 points of the mean.

The empirical rule states that 68% of data will fall within 1 standard deviation of the mean.  10 is the standard deviation, so anything within 10 points of the mean is within 1 standard deviation.

Answer:

68%

Step-by-step explanation:


If the probabilty of winning a lottery game is 7/100, does that mean that if you play the game 100 times, then you will win 7 times? explain.

Answers

Yes, the fraction, 7/100, is saying that every 100 times you play, you will win 7 times. 7 out of 100.
Other Questions
Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other Polands energy resources can be described as _____. a. based on large deposits of coal b. rich in petroleum c. large deposits of sulfur d. large deposits of copper If a circle has a radius of 18 feet what's the closest approximation for circumference Has complete control of the laws rules and affairs of a country Plz jphelp me answer this year 7 question and explain how u got the answer. If the most industrialized countries all signed a climate-change treaty with the goal of keeping the sea at its current level, which would be a free rider benefiting from a positive externality of the treaty America wanted to end japan's aggression by placing a(n) _______ to cut off the oil and scrap metal supply. Eva is jumping on a trampoline. Her height h at time t can be modeled by the equation h=-16t^2+20t+6. Would Eva reach a height of 14 feet? A traveler's budget and needs are considered by a _________ when arranging a trip. Which antibiotic was most effective in inhibiting the growth ofe. coli? Length of side AB??? your recipe calls for 1/2 a pound of potatoes. You use 1/6 of the bag of potatoes. whats the number of pounds per bag how many gallons of 20% alcohol solution and 50% alcohol solution must be mixed to get 9 gallons of 30% alcohol solution