how can asking questions of their doctors help cope with their autoimmune disease?

Answers

Answer 1
Communication with your doctor is very important when dealing with auto immune disease. Your doctor can give you coping skills and tips on how to manage your disease.

Related Questions

Why is it important for the mass of turmeric used in the extraction to be no less than 1.0 g?

Answers

Curcumin is one of several curcuminoids, which are polyphonic compounds, present in turmeric. Turmeric contains approximately 2 percent curcumin by weight, so it is important for the mass of turmeric used in the extraction.
Final answer:

Using at least 1.0 g of turmeric in the extraction process ensures that there is enough substance for the solvent to react with, leading to a higher yield. Using less could decrease the yield and lead to inaccurate results.

Explanation:

The importance of using no less than 1.0 g of turmeric in the extraction process relates to how the procedure is designed. In order to effectively extract the curcumin from the turmeric, a minimum amount of the substance is required. When less than 1.0 g is used, the yield of the extraction process can decrease, since there may be insufficient material for the solvent to fully react with. This in turn could lead to unreliable or inaccurate results in subsequent uses of the extracted curcumin such as in laboratory experiments or in the production of supplements and spices.

Learn more about turmeric extraction here:

https://brainly.com/question/1626867

#SPJ3

Why does a pregnat women need to empty her bladder more often as she gets closer to her deliver date?

Answers

A pregnant woman has to empty her bladder frequently when she is close to delivery because of the fetus growing larger and pushing on the bladder.

Researchers have given children either psychostimulant drugs or placebo for attention-deficit/hyperactivity disorder. They are interested in how the mothers will react to their children. What do they find?

Answers

The used of psychostimulant drugs or placebo with children having attention-deficit/hyperactivity disorder are considered effective as a first-line treatment for this condition. Researchers have notice that the mothers are less negative and less controlling when their children are on these medications. 

In addition, ADHD is a common childhood disorder that is considered with a cognitive and behavioral syndrome characterized by varying levels and expressions of deficits in attention and problem-solving, along with hyperactivity and impulsiveness.

 

Using electrical tools or small appliances while you hands are wet could cause you to get

Answers

electrocuted obvious hope it helps 
zapped. You could die due to wet and electric. you could get electrocuted. Please dont try. lol

If you were studying the portion of the small intestines which receives food

Answers

the small intestine gives the nutrients of that food to the body, like vitamins

The bone marrow can store iron and other minerals?
A)True
B)False

Answers

true i think but i am more to the sure side
The answer would be true

Four-year-old Alice has a known peanut allergy. What is a proper step her childcare center can take to avoid a life-threatening emergency?

A)separate Alice so she eats alone at snack time
B)tell Alice she cannot eat any peanuts
C)explain to Alice’s parents that she may not attend childcare due to her allergy
D)read all labels and only allow snacks without peanuts within the childcare environment

Answers

D is the correct answer

A proper step that childcare center can take to avoid a life-threatening emergency is to read all labels and only allow snacks without peanuts within the childcare environment. Thus, the correct option is D.

What are the measures to avoid allergy?

An allergy is a condition in which the body's immune system reacts abnormally to a foreign substance which are known as allergens, causing inflammation and other reactions.

Allergies can occur at the same time every year and last as long as the allergen is present in the air such as pollen. Allergy causes itching of the nose and eyes along with other nasal symptoms.

The best way to prevent an allergic reaction or a life-threatening emergency is to avoid peanuts and peanut products altogether. But peanuts are the common food ingredients and despite all the efforts we can come in contact with it. So, to manage this it is advised to read all labels and only allow snacks without peanuts within the childcare environment.

Therefore, the correct option is D.

Learn more about Allergy here:

https://brainly.com/question/12893949

#SPJ2

an athlete is injured on the field. his teammates see that The injury is moderately swollen and the earthly reports that the areas numb what is the first thing that his teammates to do

Answers

They would call there coaches and then the coaches would then call the closest  ems at the game!

Hope this helps!    :) plz mark me as brain

Explain the effects of pulling too wide in the breast stroke in kinesiological terms. The breast stroke in swimming terms.

Answers

if you pull too wide you could start sinking and it can mess ur swimming up

Final answer:

Pulling too wide in the breaststroke can increase drag and disrupt body position, making the stroke less effective.

Explanation:

When a swimmer pulls too wide in the breaststroke, it can have several effects on their swimming technique. First, pulling too wide can increase drag, making it more difficult for the swimmer to move through the water efficiently. This can slow them down and make their strokes less effective. Second, pulling too wide can also affect the swimmer's body position in the water. A wider pull can disrupt the streamline position and cause the swimmer's hips and legs to drop, creating more resistance and making it harder to maintain a steady and efficient stroke.

one advantage of trait theory is that they allow us to

Answers

trait concept suggests a disposition to respond consistently. This involves overt behaviors.

Which of the following BEST defines contraceptive?
A.
a device used to prevent pregnancy and disease
B.
a device used to prevent pregnancy
C.
a method or device used to prevent pregnancy
D.
a device used to prevent disease

Answers

C. a method or device used to prevent pregnancy

Answer:

C. a method or device used to prevent pregnancy

Explanation:

Contraceptives are methods and tools used by people who have an active sex life and want to avoid pregnancy. There are various types of contraceptive methods and devices available on the market, such as male condoms, female condoms, intrauterine IUDs, injectable hormonal contraception, oral hormonal contraception (birth control pills), implants, spermicide, periodic abstinence, surgical contraception, contraception emergency services, among others.

Decreasing the amount of drugs that are carried across U.S. boarder is an example of

Answers

Interdiction is a way of decreasing the amount of drugs carried across US border by using foreign crop eradication measures and stipulating an agreement controlling addictive drugs and alcoholic beverages. Another way is by implementing stiff penalties for drug traffickers and drug abusers.

 

John is jogging on a winter day. The outdoors temperature is 31 degrees F. Yet, his body temperature is 98 degrees F. What term best describes the process causing this difference in temperature?
homeostasis
pathophysiology
fever
hyperthyroidism

Answers

Answer:

Homeostasis

Explanation:

HELP ME PLEASE!!

What team would be serving in a tennis match where the score was 40-30.


A) The serving team with a score of 40

B) The serving team with a score of 30

C) No one as the game is over

D) Either team could be serving

Answers

A) the serving team with a score of 40
A)The serving team with a score of 40 because the serving team's score is said first in tennis.

Warning signs of suicide are much different than those of depression t/f

Answers

False, because depression leads to suicide in some cases.

Which health benefit occurs immediately after a person quits using tobacco?
breathing becomes easier


cilia regain normal function


blood pressure falls


circulation improves

Answers

C. Blood pressure falls.

Immediately upon quitting tobacco, blood pressure lowers and the heart rate returns to normal

Answer:

blood pressure falls

Explanation:

Smoking is bad for anyone, hypertensive or not. And quitting addiction requires effort and commitment. Now, if the person already lives with high blood pressure, it can be said that the components of the cigarette add ingredients for a true time bomb to install in the cardiovascular system. Smoking causes blood pressure to increase, but as soon as a person decides to quit, blood pressure automatically drops and reaches healthy and safe levels.

type 1 diabetes is caused by a muted gene
A. True
B. False

Answers

That statement is "false" since the cause is still sort of unknown. Scientists are still working on figuring out why the immune system incorrectly damages and destroys the insulin-producing beta cells from the pancreas, which is how the type 1 diabetes is developed. However, muted genes are surely not a cause. 

Let me know if you need further info. :)

               - Dotz
Hi,

Type 1 diabetes is caused by a muted gene

B. False

 Diabetes Mellitus Type 1 is a type of metabolic disorder that results from the bodies inability to produce insulin causing a disorder where patients are insulin dependent. They require insulin or the bodies will be unable to process sugars for energy.

Which nutritional class absorbs vitamins and sustains the immune system?

Answers

Answer:

fats

Explanation:

Despite what you think, the body can not be without fat. Fat is seen as one of the greatest enemies of our health. In fact, this substance has its importance for the proper functioning of the body as long as it is consumed in the right amount. Fat is a source of energy for the body and also fulfills other functions such as participating in cell building, maintaining body temperature, protect vital organs, absorb and transport vitamins and make up the enzymes, hormones and substances that help the immune system.

Final answer:

The nutritional class that absorbs vitamins and sustains the immune system is lipids.

Explanation:

The nutritional class that absorbs vitamins and sustains the immune system is lipids.

Lipids are a class of nutrients that include fats and oils. They play an important role in the absorption of vitamins, including vitamin D, which is essential for immune system function.

When dietary lipids are consumed, they aid in the absorption of vitamins from food. This is because vitamins A, B, C, D, E, and K are lipid-soluble, meaning they can dissolve in fat. Lipids help transport these vitamins to the cells, where they can be used to support various bodily functions, including immune system health.

Learn more about Lipids here:

https://brainly.com/question/33447977

#SPJ11

can you please help me! thanks you:)

Answers

the answer is a-cognitive
The psychodynamic perspective is especially interested in how we take in, process, store, and retrieve information. This helps people store information from different sources and that their minds will store these information and use these when needed.

Colin has been on bed rest for many months. Due to this situation, he has not had much physical movement and starts to feel weakness in his muscles. What is Colin’s diagnosis? sprain fibromyalgia atrophy muscular dystrophy

Answers

Muscular Dystrophy, I believe. 

Answer:

Muscular Dystrophy

Explanation:

Muscular dystrophies are a group of more than 30 genetic diseases, many of them linked to the X chromosome, which primarily affect the muscles and cause their progressive degeneration. The result of these diseases is serious muscle weakness and great movement difficulty, which can often cause respiratory and cardiac muscle impairment.

These diseases are usually treated with corticosteroids. The use of corticosteroids (prednisone and deflazocort) slightly strengthens muscle strength and respiratory function. The hope, however, lies in gene therapy, perhaps the only possible and effective treatment for healing muscular dystrophies that, in severe and congenital forms, prevent the child from living long.

What are the characteristics of a flash flood

Answers

Flash floods are sometimes called upstream floods.

Flash floods occur due to heavy rain or snowfall in certain areas. Some of the characteristics of Flash floods  are mentioned below:

Flash floods occur in small areas.Flash floods occur in a short time.Flash floods are most likely to be caused by thunderstorms, heavy rains etc.Flash floods occur when a dam or Levee is broken.One example of a Flash flood is Big Thompson Canyon in Colorado.

As flash floods are threatening to human's life, we need to follow some safety rules to save ourselves. We need to immediately move to a higher ground and wait for the emergency information passed by the media. We should follow each and every instruction given by the authorities.

Know more about Flash floods at,

https://brainly.com/question/28910320

__________ are one of the deadliest types of intersections.

Answers

The answer is railroad crossings. I got it wrong from the person below or above.

Give me brainliest answer :)

Unsignalized intersections are one of the deadliest types of intersections.

What is Unsignalized intersections?

Unsignalized intersections" refer to intersections where there are no traffic signals or stop signs to regulate the flow of traffic. These intersections can pose significant risks and are considered to be among the deadliest types of intersections.

The absence of traffic control devices means that vehicles must rely on visual cues and right-of-way rules, increasing the potential for collisions and conflicts between vehicles, pedestrians, and cyclists. Without the clear guidance provided by traffic signals, drivers may make incorrect assumptions about the actions of others, leading to accidents.

It is crucial for drivers, pedestrians, and cyclists to exercise caution, practice defensive driving, and follow the appropriate right-of-way rules when approaching unsignalized intersections to mitigate the associated risks.

Learn more about Unsignalised Intersections, here:

https://brainly.com/question/31014853

#SPJ2

Courtney is enrolled in an advanced physics class at her high school. She is one of only three girls in the class, and she is aware of the notion that girls are poorer at math and science than boys. This knowledge may actually hinder Courtney's performance in the class as a result of:

Answers

Answer: Stereotype threat

A stereotype threat is a social-psychological predicament that can alters academic identity and intellectual performance. Negative stereotypes raise inhibiting doubts and high-pressure anxieties in a test-taker's mind that result to reduce the performance of individuals.

The mind set of Courtney that boys do better than girls in math and science would create anxiety, which will then trigger a mechanism of decreases performance by depleting the working memory of the brain.

i think the answer is sterotype threat

What is a definite sign of overtraining

Answers

Answer:

Declining athletic performance

Explanation:

Apex

The definite sign of overtraining is Declining athletic performance

What is  overtraining?

When an athlete doesn't effectively recuperate from repeated, hard exercise, overtraining syndrome develops. This condition can lead to tiredness, deteriorating performance, and even injury. To train assiduously in order to excel in your chosen sport is admirable.

An athlete who experiences burnout, also known as overtraining syndrome, has diminished athletic performance despite continued or escalating training. Infections, diminished motivation, mood swings, and repeated injuries are all side effects of overtraining. Overtraining syndrome is uncommon, although it is much more likely to affect female athletes, young elite athletes, and athletes who play solitary sports.

Learn more about overtraining at

https://brainly.com/question/16991162

#SPJ6

In general one cup of milk or yogurt 1 and a 1/2 ounces of natural cheese or 2 oz of processed cheese can be considered as 1 cup from the milk group

Answers

Final Answer:

In general, the equivalence of one cup of milk or yogurt, 1 and a 1/2 ounces of natural cheese, or 2 ounces of processed cheese can be considered as 1 cup from the milk group.

Explanation:

This statement reflects the standard serving size equivalencies within the milk group, a key component of dietary guidelines. The recommended daily intake of dairy is crucial for meeting essential nutrient requirements, such as calcium and vitamin D.

By providing these specific measurements, individuals can easily visualize and incorporate the recommended servings from the milk group into their daily diet. This approach simplifies dietary planning and helps ensure a balanced and nutritious intake.

In terms of calculations, the statement emphasizes the importance of recognizing different forms of dairy and their respective serving sizes. The conversion factors provided (1 cup of milk or yogurt, 1 and a 1/2 ounces of natural cheese, or 2 ounces of processed cheese) allow for flexibility in dietary choices while ensuring an equivalent intake from the milk group.

This flexibility accommodates various dietary preferences and helps individuals personalize their nutrition while still adhering to the recommended daily servings.

When the reception is not sure if the patient should be seen that day they would transfer the call to the _ area.

Answers

If the reception is not sure if the patient would be seen on that day he or she may transfer it to the holding area as for the patient to be able to wait and the reception can get back to him or her after checking the doctor's appointment schedule.

Which sentence is true about preconception care

A)women who are thinking about having a child should not worry about preconception care as it is unnecessary. Preconception care is health care you receive after you get pregnant.

B)it is aimed at finding and taking care of problems that could affect you or the baby during pregnancy and steps to reduce birth defects.

C)it will involve taking medication and strict diet and exercise plan.

Answers

B) It is aimed at finding and taking care of problems that could affect you or the baby during pregnancy and steps to reduce birth defects.

Answer:

B.

Explanation:

I got it right on pluto test

What does the Animation Editor let you do?
A.
Create actions and conditions
B.
Change the file extension of an MMF2 file
C.
Make changes to parts of an Active object
D.
See a close up view of a frame

Answers

B is right hope its help

which situation describes risk factors for depression? check all the apply

Answers

Both biological and pyschosocial behaviors  play a role in this risk factors, along with PTSD and /or Trauma.

Answer:

Feeling isolated from people at school

Explanation:

Yolanda is reviewing a medical record for a patient who is receiving psychotherapy. As a part of her training in medical record confidentiality, she is aware that there are special guidelines regarding psychotherapy notes. Which of the following statements is true of these guidelines?

A. Psychotherapy notes can never be disclosed to the patient.

B. Except when used for data aggregation, psychotherapy notes can't be used without the health care provider's authorization.

C. Except when used by the originator of the psychotherapy notes, they can't be used without the individual's authorization.

D. Psychotherapy notes can never be disclosed, even for health care operations.

Answers

The correct answer is C. Except when used by the originator of the psychotherapy notes, they can't be used without the individual's authorization
Confidentiality is an essential requirement of psychotherapy. in addition, although patients share personal feelings and thoughts, intimate physical contact or relation with a therapist is never appropriate, acceptable, or useful.

The most accurate statement regarding the guidelines for psychotherapy notes under HIPAA is that, with certain exceptions, they cannot be used without the patient's authorization, except when used by the originator of the notes. Thus, the correct statement to the student's question is option (C).

Within the context of medical record confidentiality, special guidelines exist for the handling of psychotherapy notes. According to the Health Insurance Portability and Accountability Act (HIPAA), psychotherapy notes are given more protection than other types of health information. The correct statement concerning these guidelines is:

C. Except when used by the originator of the psychotherapy notes, they can't be used without the individual's authorization.

This implies that the psychotherapy notes are subject to additional protections beyond the typical health information. The notes can generally be disclosed for treatment, payment, and health care operations, but with the consent of the patient, unless an exception such as a court order applies. Furthermore, psychotherapy notes cannot be disclosed without explicit authorization from the patient, except for specific purposes including certain legal actions, oversight of the therapist, and serious threats to health or safety, among others.

Other Questions
In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure Summarize the narrative Churchill present Read this timeline:1975: federal election commission (fec) is established2002: bipartisan campaign reform act (bcra) is passed2010: citizens united v. fec is decidedwhat process do the events in the timeline reflect? Read this newspaper headline: Congressman Pushes Immigration Agenda Which change to the wording of this headline would make it more neutral without changing the overall meaning? A.Congressman Opposes Immigration Agenda B.Congressman Forces Immigration Agenda C.Congressman Advances Immigration Agenda D.Congressman Retracts Immigration Agenda Simon, come and clean up this mess at once for you(be)in trouble How did thomas jefferson purchase expand the president's power? The rectangle shown has a perimeter of 62 cm and the given area. its length is 4 more than twice its width. write and solve a system of equations to find the dimensions of the rectangle. What is the most effective way to reduce body fat? Why isn't a scale the best judge of body fat versus lean mass?