Glaciers act as ___ in the water cycle, because they can store water for a long period of time

Answers

Answer 1
Final answer:

Glaciers act as reservoirs in the water cycle, storing water for a long period of time. They play a crucial role in regulating water supply, especially in regions that depend on glacier meltwaters. The retreat of glaciers due to global warming can have significant impacts on local ecosystems and water availability.

Explanation:

Glaciers act as reservoirs in the water cycle because they can store water for a long period of time.

When water from precipitation or melting ice accumulates in glaciers, it gets stored as ice for hundreds or thousands of years. This stored water is released gradually over time, contributing to the overall water cycle. Glaciers play a crucial role in regulating water supply, especially during dry seasons or in regions that depend on glacier meltwaters.

An example of glaciers acting as reservoirs is the Grinnell Glacier in Glacier National Park. The retreat of the glacier due to global warming has led to a loss of summer meltwaters, affecting local ecosystems and water supplies.

Learn more about glaciers acting as reservoirs here:

https://brainly.com/question/34405645

#SPJ12


Related Questions

What is a likely consequence of continued human population growth?
A. Less pollution
B. Abundant natural resources
C.More urban centers
D. Larger rain forests

Answers

The answer is C. A is wrong because humans cause pollution, B is wrong because we use natural resources and their supply would deteriorate, and D is wrong because we already break down rainforests and they are getting smaller.

The presence of more urban centers is a likely consequence of continued human population growth (Option C).

What is population growth?

Population growth refers to the growth in the number of individuals that live in a given geographic area.

Population growth is a real subject of concern in most urbanized areas.

Continued human population growth leads to the development of new and higher cities.

In conclusion, the presence of more urban centers is a likely consequence of continued human population growth (Option C).

Learn more in:

https://brainly.com/question/14221196

The arrow in the diagram represents the movement of which molecular structurel
a. DNA molecule
b. Protein
c. mRNA Molecule
d. Base Pair

Answers

answer : c

mrna is also known as messenger rna so if it is transferring information the mrna would be doing it

Which of the following matches the correct definition to example?


A) Physical Change: My microwave exploded

B) Chemical Change: My dog ate my homework.

c) Chemical Change: I changed my toenail polish color.


Answers

Answer:

The awnser is C

Explanation:

If your toenail polish changes color using heat from and area lets say its yellow and you touch it with the warmth of your thumb and changes into orange. It would be chemical change.

The option which matches the correct definition to example is Chemical Change: I changed my toenail polish color using heat. (option c )

Chemical changes

A chemical change is a change which is not easily reversed and in which a new substance is formed

Chemical changes includes the following:

The dissolution of metals in acidsBurning of fire woodNeutralization reactions between acids and alkalisRusting of iron

Learn more about chemical changes:

https://brainly.com/question/11987405

she gave him that - look​

Answers

Answer:

sis what

Explanation:

elaborate

How can scientist determine whether an extinct animal gave birth on land or water?

A) Location of the hind limbs of the fetus.
B) Position it the nostrils.
C) Position it the head of the fetus.
D) Location of the fossils.

Answers

Answer:

D

Explanation:

Location of the fossils whether its deep in the earth surface or shallow.

D bc it’s probably gonna be in the water if it gave birth in water

Identify the items below that can cause illness

Answers

Answer:

cough rubing eyes biteing nails

Explanation:

Illnesses can be caused by viruses like those that cause the common cold, bacteria such as E. coli, and by eating contaminated food. An example of a disease from contaminated water is Cholera. Good hygiene practices, including hand washing, can help prevent these illnesses.

The items below that can cause illness are:

Viruses, such as those that cause the common coldBacteria, such as E. coliCoughing on a person when you are sickForgetting to wash your handsEating contaminated food

While water itself is essential for life and does not cause illness, contaminated water can be a source of disease. An example of a disease caused by contaminated water is Cholera. The common cold is caused by a type of pathogen known as a virus. Athlete's foot is caused by a fungus. Types of pathogens that commonly cause human diseases include bacteria, viruses, fungi, and protozoa. For instance, bacteria like Salmonella and E. coli can cause foodborne illnesses. These bacterial illnesses can often be prevented with proper food handling and hand hygiene.

The correct question is:

Identify the items below that can cause illness. Check all that apply.

A. water

B. viruses, such as those that cause the common cold

C. bacteria, such as E. coli

D. coughing on a person when you are sick

E. forgetting to wash your hands

F. eating contaminated food

What is this map called.....

Answers

Answer:

Robertsonian translocation

8. Unlike DNA, RNA
O A. has deoxyribose as the sugar within its nucleotide components.
OB. contains two strands wrapped in a helix.
OC. contains nitrogenous bases.
OD. pairs uracil with adenosine instead of thymine.
+ Back
Next >
Review Answer Selections

Answers

Answer:

D

Explanation:

DNA pairs with adenosine, thymine, cytosine, and guanine

RNA pairs with uracil, adenosine, cytosine, and guanine

Option D is correct because RNA pairs uracil with adenine instead of thymine, unlike DNA. Other differences include ribose in RNA versus deoxyribose in DNA and RNA being single-stranded while DNA is double-stranded.

The correct answer to the question is Option D: pairs uracil with adenosine instead of thymine.

A. has deoxyribose as the sugar within its nucleotide components: This statement is incorrect because RNA contains ribose, not deoxyribose. Deoxyribose is found in DNA.B. contains two strands wrapped in a helix: This is incorrect because RNA is typically single-stranded, whereas DNA is double-stranded.C. contains nitrogenous bases: While this is true for both RNA and DNA, it does not 'unlike' DNA. Both types of nucleic acids contain nitrogenous bases.D. pairs uracil with adenosine instead of thymine: This is the correct statement. Unlike DNA, RNA uses uracil in place of thymine and pairs it with adenine.

In summary, RNA and DNA differ primarily in their sugars (ribose vs. deoxyribose), the presence of uracil instead of thymine, and RNA being single-stranded compared to the double-stranded DNA.

complete question:

Unlike DNA, RNA

OA. has deoxyribose as the sugar within its nucleotide components.

OB. contains two strands wrapped in a helix.

OC. contains nitrogenous bases.

OD. pairs uracil with adenosine instead of thymine.

#11 choose the best answer

Answers

Answer:0

Explanation:

Describe how the motion of Earth is affected by the sun. Be sure to include the direction of any force you identify and the shape of the path that results.

Answers

The effect of motion of Earth by the sun is given below.

Explanation:

1. The Earth rotates once on its axis about every 24 hours. If you were to look at Earth from the North Pole, it would be spinning counterclockwise. As the Earth rotates, observers on Earth see the Sun moving across the sky from east to west with the beginning of each new day. We often say that the Sun is "rising" or "setting", but actually it is the Earth's rotation that gives us the perception of the Sun rising up or setting over the horizon. When we look at the Moon or the stars at night, they also seem to rise in the east and set in the west. Earth's rotation is also responsible for this. As Earth turns, the Moon and stars change position in our sky.

2. Tides are the regular rising and falling of Earth's surface water in response to gravitational attraction from the Moon and Sun. The Moon's gravity causes the oceans to bulge out in the direction of the Moon. In other words, the Moon's gravity is pulling upwards on Earth's water, producing a high tide.

3.The Moon's position in its monthly orbit determines how it appears from Earth. The diagram on page 725 shows how the positions of the Moon, the Sun, and Earth affect the shapes you see in the sky. ... As the Moon moves along its orbit, sunlight begins falling on the near side. You see a thin crescent shape.

Final answer:

The Sun's gravity influences the Earth's motion, causing it to orbit in an elliptical path around the Sun. The direction of Earth's rotation affects the apparent motion of the sun and causes a deviation in the path of large scale movements like weather systems, known as the Coriolis effect.

Explanation:

The motion of the Earth is greatly influenced by the gravitational pull from the Sun, causing the Earth to move in a consistent, elliptical path around the Sun. This elliptical orbit is referred to as the ecliptic. Viewed from above the North Pole, Earth rotates in a counterclockwise direction.

This rotation leads to a phenomenon known as the Coriolis effect. In the Northern hemisphere, this effect causes moving air and water to appear to turn right. In the Southern Hemisphere, the effect is reversed, causing motion to turn left. These effects caused by Earth's rotation impact large scale motions, such as weather patterns.

The direction of Earth's rotation also affects the Sun's apparent motion in the sky. Due to the ecliptic and Earth's tilt, the Sun seems to move north and south as the seasons change. Additionally, because of Earth's constant motion, the Sun rises about 4 minutes later each day in relation to the stars.

Learn more about Motion of Earth here:

https://brainly.com/question/24629047

#SPJ11

What are some examples classical conditioning you have in everyday life?
How does that effect you?

Answers

Well for me, I think i'd say CAT TRAINING.

Here's an example. My newest cat is still learning how to come to the food in the kitchen, and come at times when she needs to eat even if already eaten in the morning.

So before today, I've been trying to get her to come just by placing the food down. But she doesn't give a response to it. Next I try a bell alone, and some other jingling or noise makers. Still no response of her coming to me at all. Then I tried placing the food down while ringing the bell, she's starting to understand, but still not a very good response. I assume in a few more days, she will understand that the bell/other noise means COME TO ME. That is a conditioned response i'm hoping to get soon.

HAVE A GOOD DAY!

What other illness played an important role in the development of a vaccine for smallpox?
a. Measles
b. Bubonic Plague
c. Polio
d. Cow pox
e. HPV

Answers

D. Cowpox

Explanation:
And English doctor by the name Edward Jenner noticed that milkmaids who had gotten cowpox did not show symptoms of smallpox after variolation.

Answer:

A.Measles

Explanation:

The origin of smallpox is unknown. Smallpox is thought to date back to the Egyptian Empire around the 3rd century BCE (Before Common Era), based on a smallpox-like rash found on three mummies. The earliest written description of a disease that clearly resembles smallpox appeared in China in the 4th century CE (Common Era). Early written descriptions also appeared in India in the 7th century and in Asia Minor in the 10th century.The smallpox vaccine was the first vaccine to be developed against a contagious disease. In 1796, the British doctor Edward Jenner demonstrated that an infection with the relatively mild cowpox virus conferred immunity against the deadly smallpox virus.

Which best describes the function of chloroplast?

Answers

Answer:

Makes food during photosynthesis

Explanation:

Answer:

B

Explanation:

which statement best. describes the fossil record?
it is a complete record
it is an incomplete record
most fossils are older than 5. billion years
all fossils are younger than 600 years

Answers

Answer:

It is incomplete record

Explanation:

I took the quiz and got it right.

Final answer:

The fossil record is best described as an incomplete record, with fossilized species representing only a fraction of all species that have ever existed. It remains a key evidence for understanding Earth's biological history despite its incompleteness.

Explanation:

The best statement that describes the fossil record is that it is an incomplete record. Fossils are the preserved remains or traces of organisms that lived in the past, but the process of fossilization is quite rare, leaving many gaps. Even when fossils are created, finding them is not always possible, as some may be buried under extreme conditions or eroded over time. Fossilized species may represent less than 1% of all the species that have ever lived. Despite its incompleteness, the fossil record is crucial for understanding Earth's history and the evolution of life.

We could call this a wetland community. Compare this community to an ecosystem. Differentiate one more important difference between the organization of the two?

Answers

Interactions in a community occur only between living creatures or biotic components. Interactions take place in an ecosystem between living components as well as between non - living and living components.

What is a wetland community?

Wetland communities are aggregations of individuals from various species (plants, animals, microorganisms) that live and interact in habitats with water at or near the ground's surface or where the land is inundated by shallow water for large portions of the year.

Wetlands are locations where water covers the soil or is present at or near the soil's surface all year or for a variety of times throughout the year, including the growing season.

In a community, interactions occur between only biological organisms or biotic components.

Interactions occur in an ecosystem between living and non-living components as well as between living and non-living components.

Thus, this is the basic difference between the organization of the two.

For more details regarding community, visit:

https://brainly.com/question/17304846

#SPJ5

Select all the offspring phenotypes that could be produced from a BbEE x bbee cross (shown above).
black fur, red eyes
black fur, black eyes
white fur, black eyes
white fur, red eyes

Answers

Answer:

2 3

Explanation:

EDGE 2023

1. Look at the illustration in Figure 25-4. Do you think that the bud on the side of the adult hydra
is an embryo? Why?
A. No, because budding is a type of asexual reproduction.
B. No, because budding is a type of sexual reproduction.
C. Yes, because budding is a type of asexual reproduction.
D. Yes, because budding is a type of sexual reproduction.

Answers

Answer:

A. No, because budding is a type of asexual reproduction.

Explanation:

Asexual reproduction is the process where an organism makes a copy of itself by itself. It does not require a mate to make offspring.

The offspring are genetically identical to the parent.

Budding is a type of asexual reproduction where a small outgrowth of the parent breaks off to become a new organism.

Embryo development is usually only discussed in the context of sexual reproduction, where two gametes fertilize one another and a new organism that is genetically different to either parent is formed.

Answer:

A. No, because budding is a type of asexual reproduction.

Explanation:

The buds on the side of the adult hydra is not an embryo because budding is a type of asexual reproduction.

It is sexual reproduction that produces an embryo from the fusion of gametes.

Hydra produces new ones by budding using part of its body wall. This process is simply an outgrowth from the body wall. An embryo is one of the stages of development of offspring originating from a zygote. It is begins at fertilization to the formation of body structures. Embryos are peculiar to organisms that reproduces sexually.

Which statement about the human genome is correct
A) the human genome has been mapped
B) humans have about 21,000 genes
C) most of the DNA in human cells does not code for protein
D) all of these statements are correct

Answers

Answer:

I believe this is D

Explanation:

Answer:

Which statement about the human genome is correct?

humans have about 21,000 genes

Explanation:

Scientists confirmed the number of genes possessed by human which is about 21000

A woman buys a packet of seeds for red flowering plants. In the spring, she plants the seeds in her garden and enjoys beautiful red flowers all summer. The flowers are self-pollinating, and many of the flowers produce seeds. The woman collects these seeds and plants them in her garden the following spring. She is surprised when about one-fourth of these plants produce white flowers while the other three-fourths produce red flowers. Assuming that the seeds were all produced by self-pollination of the parental generation, which statement best explains the reason for the woman’s observations?
A. Temperatures were above average in the garden, causing only red flowers to be produced in the first year and both white and red flowers in the second year.
B. Some of the seeds were exposed to conditions that caused a change in the plant’s genes, leading to the production of white flowers instead of red flowers in plants grown from these seeds.
C. Both the white and red flower traits were present in the parental generation, but only the red trait was expressed in this generation, while both traits were expressed in the next generation.
D. Offspring acquired new genes during the crosses taking place between plants in the parental generation, and one of these genes codes for the white flowering trait.
E. Plants producing white flowers in the second generation did not receive the same essential nutrients from the soil needed to produce red flowers.

Answers

Answer:

It should be C -

Both the white and red flower traits were present in the parental generation, but only the red trait was expressed in this generation, while both traits were expressed in the next generation.

Explanation:

The reason is just like human. As an example, a family of, let's say Africa, and all of them are dark skin, then one married to a, let's say Europe, and that person is light skin. Which the offspring became a pretty dark skin. Then as the offspring grow up and have family of their own, the trait of light skin is always in the family, although it is recessive. So randomly, that light skin gene will pop-up in the generation, probably just not in this one.

I hope this helps, and I don't mean any offense to anyone.

Btw- I actually got this question right on Discovery Ed, so you could trust me.

If this helps you, please mark brainly!

Thank you!

Have a great day! :)

P.S- there's already a same exact question, which I had also answer, and I just copy the stuff from the other question to this.

How do these ocean currents affect the climate of the continents?​

Answers

Answer:

D

Explanation:

Tobacco mosaic virus (TMV) is a rod-shaped virus that affects many types of plants. Which of the following categories best describes TMV?
A
helical
B
polyhedral
C
icosahedral
D
complex

Answers

AnswerA. helicalExplanation:

The tobacco mosaic virus is known to be helical in nature.

Tobacco Mosaic Virus

The tobacco mosaic virus is said to be helical in nature because its capsids are rod-shaped or filamentous in appearance.

The filamentous or rod-shaped capsids have a central cavity that holds the genome (usually in the form of ribonucleic acids) of the virus.

Helical viruses are different from other viruses that may be icosahedral, prolate, or complex as far as their own capsids are concerned.

The tobacco mosaic virus, therefore, typicalizes the helical viruses.

More on the tobacco mosaic virus can be found here: https://brainly.com/question/14640586

#SPJ2

What’s the difference between a red deer, roe deer, chamois, and ibex?

Answers

Answer: Male ibex, red deer, and roe deer were generally harvested at higher elevations compared to females, whereas female chamois were harvested at higher elevations compared to male chamois. Differences in harvest elevations between males (higher) and females (lower) are smallest for ibex and largest for red deer.

Explanation: Hoped this helped

The red deer is large with prominent antlers, while the smaller roe deer has shorter antlers. The chamois is well adapted to mountains with a robust body and short horns, and the ibex is notable for its large, curved horns and mountainous habitat preference. Human activities have influenced their populations and distributions.

Differences Between Red Deer, Roe Deer, Chamois, and Ibex

The red deer, roe deer, chamois, and ibex are distinct species with unique characteristics. The red deer is known for its size and imposing antlers, especially during the rutting season when the stags roar to assert dominance. Roe deer, by contrast, are considerably smaller, with shorter antlers and more solitary behavior. Chamois are adapted to mountainous terrain, with a robust body and shorter horns that hook backwards. Lastly, the ibex is recognized for its large backward-curving horns and is typically found in rocky, mountainous environments.

Each species occupies a different ecological niche and has distinct adaptations that assist in survival, such as the chamois' agility in rugged terrain and the ibex's ability to scale steep cliffs. All of these species have been affected by human activities, ranging from hunting to habitat changes, impacting their populations and distribution.

18. When does a population experience logistic growth?
O A. When it reaches the carrying capacity
O B. When natural predators are introduced to the population
O C. When it has access to unlimited resources
O D. When there's primary succession

Answers

When it reaches the carrying capacity?

Answer:A

Explanation:

Grassland and Savanna Biomes Most of the animals in the Grasslands are. A.Herbivores B.Carnivores C.Omnivores

Answers

Imma assume it is herbivores, because there is a lot of grass in the grasslands, but double check

Most of the animals in Grassland and Savanna biomes are herbivores, such as zebras, giraffes, and bison, due to the abundance of grasses. Option A is correct.

The Grassland and Savanna biomes are two of the Earth's major ecosystems characterized by extensive areas dominated by grasses and scattered trees.Most of the animals found in these biomes are herbivores, such as zebras, giraffes, and wildebeests in African savannas, as well as bison and antelope in North American grasslands. These animals primarily feed on grasses and other vegetation.

There are also carnivores, such as lions, cheetahs, and hyenas, that prey on these herbivores, but the dominant group in terms of numbers and diversity are the herbivores, due to the abundance of grasses which provide a primary food source.

In summary, herbivores form the majority of animal populations in Grassland and Savanna biomes, ensuring a balanced ecosystem where plants and animals coexist.

Explain how a cold front is formed.

Answers

Explanation:

Cold fronts form when a cooler air mass moves into an area of warmer air in the wake of a developing extratropical cyclone. The warmer air interacts with the cooler air mass along the boundary, and usually produces precipitation. Cold fronts often follow a warm front or squall line.

Cold Front: transition zone from warm air to cold air. A cold front is defined as the transition zone where a cold air mass is replacing a warmer air mass. Cold fronts generally move from northwest to southeast. The air behind a cold front is noticeably colder and drier than the air ahead of it.

when a cooler air mass moves into a warmer one

Which habitat is characterized by permafrost?
O
A. Desert
O
B. Forest
O
O
C. Tundra
D. Grassland

Answers

Answer:

Option C is the correct answer

Explanation:

which describes the statements that Schwann and Schleiden would make?

Answers

Answer:

Schleiden and Schwann proposed spontaneous generation as the method for cell origination, but spontaneous generation (also called abiogenesis) was later disproven. Rudolf Virchow famously stated “Omnis cellula e cellula”… “All cells only arise from pre-existing cells

Explanation:

Answer:

The correct answer is: B. Schwann would make Statement II and Schleiden would make Statement III. Theodor Schwann was one of the contributors of cell theory, which explains that all living organisms are composed of one or more cells. Matthias Jakob Schleiden stated that all parts of the plant organism are composed of cells. 5.0.

Explanation:

A lab technician is running a test on a patient’s sample that is likely infected with salmonella. The technician correctly performs PCR on the sample using primers known to identify salmonella. Then they run the PCR product on an electrophoresis gel. What is the technician likely to see on the gel if the patient does have salmonella?

bands matching the size found in known salmonella samples

bands that do not match the size found in known salmonella samples

no bands

Answers

Answer:

First one

Explanation:

Final answer:

If the patient has salmonella, the lab technician is likely to observe bands matching the size found in known Salmonella samples on the electrophoresis gel, indicating the presence of the bacteria.

Explanation:

Electrophoresis Gel Analysis for Salmonella Prediction

If the patient's sample is indeed infected with Salmonella, the lab technician would expect to see bands matching the size found in known Salmonella samples on the electrophoresis gel after running PCR. This is because PCR specifically amplifies the DNA region targeted by the primers, and if Salmonella DNA is present, its size after amplification should be consistent with known Salmonella DNA fragments. Upon visual confirmation with a gel, distinct bands of the expected size should appear, suggesting a positive identification of the bacteria in the sample.

PCR amplification results in a large number of copies of the targeted DNA segment, usually producing a single, sharp band after gel electrophoresis if the target is present. If no bands are present, this might indicate that the sample did not contain the DNA region targeted by the primers, or there could have been an error in the PCR process. Observing the correct size band confirms the technician's prediction and the presence of the pathogen.

Differences in traits such as hair texture are determined by differences in ? A) The location of sugar groups in DNA B)the sequence of nucleotides in DNA C) The number of nitrogenous bases un DNA D)The molecules attached to the phosphate in DNA

Answers

Answer:

A

Explanation:

This is called the locus and is determined in Meiosis by gametes from parent cells. During meiosis there is this thing called 'crossing over' where the gametes (sperm and egg cells) homologous genes (genes of similar size and shape, such as X and Y chromosomes or X and X) exchange genes on the same locus to provide slightly different characteristics.

Please check this with your teacher but i believe that this is right. Hope this helps. ;)

How many diseases are created each year

Answers

Answer:

Deadly Diseases: Epidemics throughout history. Experts warn a global pandemic will halt humanity as we know it in the next 20 to 30 years.

Explanation:

Past epidemics may offer some insight into what the future holds

Other Questions
Help,please,thankyou In Draco Corporations first year of business, the following transactions affected its equity accounts. Issued 6,800 shares of $2 par value common stock for $46. It authorized 20,000 shares. Issued 1,700 shares of 12%, $10 par value preferred stock for $51. It authorized 3,000 shares. Reacquired 340 shares of common stock for $58 each. Retained earnings is impacted by reported net income of $78,000 and cash dividends of $29,000. Prepare the stockholders equity section of Dracos balance sheet as of December 31. Miranda and her uncle see an interesting new car drive by. Later, after the car has gone, her uncle asks if she remembers the neat thing they saw minutes before. Miranda says, "Yes, we saw a car." Miranda is demonstrating A rumor starts that says a bank has suffered significant losses and may not be able to honor its promises to depositors. This causes most of the depositors to line up in front of the bank the next morning wanting to withdraw their deposits. This is an example of:A. Liquidity riskB. Operational riskC. Interest rate riskD. Credit risk PLS PLS HELP 30 PTS AND BRAINLIEST IF CORRECTBanksy Art Self-Destructs After Selling for $1.4MBy Rowena SalazarAnonymous artist Banksy stunned the art world on October 6, 2018 with a prank that caused one of his paintings to self-destruct. Moments after "Girl With Balloon" sold for $1.4M via phone auction at Sotheby's auction house, an alarm sounded. Then, a remote-controlled mechanism slid the canvas down its frame where a shredder was hidden. Several videos and photos show the painting hanging halfway shredded outside of its frame."Girl With Balloon" was a spray paint on canvas work completed in 2006 and shows a small child reaching up toward a heart-shaped red balloon. The original work was stenciled on a wall in east London and is one of Bansky's most recognizable images.Banksy, an England-based graffiti artist, is also considered a political activist and vandal. He has remained anonymous since gaining fame for his stenciled graffiti art, usually spray-painting his murals in the middle of the night. Banksy often incorporates dark humor, political messaging, and social commentary into his art. He openly criticizes commercialism, once even selling works of his art at a New York Central Park pop-up shop for $60 a piece, far below their value. In 2007, he graffitied "ONE NATION UNDER CCTV" on the side of a British postal service building."Graffiti art has a hard enough life as it is, before you add hedge-fund managers wanting to chop it out and hang it over the fireplace," the New York Times quoted Banksy in 2013. "For the sake of keeping all street art where it belongs, I'd encourage people not to buy anything by anybody, unless it was created for sale in the first place." (Ryzick, M. "Another Banksy Mural to Go from Wall to Auction." The New York Times, 12 August 2013).Soon after shredding his own painting, which sold for a record-high price, Banksy posted a photo on his Instagram account of the half-shredded painting with a caption reading "Going, going, gone " He also posted a video describing how "a few years ago I secretly built a shredder into a painting in case it was ever put up for auction " He captioned the video with a quote from Pablo Picasso"The urge to destroy is also a creative urge."From the Financial District Times"'Girl With Balloon' already broke an important auctions record for Bansky, selling for $1.4M. After its recent shredding, we certainly expect this important work to raise the bar even further. While casual art observers consider the work to be destroyed, collectors are drawn to its one-of-a-kind circumstance. We wouldn't be surprised if it's already doubled in value."In a paragraph of at least five sentences, address Banksy's advice "not to buy anything by anybody, unless it was created for sale in the first place." Include at least one specific reference to each excerpt in your response. QUESTION 2 Objectives: I . identify potential and kinetic energy in a situation and draw corresponding energy bar charts, II . calculate gravitational and elastic potential energy, III . draw & analyze potential energy functions, and (d) use conservation of energy to relate the total energy at one time to total energy at another time. ------------------------------------------- Bungee Jump: you will step off with zero initial vertical velocity from a platform a height h above the ground. The bungee cord will act like a giant extensional spring that will, you hope, provide an upward force on becoming taut. After weighing you (you have a mass M), the operator has selected a bungee cordwith an un-stretched length of d and a spring constant of k. Consider yourself to be a single point i.e., use the particle model. Choosing the ground as your origin (and the z-axis directed upwards), answer the following questions about your bungee jumping adventure in terms of M, h, d, k, z, and the gravitational field strength, g. Answer with variables. ------------------------------------------- a) Write an expression for the stretching ?L of the cord in terms of d and z and for the total potential energy U of the jumper-bungee-Earth system for each situation (consider the latter two situations together). b) Which type of potential energy ( UG or US ) is largest for large z (early in the fall)? For small z (late in the fall)? c) Sketch a graph of your gravitational potential energy, UG(z) vs your height, z, from z = 0 to z = h, on the left plot. Then sketch a graph of your elastic potential energy, US(z) on the center plot. Finally on the rightmost plot, sketch a graph of your total potential energy1 U(z) = UG(z) + US(z). Do these plots on your own without the help of a computer or calculator. 1.) 2x9y=14 2.) x=6y+7 please help!! 40% of OatyPop cereal boxes contain a prize. Hannahplans to keep buying cereal until she gets a prize. What isthe probability that Hannah only has to buy 3 or lessboxes before getting a prize?We need to design a simulation. Which random device can we use to BESTrepresent this situation?Use a double-sided coin andassign heads as the prize andtails as no prize.Use a number cube with thenumbers 1 through 6 and assign1 through 2 as the prize and 3through 6 as no prize.Use a random number generatorranging from 1 to 10 and assign1 through 4 as the prize and 5through 10 as no prize.Use a deck of cards and assignspades as the prize and allother suits as no prize. There are three groups that contain carbon but are not organic compounds:carbon chlorides carbon oxides carbon iodides carbides carbonates When should you use the median and interquartile range as your measure of center and measure of variability tocompare populations shown on a box plot? Check all that applywhen there are outliers in the data setswhen there are no big gaps in the middle of the data setswhen the plots representing the data are symmetricalwhen the plots representing the data are nonsymmetricalwhen there are no outliers in the data setIntroDone To assist with a class demonstration, a student (whose mass is 60 kg) filled a water balloon with 2 kg of water. He then climbed to the second floor (10 metres) of the school and held the balloon out of a window. How much work did the student do? What is it called when plants give off water vapor as a waste product? Jason is entering a weight lifting contest. Gurrently, his maximum bench press weight is 105 pounds. If he increases the weight by 7 pounds each week, What is the maximum weight he be able to bench press after 13 weeks? Which statement best summarizes the central idea of thisexcerpt?DOUO One must know the process of hiring servants.0 It is important to always honor one's servants.O It is necessary to choose trustworthy servants.O The intelligence of servants must be considered.herofich 1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment