HEEEEEEEEEEEEELLLLLLLLLLPPPPPPPPPP

Fraction 4 over 5n = Fraction 2 over 3. n = ___?

A. Fraction 2 over 15
B. Fraction 5 over 6
C. 1Fraction 1 over 5
D. 1Fraction 7 over 15

HEEEEEEEEEEEEELLLLLLLLLLPPPPPPPPPPFraction 4 Over 5n = Fraction 2 Over 3. N = ___?A. Fraction 2 Over

Answers

Answer 1
The answer is B, 5/6, because when you multiply 4 by 5 it is 20, and when you multiply 5 by 6, you get 30, so 20/30. And, 20/30=2/3. I hope I answered your question!
Answer 2

The correct option is (b) 5/6.

What is fraction?An element of a whole is a fraction. The number is represented mathematically as a quotient, where the numerator and denominator are split. Both are integers in a simple fraction. A fraction appears in the numerator or denominator of a complex fraction. The numerator of a proper fraction is less than the denominator.

Given ,

                   [tex]\frac{4}{5} n = \frac{2}{3} \\[/tex]

now do simply cross multiplication both sides,

                  4n × 3 = 2 × 5

                    4n = 10/3

                      n = 10/3 ×4

                      n = 10/12 ⇒ 5/6

Therefore, value of n is 5/6.

Learn more about fraction brainly.com/question/17205173  here

#SPJ2


Related Questions

Please help me!
Which of the following is the best definition of the sample space of a probability event?

Answers

It’s the set of all possible outcomes

Answer: D. The set of all possible outcomes

Step-by-step explanation:

The set of all possible outcomes is the collection of all possible outcomes of an experiment.In the theory of probability the sample space of an random experiment is the set of all possible results of that particular experiment.

Therefore, the  best definition of the sample space of a probability event is the set of all possible outcomes.

What is the value of x in the solution to this system of linear equations? 4x - 3y = 3

Answers

4x-3y=3
x-y=2

Multiply the bottom equation by -3

4x-3y=3
-3x+3y=-6

Add the two equations together
The y’s cancel each other out
So your left with:

X=-3

The value of x is -3

simplify this expression 6q/20(q+r)

Answers

For this case we have the following expression:
 6q / 20 (q + r)
 Rewriting the expression we have:
 (6/20) (q / (q + r))
 Simplifying we have:
 (3/10) (q / (q + r))
 Answer:
 
The simplified expression is given by:
 
(3/10) (q / (q + r))
The answer would be  (3/10) (q / (q + r)) 
Equation:
6q / 20 (q + r)
 =(6/20) (q / (q + r))
 Simplify it :
 (3/10) (q / (q + r))

 
The simplified expression is given by:
 
(3/10) (q / (q + r))

factor 3x^3+3x^2+x+1

Answers

We can solve it like:
3x^3+3x^2+x+1= (3x^3+3x^2)+(x+1)=
3x^2(x+1)+(x+1)=
= (x+1)(3x^2+1)

Have a good day
(3x³ + 3x²) + (x + 1)
3x²(x + 1) + 1(x + 1)
(3x² + 1)(x + 1)

Factored form: (3x² + 1)(x + 1)


help me in 25 no...I am not getting

Answers

25a. You are given a formula for height and told that the value of "r" in the formula is 19.6. You are asked to find the value of t such that h = 14.7. Substitute the given values and solve for t the way you solve any quadratic equation.
 14.7 = 19.6t -4.9t²
 4.9t² -19.6t +14.7 = 0 . . . . . put the equation in standard form
 4.9(t² -4t +3) = 0 . . . . . . . . . factor out 4.9 to simplify the numbers
 (t -1)(t -3) = 0 . . . . . . . . . . .. divide by 4.9 and factor
The solutions to this are ...
 t = 1, t = 3

After 1 second, the ball will reach the height of 14.7 meters.


25b. This question asks you to find the value of t that make h = 0.
 0 = 19.6t -4.9t² . . . . . . substitute the given numbers
 0 = 4.9t(4 -t) . . . . . . . . factor
The solutions to this are ...
 t = 0, t = 4

The ball will hit the ground after 4 seconds.


_____
As you can see from the graph below, a graphing calculator can be helpful for solving problems of this sort.

Find sine cosine and tangent

Answers

I am just going to assume that you  are looking the sine, cosine, and tangent of both A and B. 

SOHCAHTOA (used for reference). 

 [tex]Sin A = \frac{8}{10} = \frac{4}{5} \\Cos A = \frac{6}{10} = \frac{3}{5} \\Tan A = \frac{8}{6} = \frac{4}{3} \\Sin B = \frac{6}{10} = \frac{3}{5} \\Cos B = \frac{8}{10} = \frac{4}{5} \\Tan B = \frac{6}{8} = \frac{3}{4} \\[/tex]

How many lawns were mowed?

What is the difference between the greatest amount and least amount of gasoline used to mow lawns?

Answers

How many lawns were mowed ?
11 lawns because there are 11 x’ s

What is the difference between the greatest amount and least amount of gasoline used to mow lawns ?
4/8 of to simplify it’s 1/2

An electrolyte solution has an average current density of 1 ampere per square decimeter (A/dm^2). What is the current density of the solution in A/m^2?

Answers

We should know that  ⇒⇒⇒ 1 meter = 10 decimeters
1 m = 10 dm

∴ 1 m² = 100 dm²  ⇒⇒⇒ 1 dm² = 0.01 m²

For the given dimension
1 (A/dm²) = [tex] 1 \frac{A}{dm^2} = 1 \frac{A}{0.01 \ m^2} = 1 * \frac{1}{0.01 } \frac{A}{m^2} = 100 \ \frac{A}{m^2}[/tex]

note: 1/0.01 = 100



Answer:

the density of electrolyte solution is 100 ampere per square meter

Step-by-step explanation:

We know that the Average current density of the solution = 1 ampere per square decimeter  and we need to find the average current density of the solution in ampere per square meter. So


Solve the inequality and describe the solution set:
y-6 ≥ 12

Answers

y≥18

You want to get the y only on one side of the equation. To get rid of the -6 you  have to add 6 to both sides to even out the equation.

y-6≥12
 +6 +6
y ≥18

Answer: The solution set is  y≥18.

Step-by-step explanation:

Since we have given that

[tex]y-6\geq 12[/tex]

We need to first find the inequality and find the solution set.

[tex]y-6\geq 12\\\\y\geq 12+6\\\\y\geq 18[/tex]

So, the solution set for this would be all the values of y which is greater than 18.

i.e. y≥18.

a roll of one die has six possible outcomes. Use the product counting principle to determine the total number of outcomes for a toss of two die explain your response



       

Answers

There are 36 possible outcomes.

There are 6 outcome for the first die and 6 outcomes for the second die.  The fundamental counting principle states that to find the total number of outcomes of these independent events, we multiply:

6(6) = 36

596.282 ×_____ = 5,962.82
A) 1
B) 10
C) 100
D) 1,000

Answers

The answer is B because multiply 10 will give you the answer.
Answer is B

5,962.82 ÷ 596.282 = 10

A rectangle has vertices at these coordinates. (5, −3), (5, −8),(8, −3) What are the coordinates of the fourth vertex of the rectangle? Enter the coordinates in the boxes.

will give brainlest

Answers

Answer:

Coordinate of 4th vertex of the rectangle is ( 8 , -8 ).

Step-by-step explanation:

Given Vertices of Rectangle are ( 5 , -3 ) , ( 5 , -8 ) , ( 8 , -3 )

To find: Coordinate of Fourth Vertex of the rectangle.

First, Plot all given three points on the graph.

Graph is attached.

We know that Opposite sides of the rectangle are equal and parallel.

Also All angles of rectangles are right angle.

So to satisfy these properties of rectangle.

4th coordinate must be on line x = 8 and y = -8.

⇒ Fourth coordinate = ( 8 , -8 )

Therefore, Coordinate of 4th vertex of the rectangle is ( 8 , -8 ).

the sum of two numbers equals 49.The sum of the larger number and twice the smaller number is 70. what are the numbers.

Tell me the steps!

Answers

[tex]x + y = 49 \\ x + 2y = 70[/tex]

[tex]x = 49 - y[/tex]

Substitute that into,
[tex]49 - y + 2y = 70 \\ y = 21[/tex]

Substitute that into,
[tex]x = 49 - 21 \\ x = 28[/tex]

Answer check :
[tex]21 + 28 = 49 \\ 28 + 2(21) = 28 + 42 = 70[/tex]

Answer : The numbers are 21 and 28.

Hope this helps. - M

The problem is solved using a system of equations to find that the two numbers in question are 21 and 28.

To solve the problem involving two numbers where the sum equals 49 and the sum of the larger number and twice the smaller number equals 70, we need to form a system of linear equations and solve for the unknowns. Let's denote the smaller number as s and the larger number as l.

The sum of the two numbers is 49: s + l = 49.The sum of twice the smaller number and the larger number is 70: 2s + l = 70.

Subtract the first equation from the second to find the value of s.

2s + l - (s + l) = 70 - 49

Which simplifies to:

s = 21

Substitute the value of s into the first equation:

21 + l = 49

And solve for l:

l = 28

Therefore, the smaller number is 21 and the larger number is 28.

What is 51-50.1? Explain your answer.

Answers

51.0-50.1=0.9
This was a basic subtraction problem.
.9 as the calculator says so

Which expression repressents “6 more than x”?

Answers

I would say the 2nd option because its adding 6 to the X which means 6 more

Hope this helps I would appreciate brainliest
Hello there, and thank you for posting your question here on brainly.

Short answer: C. x + 6

Why?

When you're referring to addition, you can use words like 'more than, higher than, added, etc.' In this case, we have 6 more than x, so the correct answer would be the one that shows addition, which is x + 6.

Hope this helped you! ♥

Which point is an x-intercept of the quadratic function
f(x) = (x + 6)(x – 3)?

Answers

D (-6,0) is the correct answer

Answer:

(-6,0) and (3,0)

Step-by-step explanation:

we have the function [tex]f(x)=(x+6)(x-3)[/tex] and the x-intecept of the function will be when y=0 then:

[tex]f(x)=(x+6)(x-3)\longrightarrow 0=(x+6)(x-3)[/tex]

Then the result will be 0 when x=-6 or x=3

Which of the following is the correct way to write 6 * 6 * 6 as a base and exponent?

Answers

To write this equation in the correct form would look something like this :

[tex] 6^{3} [/tex] .

6 to the 3rd power, or 6 cubed, would equal :

6 x 6 x 6 = 216.


Hope this helps.

Jamie is 5 years older than Ella. Jamie's age is 11 years less than three times Ella's age. The system below models the relationship between Jamie's age (j) and Ella's age (e):

j = e + 5
j = 3e – 11

Which of the following methods is correct to find Jamie's and Ella's age? (4 points)



Solve j + 5 = 3j – 11 to find the value of j.

Write the points where the graphs of the equations intersect the x-axis.

Write the points where the graphs of the equations intersect the y-axis.

Solve e + 5 = 3e – 11 to find the value of e.

Answers

The correct answer is to solve e+5=3e-11 for e.

The correct method is to use the equation

e + 5 = 3e - 11

on solving, we get e = 8 and j = 13

Other methods are complicated.

Kara and Steven are biking around a 1,800 kilometer path. They start biking from the same place, at the same time, and in the same direction. Kara bikes at a speed of 15 km/h and Steven bikes at a speed of 30 km/h. How long will it take before Steven and Kara will be at the same place of the path next time?

Answers

This is the concept of speed, distance and time:
Time taken before the cyclist are on the same sport will be found as follows:
time=distance/(relative speed)
distance=1800 km
given that the cyclist will be riding towards the same side, then
relative speed=(Steve's speed-Kara's speed)=30-15=15 km/h
thus time taken will be:
time=1800/15
=120 hours

Enter the value of m when the expression 13.5x+m is equivalent to 2.7(5x-3.6)

Answers

we have that
13.5x+m =2.7(5x-3.6)
13.5x+m =2.7*5x-2.7*3.6
13.5x+m=13.5x-9.72

if the expression (13.5x+m) is equivalent to 13.5x-9.72 
then 
m=-9.72

the answer is
m=-9.72

just answer question, No need to explain. THANKS

Answers

The answer is c.

The -3 means it’s shifted to the right 3 units
The 4 means it shifted up 4 units

For this case we have the following function:
 f (x) = x ^ 2
 We have the following information:
 Horizontal translations
 
Suppose that h> 0
 To graph y = f (x-h), move the graph of h units to the right
 f (x) = (x-3) ^ 2
 Vertical translations
 
Suppose that k> 0
 To graph y = f (x) + k, move the graph of k units up.
 f (x) = (x-3) ^ 2 + 4
 Answer:
 
f (x) = (x-3) ^ 2 + 4
 
option C

Who can help me with this algebra 2 work Need help

Answers

Change the following to logarithmic or exponential form.
Note:
log_a c=b can be written as:
aᵇ=c
hence:
1. log₄ 16=2
will be written in exponential as:
4²=16

2. 25^(1/2)=5
will be written in logarithmic form as:
log₂₅5=1/2

3. Which function represents exponential growth?
#N/B For an exponential function:
y=a(b)^x
when b>1 it exponential growth
when b<1 it is an exponential decay
F: y=1/20(4)ˣ
b=4>1
exponential growth

G: y=16(0.4)ˣ
b=0.4<1
exponential decay

H: 20(1/8)ˣ
b=1/8<1
exponential decay

I. y=8x³
The above function does not have a growth factor, thus
it is a polynomial function not an exponential function.

4. Solve log₄3+log₄x=log₄18
when we add log functions we can multiply them as follows:
log₄(3*x)=log₄18
the log₄ will cancel and we shall remain with:
3x=18
solving for x we get:
(3x)/3=18/3
thus
x=6

5. Solve log₇36x-log₇2=log₇9
Dividing log functions is like subtracting them, thus we shall have:
log₇(36x/2)=log₇9
simplifying this we get:
log₇ 18x=log₇9
log₇ will cancel because of the same base and we shall have:
18x=9
thus
x=9/18
x=1/2

Expand the following:
Remember:
Multiplying logs is the same as adding them
Subtracting logs is the same as dividing them
thus

6. log₃ 4xy
expanding the above give us:
log₃4+log₃x+log₃y
Answer: log₃4+log₃x+log₃y

7. log₅ (xy²)/3
expanding this gives us:
log₅x+log₅y²-log₅3

Answer: log₅x+log₅y²-log₅3

Condense the following logarithms:
Using the concept from 6 and 7 we shall have:
8. log₈2+log₈7-log₈x
condensing this will give us:
log₈[(2*7)/x]
simplifying gives us:
log₈(14/x)

9. log₇9+3log₇y-4log₇2
Condensing the above gives us:
log₇9+3log₇y-4log₇2
=log₇9+log₇y³-4log₇2
=log₇(9*y³)/2
=log₇(9y³/2)

One fifth the total of a number and 4 is 2, find the number

Answers

Answer:

-10

Step-by-step explanation:

(1/5)x+4=2

5(1/5)x+4=2)

x+20=10

x = -10

A survey shows that 67% of peanut butter lovers prefer chunky-style. Out of 850 people surveys, how many can be predicted to say they prefer chunky-style peanut butter?

Answers

ANSWER: 569.5
All you have to do is make you % into a decimal is multiply by 850

Hope this helps :-)



I like to use this formula cause it's really useful when it comes to these problems:


   Part                  Percent

________    =  _________

  Whole                 100



So, you basically plug in the numbers into the equation, it's really easy:


    ???                  67%

________   =   ________

    850                  100


Then, you cross multiply. 67% x 850 = 56,950 / 100 =

And the answer to your question is: 569.6 or rounded is 570.

A bag is filled with marbles. You take out and mark 80 marbles. Then you put the marbles back in the bag and mix the marbles. In a sample of 20 marbles, 4 of the marbles are marked. About how many marbles are in the bag?

Answers

About 400 marbles. You simply set up a proportion and solve it as I did in the photo attached.
there are about 400 marbles

Explain why the equation 5z + 2 = 5z has no solution.

Answers

[tex]5z + 2 = 5z \\ 5z - 5z = - 2 \\ 0 = - 2[/tex]

Answer : This is because when 5z minus 5z, it is nullified, with no way to determine the value of z. 5z - 5z = 0
That is why there is no solution for this equation.

Hope this helps. - M

Traverion wants to find the answer to the question “how much money does the average college professor make?” He surveys 50 professors from the university in his hometown. Which best describes whether or not the results of his survey would represent the responses from the entire propulatiob of college professors?

Answers

The results do not represent the population because the sample does not represent professors from different areas.

Traverion's survey would not represent the responses from the entire population of college professors.

Survey

A survey is conducted in order to collect a piece of specific information from a group of people chosen from the entire population who denotes the entire population for those questions.

Given information

Traverion wants to find the answer to the question “how much money does the average college professor make?” He surveys 50 professors from the university in his hometown.

Traverion wants to know “how much money does the average college professor make?”, so, in the survey, he wants to know the average for the entire population.The information is been collected from his town only, therefore, the data represents the average college professor's salary for his town only.

Hence, Traverion's survey would not represent the responses from the entire population of college professors.

Learn more about Survey:

https://brainly.com/question/13532910

The movie theater add 352 people in it.if the people split into eight even groups to watch different movies how many people Will watch each movie

Answers

The answer is 44 because the equation is 352 divided 8. And 8 goes into 352 44 times. If you want to check the work you can also multiply 44 and 8, and it should be 352.

So the answer is 44
Hope this Helps:)

you flip two coins and roll a number cube what is the probability of flipping two tails and rolling as even number

Answers

P(tail) = 1/2
P(even number) = 1/2

P(tail, tail, even) = (1/2) (1/2) (1/2) = 1/8

Answer: 1/8
each coin flip has a 1/2 probability of landing on tails
 so  1/2 x 1/2 = 1/4 probability of getting 2 tails

a single die has 3 even numbers so you have a 3/6 = 1/2 probability of getting an even number

multiply both together for probability of 2 tails and an even number: 1/4 x 1/2 = 1/8 probability

x – y ≥ -4.
2x – y ≤ 5.
2y + x > 1

Answers

I took a picture of the work instead ^^
Other Questions
Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other Polands energy resources can be described as _____. a. based on large deposits of coal b. rich in petroleum c. large deposits of sulfur d. large deposits of copper If a circle has a radius of 18 feet what's the closest approximation for circumference Has complete control of the laws rules and affairs of a country Plz jphelp me answer this year 7 question and explain how u got the answer. If the most industrialized countries all signed a climate-change treaty with the goal of keeping the sea at its current level, which would be a free rider benefiting from a positive externality of the treaty America wanted to end japan's aggression by placing a(n) _______ to cut off the oil and scrap metal supply. Eva is jumping on a trampoline. Her height h at time t can be modeled by the equation h=-16t^2+20t+6. Would Eva reach a height of 14 feet? A traveler's budget and needs are considered by a _________ when arranging a trip.