hey can you please help me posted picture of question

Hey Can You Please Help Me Posted Picture Of Question

Answers

Answer 1
Selecting this function: F(x)= x^4-x^2+3

Graph using these selected points:
Rises to the left and rises to the right
x            y
-1          3
0           3
1           3
2           15
3           75


After assigning values for x and y, plot the graph:
See attached picture for the graph.

We can now conclude that for the given graph, the equation of F(x) is equal to x^4-x^2+3 which is letter D. F(x)= x^4-x^2+3
Hey Can You Please Help Me Posted Picture Of Question

Related Questions

Q # 1 solve the problem

Answers

 For this case we have the following variables:
  x = the number of adult tickets
  y = the number of children's tickets
  We write the inequality:
  8x + 6y <= 172
  The solution is the set of points that belong to the region shaded in the graph.
  Answer: 
  8x + 6y <= 172 
  see attached image.


The solution is shown in the graph attached.

Explanation:

I am goind to teach you how to get that solution.

1) Restricctions: both x and y cannot be negative, i.e. x ≥ 0 and y ≥ 0

⇒ the solution is on the first quadrant.

2) Using the prices of the tickets, $ 8 for adults, and $ 6 for children, the linear equation for the costs is: cost = 8x + 6y.

3) Since the radio station is willing to spend a maximum of $ 172 you have the final restriction:

⇒ 8x + 6y ≤ 172.

4) Then the solutions that meet the three restrictions (x ≥0, y ≥ 0, and 8x + 6y ≤ 172) is found graphically by drawing the line 8 x + 6y = 172

5) To draw the line 8x + 6y = 172, use the axis intercepts:

x = 0 ⇒ y = 172/6 = 86/3 ⇒ point (0, 86/3)

y = 0 ⇒ x = 172/8 = 86/4 ⇒ point (86/4, 0)

6) Once you have the line you shade the region that is between the line and the two axis. That region contain of the possible solutions.

2(3y-1)3(y-4)=13 please show step by step

Answers

[tex]2(3y-1)+3(y-4)=13\\\\2\cdot3y+2\cdot(-1)+3\cdot y+3\cdot(-4)=13\\\\6y-2+3y-12=13\\\\\underbrace{6y+3y}_{9y}\underbrace{-2-12}_{-14}=13\\\\9y-14=13\ \ \ |\text{add 14 to the both sides}\\\\9y=27\ \ \ |\text{divide both sides by 9}\\\\\boxed{y=3} [/tex]

Select whether the number is rational, irrational, or imaginary. 1/4

Answers

Hey there!

The correct answer should be rational.

Hope this helps!

The value of number 1 / 4 is a Rational number.

What is Rational number?

A number which can be written in the form of fraction p / q , where q is non zero, are called Rational numbers.

We have to given that;

The number is,

⇒ 1 / 4

Now, Number 1 / 4 is of the form p / q (fraction form).

Hence, We can say that;

The value of number 1 / 4 is a Rational number.

Thus, It is a Rational number.

Learn more about the rational numbers visit:

https://brainly.com/question/12088221

#SPJ3

list all the possible whole number length and width of rectangles that darla can cut from the 400 square inch piece of paper

Answers

The possible dimension are :

400 = 1 x 400
400 = 2 x 200
400 = 4 x 100
400 = 5 x 80
400 = 8 x 50
400 = 10 x 40
400 = 16 x 25
400 = 20 x 20

A real estate broker sold your house for $189,000. The broker's commission was 4.5 percent of the selling price. How much would you get for the house after the commission is paid?

Answers

First, we are going to find the commission of the broker. To do that we are going to multiply  the selling price of your house by 4.5 percent:
[tex]189000*[/tex]4.5%=[tex]189000* \frac{4.5}{100}=8505 [/tex]

Next we are going to subtract the broker's commission ($8505) from the selling price of your house:
[tex]189000-8505=180495[/tex]

We can conclude that you will get $180,495 from your house after the commission is paid.

Find the length of CE

Answers

we know that
CE=CD+DE

in the right triangle EDF
cos 38°=EF/DE-----> DE=EF/cos 38°-----> DE=17/cos 38°----> DE=21.57 units

∠FDE=90-38----> 52°
∠BDC=∠FDE------> vertical angles
so
∠BDC=52°

in the right triangle BDC
cos 52°=BD/CD-------> CD=BD/cos 52°----> CD=10/cos 52°---> CD=16.24

CE=CD+DE----> CE=16.24+21.57----> CE=37.81 units

the answer is
the length of CE is 37.81 units

What is 3km 9hm 9dm +7km 7dam

Answers

3+9+9+7+7=36
Good night hope thid helps
using conversion
 
let km be the base unit

9 hm = 0.9km
9 dm = 0.0009 km
7 dam = 0.07km

adding all of the values

3 + 0.9 + 0.00009 + 7 + 0.07 = 10.97009

a _____ is a list of things where each thing appears only once and Order matters

Answers

Answer: Permutation

Permutation is a way, in which a set or number of things can be ordered or arranged. It is a listing where order matters and each thing in the list of things appears only once.

 In Mathematics, permutation is the action of changing the arrangement of a set of items. .It is also called an "arrangement number" or "order 

what number is the opposite of 890

Answers

-890 is your answer . Any positive number is the negative of it .

The opposite of 890 is -890, which means -890 added to 890 equals zero.

The opposite of a number is defined as a number that, when added to the original number, results in zero. To find the opposite of a number, you simply change its sign. If the number is positive, the opposite is negative, and if the number is negative, the opposite is positive. Therefore, the opposite of 890 is -890.

A certain​ country's postal service currently uses 6​-digit zip codes in most areas. how many zip codes are possible if there are no restrictions on the digits​ used? how many would be possible if the first number could not be 0​?

Answers

If any digit can be 0 to 9 with no restrictions, the number of possible zip codes is ...
  10×10×10×10×10×10 = 10⁶ = 1,000,000.
Final answer:

For a 6-digit zip code with no restrictions, there would be 1,000,000 possible zip codes. If the first digit could not be a '0', the number of possible zip codes would decrease to 900,000.

Explanation:

We're dealing with a counting problem here. This problem involves basic principles of combinatorics.

Firstly, if there are no restrictions on the digits used, each of the six positions in the zip code can hold any digit from 0 to 9. There are 10 choices (from 0 to 9) for each of the 6 digits in the zip code which leads to 10^6 = 1,000,000 possible zip codes.

However, if the first number could not be 0, there are 9 possible choices for the first digit and 10 choices for each of the remaining 5 digits. Therefore, the number of possible zip codes would be 9 * 10^5 = 900,000.

Learn more about Combinatorics here:

https://brainly.com/question/32015929

It costs $0.05 to send a text message and $0.10 to send a picture on your cell phone. You spend $4 and send five more text messages than pictures. How many text messages, x, and pictures, y, did you send?

Answers

The first thing we must do for this case is to define variables:
 x: text messages
 Y: pictures
 We write the system of equations:
 0.05x + 0.10y = 4
 x = y + 5
 Solving the system we have:
 x = 30
 y = 25
 Answer:
 
you send:
 
30 text messages
 
25 pictures
Final answer:

This is a problem of system of linear equations. We form two equations from the conditions given in the problem, and solve the system of equations to find the number of text messages and pictures sent.

Explanation:

This is a problem of system of linear equations. Here are two conditions mentioned: The total cost and difference of number of text messages and pictures.

Let's denote the number of text messages as x and pictures as y as per your question.

From the cost, we have the equation: $0.05x + $0.10y = $4.

From the difference of the number of sent messages and pictures, we have: x = y + 5.

Now we can substitute x from the second equation into the first one, get the value for y, and calculate the value for x after. Here you have step-by-step solution for your problem.

Learn more about system of linear equations here:

https://brainly.com/question/20379472

#SPJ12

Which conversion requires multiplication? Use the metric table to help answer the question.

Answers

Any conversion that goes down to a smaller value 

Ex: Kilometer to meter will be x1000
meter to centimenter is x100

BUT going up will be division
Meter to kilometer is /1000

Answer:

centimeters to kilometers

Step-by-step explanation:

The students at Porterville Elementary sold raffle tickets, each for the same price, for a fundraiser. The equation below shows how much money was raised with the tickets sold. $1,760 = $20t. What is the unit rate in the equation above?

Answers

The "unit rate" appears to be $20 per ticket.

A combination lock requires 4 selections of numbers, each from 1 to 20. • how many different combinations are there? • suppose that the lock is constructed in such a way that no number maybe used twice. how many different combinations are possible?

Answers

NUmber of combination = 20 x 19 x 18 x 17 = 116 280

Answer:  116 280

the quotient of a number and 9 is equal to the same number decreased by 40. what is the number

Answers

Quotient is the result of dividing two numbers.

x= the unknown number

The equation is x divided by 9 equals x minus 40.


x/9= x - 40
multiply both sides by 9

(9)(x/9)= (9)(x - 40)
x= 9x - 360

subtract 9x from both sides
-8x= -360

divide both sides by -8
x= 45


ANSWER: The number is 45.

Hops this helps! :)

change -115 degrees to radian measure in terms of pi

Answers

-23\pi/36 or -115\pi/180.

In order to find this, you need to take the degrees [ in this case -115 ] and multiply that by \pi/180. Then simplify that result if possible.

Hope this helps!

Answer:

-23/36 pi

Step-by-step explanation:

(-115 x pi) / 180

Nadine has 3 yard of ribbon to wrap birthday party favors if each favor use 1/5 yards of ribbon how many favors can nadine wrap

Answers

I think the answer is 15 Hope this helps

the expression sinx + cotx cosx can be simplified to___. A. cotx B. cscx C. cosx sinx D. secx

Answers

[tex]\sin x+\cot x\cos x=\sin x+\dfrac{\cos x}{\sin x}\cos x=\dfrac1{\sin x}(\sin^2x+\cos^2x)=\csc x[/tex]

Answer:

Solution-

∵ cotx = (cosx÷sinx)

∴ The given expression can be written as

sinx + cotx·cosx = sinx + ( cosx÷ sinx).cosx

⇒sinx +(cosx)²÷sinx = [ (sinx)² + (cosx)²] ÷ sinx

⇒ 1÷ sinx = cosecx = cscx

using the identity (sinx)²+(cosx)²=1

∴ option B is correct.


PLZ HELP NOOOOW!!

Sarah ran around a track 1 1/2 times. The track in 3/4 of a mile long.

How many miles did Sarah run?

Answers

Hey there! The answer is 1 1/8 mile.

To find the amount of miles Sarah ran, we need to multipy the length of the track by the times she run that distance.
[tex]1 \frac{1}{2} \times \frac{3}{4} = \frac{3}{2} \times \frac{3}{4} = \frac{9}{8} = 1 \frac{1}{8} [/tex]

Rembember: multiplying a fraction means you have to multiply the numerator by the numerator (of the other fraction) and the denominator by the denominator (of the other fraction)

The answer is 1 1/8 mile.
~ Hope this helps you!

mean median mode range on 83 75 74 40 85 64 23 68

Answers

In the given set, the mean is 64, the median is 66, there is no mode, and the range is 62.

To find the mean, median, mode, and range of the given set of numbers: 83, 75, 74, 40, 85, 64, 23, 68.

1. Mean:

[tex]\[ \text{Mean} = \frac{\text{Sum of all numbers}}{\text{Total number of numbers}} \][/tex]

[tex]\[ \text{Mean} = \frac{83 + 75 + 74 + 40 + 85 + 64 + 23 + 68}{8} \][/tex]

[tex]\[ \text{Mean} = \frac{512}{8} \][/tex]

[tex]\[ \text{Mean} = 64 \][/tex]

2. Median:

The median is the middle number when the numbers are arranged in ascending order.

Arranging the numbers in ascending order: 23, 40, 64, 68, 74, 75, 83, 85

Since there are 8 numbers, the median is the average of the two middle numbers:

[tex]\[ \text{Median} = \frac{64 + 68}{2} \][/tex]

[tex]\[ \text{Median} = 66 \][/tex]

3. Mode:

The mode is the number that appears most frequently.

In this set, there is no number that appears more than once.

So, there is no mode.

4. Range:

The range is the difference between the largest and smallest numbers.

[tex]\[ \text{Range} = \text{Largest number} - \text{Smallest number} \][/tex]

[tex]\[ \text{Range} = 85 - 23 \][/tex]

[tex]\[ \text{Range} = 62 \][/tex]

So, for the given set of numbers, the mean is 64, the median is 66, there is no mode, and the range is 62.

if a horse weighs 500kg and a spider 1g how many spiders weigh the same as one horse??

Answers

Hello!

First you have to put the horses weight into grams

There are 1000 kilograms in a gram

Multiply the horse weight by 1000 to get its weight in grams

500 * 1000 = 500000g

Divide the weight of the horse by the weight of the spider

500000 / 1 = 500000

The answer is 500,000 spiders

Hope this helps!

hey can you please help me posted picture of question

Answers

Option A is the correct answer.

The cubic parent function is y = x³ , with no coefficients multiplied to x and with number added to or subtracted from x. Other cubic functions are a modified form of parent cubic function.

So, the answer is y = x³

which of the following is equal to the rational expression when x does not equal to 5 or -1
(x-7)(x+1)/(x+1)(x-5)
a- x+1/x-5
b-x-7/x+1
c- x+1/x-7
d- x-7/x-5

Answers

The answer is D. You can cancel the (x+1) on the top and bottom because they are the same number. 

The expression that is equal to the rational expression when x does not equal to 5 or -1 is; (x - 7)/(x -5)

How to simplify Algebraic Expressions?

We want to simplify the algebraic expression;

(x - 7)(x + 1)/(x + 1)(x - 5)

Now, looking at the given expression, we see that (x + 1 ) is common to both numerator and denominator and as such they will cancel out to leave us with;

(x - 7)/(x -5)

Read more about Algebraic expressions at; https://brainly.com/question/4344214

#SPJ2

What is the slope of the line y = 3?

Answers

The slope of a line y = any constant real number is 0.
 
This is because the equation y = a number represents a straight horizontal line on a graph.

find the center and radius of the circle (x+8)^2+(y-2)^2=25

Answers

The circle equation is in the format: (x – h)^2 + (y – k)^2 = r^2
The center is at the point (h,k) and the radius is r

In the equation (x+8)^2+(y-2)^2=25,

Center = (-8, 2)
Radius = 5

Hope this helps. :)

hey can you please help me posted picture of question

Answers

The points in the graph that will intersecr in the x axis would be 0. It has no points since it just involves a y axis line and ita pointa do not pass in the x axis. So the best and most correct answer is B. 0.
The nature of roots can help us to determine the answer to this question and discriminant can be used to determine the nature of the roots.

Discriminant = b² - 4ac

b = coefficient of x term = -9
a = coefficient of squared term = 4
c = constant term = 9

So, Discriminant = 81 - 4(4)(9) = -63

Since, the discriminant is negative, the equation will have complex zeros.This means its graph will not cross x-axis at any point.

So, the answer to this question is zero, option B

Q # 15 please solve

Answers

The give line is a horizontal line, i.e. parallel to x-axis.

The slope of a parallel line is always 0, and the equation of the horizontal line can be expressed as:

y = c

where c is the x-intercept.

So 2nd option is the correct answer

A Fermi estimate is an estimate of a very large number found by using geometry to estimate measurements of a real-world objects

True
or
False

Answers

False. A Fermi estimate doesn't rely on geometry. It's a method for approximating large numbers using basic assumptions and math.

False. A Fermi estimate is not reliant on geometry to estimate measurements of real-world objects.

Instead, it's a method for making quick, rough approximations of quantities or numbers, especially when precise data is unavailable or impractical to obtain. Named after physicist Enrico Fermi, this approach involves breaking down complex problems into simpler components, making reasonable assumptions, and using basic mathematics to arrive at an estimate.

While geometry might be employed in some cases, Fermi estimates primarily focus on leveraging broad understanding and educated guesses to reach ballpark figures rather than precise calculations based on specific measurements.

Nina wants to put color tiles on a square three color tiles fit across the top of the square how many rows and Columns of the squares will Nina need how many color tiles will she use in all

Answers

Nina will need 3 columns,3 rows and she will use 9 squares in all. 
Hope that helped

describe how a company that produce earphones can design a survey

Answers

First of all this survey need to be anonymous. The company need to know the population whom the survey is addressed. So, I think the following questions can be a good example:

1. Where do you usually use earphones? (Please select all that apply)

library 
home
transportation
kitchen
driving/riding
Other

2. What are the purposes you use earphones? (Please select all that apply)  learn language
listen to music
watch video
privacy concerns(show ‘don’t bother me’)
for beauty
Other

3. What kind of earphones you like the most?
 
circumaural
supra-aural
earbuds
in-ear 

4. What are the reasons make you like the earphone you chose in question 3? (Please select all that apply)
 
appearance
comfortability
function(plays music well) 
brand 
price 
portability 
Other

5. Have you ever felt vulnerable or unsafe while wearing headphones and listening to music because you are not as aware of your surroundings?
 
yes 
no
Other Questions
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure Summarize the narrative Churchill present Read this timeline:1975: federal election commission (fec) is established2002: bipartisan campaign reform act (bcra) is passed2010: citizens united v. fec is decidedwhat process do the events in the timeline reflect? Read this newspaper headline: Congressman Pushes Immigration Agenda Which change to the wording of this headline would make it more neutral without changing the overall meaning? A.Congressman Opposes Immigration Agenda B.Congressman Forces Immigration Agenda C.Congressman Advances Immigration Agenda D.Congressman Retracts Immigration Agenda Simon, come and clean up this mess at once for you(be)in trouble How did thomas jefferson purchase expand the president's power? The rectangle shown has a perimeter of 62 cm and the given area. its length is 4 more than twice its width. write and solve a system of equations to find the dimensions of the rectangle. What is the most effective way to reduce body fat? Why isn't a scale the best judge of body fat versus lean mass? Seawater has a ph of 8.1. what is the concentration of oh?