Given the width of the lawnmower is 2.2 feet and the length of the rope is 22 feet calculate the radius of the pole that will produce a perfect lawn

Answers

Answer 1

Answer:

  0.35 ft

Step-by-step explanation:

We assume that the lawnmower is mowing a spiral around the pole and that each turn increases the radius by 2.2 feet. That is, each turn around the pole captures (or releases) 2.2 feet of rope, so that is the circumference of the pole.

  C = 2πr

  2.2 ft = 2(22/7) r

  (2.2 ft)(7/44) = r = 0.35 ft

The radius of the pole needs to be about 0.35 feet, or 4.2 inches.

_____

We assume that the lawnmower width is a multiple of 22 because we are intended to use 22/7 as our approximation of pi. A more accurate value of pi would give a radius of 0.35014 feet, about 4.202 inches.


Related Questions

If Ezra works less than or equal to 50 hours doing lawn care, he must spend at least __ hours walking dogs.

Answers

Final answer:

If Ezra works less than or equal to 50 hours doing lawn care, he must spend at least [answer] hours walking dogs.

Explanation:

To determine the minimum number of hours Ezra must spend walking dogs when he works less than or equal to 50 hours doing lawn care, we need to refer to the given information and apply it to the situation

According to the exercise, Louis requires one hour to cut a typical lawn, while Carrie Anne needs one and one-half hours. Therefore, Louis is more efficient at cutting grass. Carrie Anne, on the other hand, can wash a car in half an hour, while Louis requires three-quarters of an hour. So, Carrie Anne is more efficient at cleaning cars.

If they each specialize in the task they are most efficient at, Louis should cut the grass, and Carrie Anne should wash cars. This way, they can maximize their output in a given amount of time.

Now, if they each work a twelve-hour day, we can calculate how many lawns they can cut and how many cars they can wash based on their efficiency. Louis can cut 12 lawns (since he requires 1 hour per lawn), and Carrie Anne can wash 24 cars (since she can wash a car in 0.5 hours).

Therefore, if they specialize in their most efficient tasks, they can cut 12 lawns and wash 24 cars in a twelve-hour day.

Answer:

IT IS 35

Step-by-step explanation:

What number must you add to complete the square?
x^2+12x=5

Answers

Answer:

36

Step-by-step explanation:

12/2 = 6

6^2 = 36

In the diagram below, what is the approximate length of the minor arc DE?

А. 6.3 cm
В. 3.1 cm
с. 5.2 cm
D. 7.9 cm​

Answers

Answer:

6.3cm

Step-by-step explanation:

The approximate length of the minor arc DE will be 6.3 cm. Then the correct option is A.

What is a circle?

It is a locus of a point drawn an equidistant from the center. The distance from the center to the circumference is called the radius of the circle.

Then the angle is subtended by the arc is 36° and the radius of the circle is 10 cm.

Then the length of the arc DE will be

[tex]\rm ARC = \dfrac{\theta }{360} \times 2\pi r[/tex]

Then we have

[tex]\rm ARC = \dfrac{36}{360} \times 2\pi \times 10\\\\ARC = 6.283 \approx 6.3\ cm[/tex]

More about the circle link is given below.

https://brainly.com/question/11833983

I’m lost and unsure what is the first step to do find width of da roof

Answers

Answer:

You set up an equation, using the trig function "tan" to find half of the roof (the equation would be tan(24) = 3.5/x, where x = 1/2 roof width)

Step-by-step explanation:

That would be the first step.

You solve the equation for x, and then multiply x by 2 to get the width of the roof.

what is the "X" in x2 − 70 = –69 plz need asap

Answers

Answer:

1,-1

Step-by-step explanation:

Answer:

X = 1/2

Step-by-step explanation:

x2 = -69 + 70

x2 = 1

x = 1/2

Turner mesuares 3/4 foot of a ribbon for a coustume. He needs 9 pieces of ribbon with the same length

Answers

That answer is 6.75

Answer:

Step-by-step explanation:

¾ * 9/1 = 287/4

27/4=6 ¾

which equals 6.75

What is the positive negative square roots of 64?

Answers

The answer explains the positive and negative square roots of 64.

When dealing with the square roots of a number like 64, remember that the square root of 64 is 8, both positive and negative. This is because (-8) x (-8) equals 64 just like (8) x (8) equals 64, following the rule that multiplying two negative numbers results in a positive number.

A block is set in motion hanging from a spring and oscillates about its resting position
x = 0
according to the function
x = 0.6sin(2t)+0.4cos(2t),
where x is in centimeters and t is in seconds. For what values of t in the interval [0,3] is the block at its resting position
x =0?

Answers

Answer:

t = 1.277 sec and t = 2.848 sec

Step-by-step explanation:

This problem is much more easily done by graphing it than by computing it using algebra.

The values of t we're looking for are the ones that make x = 0, so we want the solutions of [tex]0.6sin(2t)+0.4cos(2t)=0[/tex] on the interval [0, 3].

According to the graph, this is true when t = 1.277 seconds and t = 2.848 seconds.

Answer:

t = 1.28, 2.85

Step-by-step explanation:

x = 0.6sin(2t)+0.4cos(2t)

x = 0, so

0.6sin(2t)+0.4cos(2t) = 0

0.6sin(2t) = -0.4cos(2t)

Convert into tan(2t) by dividing both sides by 0.6cos(2t):

tan(2t) = -0.4/0.6

tan(2t) =-2/3

Since t lies in [0,3] ,

2t lies in [0,6]

tan(2t) =-2/3

Basic angle:

0.5880026035

Tan is negative is second and fourth quadrants

2t = 2.553590005, 5.695182704

t = 1.276795025, 2.847591352

(9+q)(8-q)= polynomial in standard form

Answers

Answer:

- q² - q + 72

Step-by-step explanation:

To express the given expression as a polynomial in standard form, we would first multiply the individual elements in one parenthesis with the elements in the second.

We would then rearrange the outcome and simplify it algebraically.

The arrange it in the order of the unknown variable.

As such,

(9+q)(8-q) = 9(8-q) +q(8-q)

= 72 -9q + 8q - q²

= 72 - q - q²

= - q² - q + 72

To form the expression (9+q)(8-q) into a polynomial in standard form, we multiply the terms using the distributive property to get -q² - q + 72.

The student has asked for the expansion of a binomial expression into polynomial form, in this case, expanding (9+q)(8-q). The process involves using the distributive property, also known as the FOIL method (First, Outer, Inner, Last), to multiply each term in the first binomial by each term in the second.

Expanding the binomials, we have:

First: 9 × 8 = 72

Outer: 9 × (-q) = -9q

Inner: q × 8 = 8q

Last: q × (-q) = -q²

Combining like terms (-9q and 8q) gives -q and then adding to the remaining terms, we have:

72 - q - q²

Reordering to get the polynomial in standard form (highest degree first), the result is:

-q² - q + 72

Students in middle school and high school were surveyed about whether they have taken the SAT. Some of the survey results are listed here.

37% of middle school students have taken the SAT.
4% of high school students have not taken the SAT.

This information is shown in the two-way frequency table below. Drag numbers into the empty spaces to complete the table.

Answers

Answer:

Step-by-step explanation:k so high school total should be 100%

                                            middle school not taken SAT should be 63%

                                            high school have taken SAT should be 96%

basically just use your basic math. Turn the problem around and take the total(100%) and subtract what number you already know. So like This:

                                                                                                100-37=63

                                                                                                100-4=96

Final answer:

The subject of this question is SAT and it is related to middle school and high school. The answer provides an explanation of the survey results regarding students taking the SAT.

Explanation:

The subject of this question is SAT. The grade level of this question is Middle School, High School.

The table provided shows the survey results of whether middle school students and high school students have taken the SAT. From the information given, we can determine the missing values in the table:

Middle School Students Taken SAT = 37%

High School Students Not Taken SAT = 4%

*Please note that the table was not provided with the question, so we are unable to fill in the missing values.

Write an expression for the sequence of operations described below.
divide w by 3, then subtract 10 from the result
Do not simplify any part of the expression.

Answers

Answer:

(w/3)-10

Hope this helps!

w/3 - 10 is an expression for the above-described series of operations.

What is a linear equation?

A linear equation is an algebraic equation of the form y=mx+b, where m is the slope and b is the y-intercept, and only a constant and a first-order (linear) term are included. The variables in the preceding equation are y and x, and it is occasionally referred to as a "linear equation of two variables."

Given, divide w by 3, then subtract 10 from the result Do not simplify any part of the expression.

We need to Create an expression for the above sequence

divide w by 3

=> w/3

then subtract 10

=> w/3 - 10

Since it's written in the problem that does not simplify hence, we would simplify this equation further.

Therefore, an expression for the sequence of operations described above is w/3 - 10

Learn more about linear equations here:

brainly.com/question/11897796

#SPJ2

Find the domain of the rational function 9x/(x+5)(x+3)

Answers

Answer:

the domain is : D = ]-∞ , -5[ U ]-5 , -3[ U ]-3 , +∞[

Step-by-step explanation:

hello :

f(x) = 9x/(x+5)(x+3)

f exist for : (x+5)(x+3) ≠ 0

(x+5)(x+3)=0

x+5=0 or x+3=0  means : x= - 5 or x= -3

the domain is : D = ]-∞ , -5[ U ]-5 , -3[ U ]-3 , +∞[

i really need help :( i dont get help from anyone :(

Answers

Answer:

D.) 12x -6x 90

Step-by-step explanation:

because it's right angle

A car traveling 9/10 of a mile per minute will travel _____ miles in 10 minutes

Answers

Answer:

It will travel 9 miles in 10 minutes

Step-by-step explanation:

A car travels 9/10 miles/minute

In 10 minutes, it will travel

10*9/10 = 9 miles

Final answer:

A car traveling at 9/10 of a mile per minute will travel 9 miles in 10 minutes by simply multiplying the car's speed by the time traveled.

Explanation:

To calculate how far a car traveling at a speed of 9/10 of a mile per minute will travel in 10 minutes, we simply multiply the speed of the car by the amount of time it travels.

Speed of car = 9/10 mile/minute

Time = 10 minutes

Distance traveled = Speed of car × Time

Distance traveled = (9/10) mile/minute × 10 minutes

Now we perform the multiplication:

Distance traveled = 9/10 × 10

Distance traveled = 9 miles

Grace had 4 3/8 yards of elastic. She used 1 2/3 yards of the elastic to make bracelets for her friends. How many yards of elastic does she have now?

6 1/24 yards
3 7/24 yards
2 17/24 yards
3 17/24 yards

Answers

Answer:

Exact form: 65/24

Decimal form: 2.7083

Mixed number form: 2 17/24

Step-by-step explanation:

4 3/8 - 1 2/3 = 2 17/24

Which point on the number line represent 42?

A.P
B.Q
C.R
D.S

Answers

I think is letter A....

Answer:

Q

Step-by-step explanation:

because 42 square rooted is between 6 and 7.

Which of the following formulas could be used to find the perimeter, P, of a regular hexagon? plz

Answers

Answer:

Just add up all the sides and you get the perimeter.

The supply and demand curves for a product line of bicycles are shown. Approximately where is the equilibrium point?

Answers

Answer:

The answer is B (132,220)

Step-by-step explanation:

I got it correct on the test

Plato tests

The required equilibrium point for the supply and demand curves for a product line of bicycles is (135, 225).

What is the graph?

The graph is a demonstration of curves that gives the relationship between the x and y-axis.

here,
The graph shows the supply and demand curves for a product line of bicycles.
To determine the equilibrium point we to locate the intersection point of supply and demand.
From the graph, the intersection point is (135, 225), which is the approximate equilibrium point.

Thus, the required equilibrium point for the supply and demand curves for a product line of bicycles is (135, 225).

Learn more about graphs here:

brainly.com/question/16608196

#SPJ5

Two of the world's longest rivers are the Nile, which is 4100 miles long, and the Rio
Grande, which is 1900 miles long. Find how much longer the Nile is than the Rio
Grande.

Answers

Answer:

The Nile River is 2,200 miles longer than the Rio Grande.

Step-by-step explanation:

4100-1900=2200

Answer:

Answer:

The Nile River is 2,200 miles longer than the Rio Grande.

Step-by-step explanation:

4100-1900=2200

Step-by-step explanation:



The exponential function g(x) is shown on the graph. Suppose f(x) = x. Which statement is true when comparing the domain of f(x) to the domain of g(x)?
A) The domain for both functions is all positive numbers.
B) The domain for both functions is all integers.
C) The domain for both functions is all real numbers.
D) The domain for both functions is all real numbers greater than 0.

Answers

Answer: The domain for real numbers

Step-by-step explanation: taking it right now

The domain for both functions g(x) and f(x) is all real numbers. Then the correct option is C.

What is a domain?

The domain means all the possible values of the x.

The exponential function g(x) is shown on the graph.

Suppose f(x) = x.

Then the domain of the function g(x) is a real number.

And the domain of the function f(x) is also a real number.

Then the domain for both functions is all real numbers.

More about the domain link is given below.

https://brainly.com/question/12208715

What is the length of Line A B? On a coordinate plane, point A is (negative 4, 3), point B is (2, 3), and point C is (2, negative 1). 4 units 5 units 6 units 7 units

Answers

Answer:

6 units

Step-by-step explanation:

Answer:

6 units

Step-by-step explanation:

-1/2x>4 solve for x​

Answers

Answer:

X<-8

Step-by-step explanation:

-1/2x>4

Multiple both sides by -2

-2(-1/2)x<-2(4)

Multiple even numbers of negative terms

2(1/2)x<-2(4)

Cancel out the 2

(2 this is out)(1/(2 this is out))x<-2(4)

x<-2×4

Multiple

x<-8




Which BEST describes the representation of the data on the given graph?
A) The graph represents the data appropriately.
B) The graph is misleading because the size of the sample is not shown.
C) The graph is misleading because the vertical scale does not begin at 0.
D) The graph is misleading because the scale is disproportional to the data.

Answers

Answer:

A) The graph represents the data appropriately.

Step-by-step explanation:

The graph above is a true representation of data showing the percent of political parties people who agreed with court.

From the graph above, three categories of political parties people are concerned; which are, the Democrats, the Republicans and the Independents.

It can therefore be deduced that 62% of the Democrats agreed with court. By implication, the percent of the Democrats who disagreed with court is 38%. Conversely, 54% of people agreed with court for both the Republicans and the Independents respectively. This implies that the percent of both the Republicans and the Independents who did not agree with court is 46% respectively.

However, the graph fails to provide us with information about what the people agree on; probably the outcome of an election or appointment of a minister.

The graph is not misleading in any way and it is not necessary that the vertical scale begin at zero. Therefore, the data represents the graph appropriately.

3x-4y=1 and x=2y+1 using substitution

Answers

Answer:

x =-1

y =-1

Step-by-step explanation:

to solve this system of equation, using substiution method

3x-4y=1 ........................ equation 1

x=2y+1 ............................  equation 2

subbstitute for x into equation 1

3x-4y=1 ........................ equation 1

3(2y + 1) - 4y = 1

6y + 3 -4y = 1

2y + 3 = 1

collect the like terms

2y = 1- 3

2y= -2

divide both sides by  the coefficient of y which is y

2y/2 = -2/2

y = -1

put the value of y =-1 into equation 2

x=2y+1 ............................  equation 2

x = 2(-1) + 1

x = -2 + 1

x = -1

therefore x =-1 y = -1

Which sample size of a population of 200 is most likely to give a reliable conclusion?

Answers

Therefore, the sample size of a population of 200 is most likely to give a reliable conclusion is 80.

Answer:

80

Step-by-step explanation:

(giving 30 points/need answers STAT!!)

Four transformations of the function f(x) = 3x + 2 are given below.



For each transformation, drag the expression that shows the result of that transformation into the box under it.

Answers

Transformations can be applied to functions to change the appearance of

the (slope and intercept) of the function.

The result of the transformation are presented as follows;

[tex]\begin{tabular}{|c|c|c|c|}f(x-5)&f(x) - 5&-5 \cdot f(x) &f(-5\cdot x)\\3\cdot (x - 5) + 2&3 \cdot x - 5 + 2&-5\cdot (3 \cdot x + 2)&3 \cdot (-5\cdot x) + 2 \end{array}\right][/tex]

Reasons:

The given function is; f(x) = 3·x + 2

The function -5·(3·x + 2) is the same as -5 × f(x) = -f(x)

Therefore;

-5·(3·x + 2)  → -5·f(x)

The function 3·x - 5 + 2 = 3·x + 2 - 5 = f(x) - 5

Therefore;

3·x - 5 + 2  → f(x) - 5

The function 3·(x - 5) + 2 by comparison to 3·x + 2 is obtained when x is replaced by (x - 5), therefore;

f(x) = 3·x + 2

f(x - 5) = 3·(x - 5) + 2

3·(x - 5) + 2 → f(x - 5)

The function 3·(-5·x) + 2 is obtained when x in f(x) is replaced by (-5·x),

which gives;

f(x) = 3·x + 2

∴ f(-5·x) = 3·(-5·x) + 2

Which gives;

3·(-5·x) + 2 → f(-5·x)

The completed table is therefore;

[tex]\begin{tabular}{|c|c|c|c|}f(x-5)&f(x) - 5&-5 \cdot f(x) &f(-5\cdot x)\\3\cdot (x - 5) + 2&3 \cdot x - 5 + 2&-5\cdot (3 \cdot x + 2)&3 \cdot (-5\cdot x) + 2 \end{array}\right][/tex]

Learn more about transformation of functions here:

https://brainly.com/question/18076552

A pool is in the shape of a rectangular prism. On Monday, water was pumped out of the pool at a constant rate, starting at 12:00pm. At 12:15 pm, the water in the pool was 45 inches deep. At 12:35 pm, the water in the pool was 41 inches deep.

Part A
How many inches does the depth of the water decrease each minute?

Part B
Write an equation that represents y, the depth of the water (in inches) after x minutes.

Answers

Answer:

the equation is y = (-2/15 in/min)x + 43 in

Step-by-step explanation:

We'll represent elapsed time with the letter t.  Then 12 p.m. corresponds to t = 0 sec.  Between 12 p.m. and 12:15 p.m., the change in time was 15 min and the change in water depth was (45 - 41) in., or 4 in.

Thus, the water depth changes by 4 in (a decrease) over 30 min.  

Part A:  The water depth rate of change is -4 in/30 min, or -2 in/15 min, or

(-2/15 in)/min (the depth is decreasing).

Part B:  We need to derive a linear function that describes the water depth at any given time x (or t).  Two points on the graph of this line are

(15 min, 45 in) and (35 min, 41 in):  the 'run' is 30 min and the 'rise' is -4 in.

As in Part A, the slope of this line is (-2/15 in)/min.

The desired equation is then y = mx + b, or 45 in = (-2 in/15 min)(15 min) + b, or 45 in = 2 in + b, or  43 in = b.  Then, in its most general form,

the equation is y = (-2/15 in/min)x + 43 in

I need help:
The width of this rectangle is 1/3 of the length. Find the length and the width of the rectangle.

Answers

Answer:

3(y-4) =2y+6

3y - 12 = 2y +6

y = 18

so length is 42 in.

width is 14 in.

After solving the given equations, the length of the rectangle is 42 inches and the width of the rectangle is 14 inches.

What is an equation?

Equations are mathematical expressions that have two algebra on either side of an equal (=) sign. The expressions on the left and right are shown to be equal to one another, demonstrating this relationship. L.H.S. = R.H.S. (left-hand side = right side) is a fundamental simple equation.

The given data in the question,

According to the given diagram,

Length of the rectangle, L = 2y + 6 inches    (i)

Width of the rectangle, W = y - 4 inches   (ii)

The width of the rectangle is 1/3 of the length,

1/3(2y + 6) = (y - 4)

2y + 6 = 3y - 12

y = 18.

Substitute y = 18 in equation (i)

L = 2(18) + 6

L = 42 inches

Substitute y = 18 in equation (ii)

W = (18 - 4)

W = 14 inches.

To know more about equation:

https://brainly.com/question/10413253

#SPJ2

2c = 112
A. c = 2
B. c = 42
C. c = 56
D. C = 224

Answers

Answer:

The answer is C. 56

Step-by-step explanation:

So if we replace C with 56, the equation would look like this, 2(56)=112.

Re-write the quadratic function below in Standard Form
y = -7(x + 9) (x - 1)

Answers

Answer:

-7x squared -56x+63.

Step-by-step explanation:

Hope this helps!

Other Questions
There are three groups that contain carbon but are not organic compounds:carbon chlorides carbon oxides carbon iodides carbides carbonates When should you use the median and interquartile range as your measure of center and measure of variability tocompare populations shown on a box plot? Check all that applywhen there are outliers in the data setswhen there are no big gaps in the middle of the data setswhen the plots representing the data are symmetricalwhen the plots representing the data are nonsymmetricalwhen there are no outliers in the data setIntroDone To assist with a class demonstration, a student (whose mass is 60 kg) filled a water balloon with 2 kg of water. He then climbed to the second floor (10 metres) of the school and held the balloon out of a window. How much work did the student do? What is it called when plants give off water vapor as a waste product? Jason is entering a weight lifting contest. Gurrently, his maximum bench press weight is 105 pounds. If he increases the weight by 7 pounds each week, What is the maximum weight he be able to bench press after 13 weeks? Which statement best summarizes the central idea of thisexcerpt?DOUO One must know the process of hiring servants.0 It is important to always honor one's servants.O It is necessary to choose trustworthy servants.O The intelligence of servants must be considered.herofich 1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes. if tan 0= -3/8 which expression is equivalent to cot0? A fairground ride spins its occupants inside a flying saucer-shaped container. If the horizontal circular path the riders follow has a 6.75 m radius, at how many revolutions per minute are the riders subjected to a centripetal acceleration equal to that of gravity What should you expect to happen if you participate in a poetry workshop? Gothic archtiture rarely used on the outstide of cathedrals and churhes. true or false Theo's Survey ResultsEye ColorBrown BlueBoy2525GenderGirl2525Theo recorded the gender and eye color of students walking in the hallway at his middle school. What is theexperimental probability in simplest form that the next student he sees will be a boy with brown eyes? A group of adults plus one child attend a movie at Cineplex 15. Tickets cost $9 for adults and $6 for children. The total cost for the movie is $78. Write an equation to find the number of adults in the group.