In a class of 18 children, 13 have pet dogs at home, 11 have pet cats, and 8 have both. How many kids do not have four-legged pets at home?

Answers

Answer 1

Answer:

2 people

Step-by-step explanation:

8 have both that means that of the 11 people that have cats 3 have only cats and of the 13 that have dogs 5 only have dogs therefore 2 people don't have four-legged animals at home

Answer 2

Answer:

2

Step-by-step explanation:

it starts out with 18 students, 24 pets in total. -16 for the dogs and cats, to lead up to 8, and 10 students left after subtracting 8 for how many students don't have a pet at home. So 2 students shouldn't have four legged pets left after subtracting the rest.  (this is my answer, it's probably wrong, i think you should wait for more,)


Related Questions

What is the approximate area of the figure below?

Answers

YOUR ANSWER IS IN THE ATTACHMENT PLZZ REFER TO THE ATTACHMENT MARK ME BRAINLIEST AND FOLLOW ME

6.1712 rounded to the nearest tenth

Answers

Answer:

6.2

Step-by-step explanation:

Answer:

the answer is 6.2

what is 14991.1 rounded to the nearest hundredth

Answers

Answer:

15000.0

Step-by-step explanation:

Answer:

Step 1:  Round to the nearest hundredth

It is already rounded to the tenth so rounded to the hundredth would just add a 0.

14991.10

Answer:  14991.10

If you meant hundreds:

14991.10

Since the tens place is greater or equal to 5, you round up the hundreds place.  This will make the thousands place go up by one.

14991.10

15000

Kishuana rode her bike for 35 minutes each on Monday, Wednesday, and Saturday and 55 minutes each on Tuesday and Thursday. Write an expression that shows the total amount of time she spent riding her bike. Then evaluate the expression.
order of operations

Answers

Answer:

35a+55b=c

35x3=105

55x2=110

105+110=215

c=215

she rode her bike for 215 mins= 3 hours and 58 mins

Step-by-step explanation:

Does 10.5, 36, 50 form a right triangle

Answers

Answer:

No because if you are looking for a right triangle its sums have to equal to 90 degrees

Step-by-step explanation:

for example:side a; 30 inches

side B;30 in

c;30 that equals 90 so that is a right triangle

Answer:

No, it is not a right triangle.

Step-by-step explanation:

10.5, 36, and 50 do not form a right triangle.  This can be tested using the Pythagorean theorem.  

10.5^2=110.25

36^2= 1296

50^2=2500

If this was a right triangle, the 10.5 squared and 36 squared would have to equal 50 squared.  

Which is the correct answer for the question below

Answers

Answer:

C

Step-by-step explanation:

Answer:

C

Step-by-step explanation:

it is the only net that has 6 squares, and 6 squares make a cube.

If the population standard deviation is o=10, how large a sample is necessary to have a standard error that is less than 5 points?

Answers

Final answer:

To have a standard error less than 5 points, the necessary sample size must be greater than 4. The minimum sample size required is 5.

Explanation:

To calculate the sample size required, we need to use the formula for standard error:

SE = σ/√n

In this case, we want the standard error to be less than 5 points, so we have the inequality:

5 > σ/√n

Multiplying both sides by √n, we get:

5√n > σ

Since we know that the population standard deviation (σ) is 10, we can substitute that value into the inequality:

5√n > 10

Dividing both sides by 5:

√n > 2

Squaring both sides of the inequality:

n > 4

So, the sample size must be greater than 4. However, since sample size is typically an integer value, we round up to the nearest whole number. Therefore, the minimum sample size required is 5

Final answer:

To achieve a standard error of less than 5 with a population standard deviation of 10, a sample size of at least 5 is required.

Explanation:

The question deals with determining the sample size necessary for a specified standard error when the population standard deviation is known.

To find the sample size (n) necessary for a standard error of less than 5, when the population standard deviation (σ) is 10, we use the formula for the standard error of the sample mean, which is σ/sqrt(n).

To want the standard error to be less than 5, set up the inequality 10/sqrt(n) < 5, which simplifies to sqrt(n) > 2.

Solving for n, we square both sides to obtain n > 4.

Thus, we need a sample size greater than 4.

However, as sqrt(4) equals 2, the next whole number that provides a standard error less than 5 is 5.

Therefore, a sample size of at least 5 is needed.

Please help me I am horrible at calculations
Solve for x when y=-0.27

5y+8(x−3y)=7x−12

Answers

Answer:

X = -12.54 (I am a Math Class Topper in both 6th Grade an 7th Grade)

Step-by-step explanation:

5 x .27 = 1.35

8x - (3 x .27) = .81

1.35 + 8x - .81 = 7x - 12

        - 7x           - 7x

----------------------------------

1.35 + X - .81 = -12

              + .81 +.81

---------------------------

1.35 + X = -11.19

-1.35         -1.35

-----------------------

X = -12.54

What would be the price per year for equation p(t)=1200(1.037)^t

Answers

i’m pretty sure it would be 1,244.40 per year. you would do 1200 x 1.037 = 1244.40 x1 = 1244.40. :)

The dot plot below shows the number of books 26 students read in a month:

Dot plot labeled Number of Books Read shows 10 dots over 0, 7 dots over 1, 3 dots over 2, 2 dots over 3, 1 dot over 4, and 3 dots over 10.

Is the median or the mean a better center for this data, and why?

Mean; because the data is skewed and there are outliers

Mean; because the data is symmetric and there are outliers

Median; because the data is skewed and there are outliers

Median; because the data is symmetric and there are outliers

Answers

The answer is

C. Median; because the data is skewed and there are outliers

100% Verified!

Hope This Helps!:)

WILL GIVE BRAINLIEST!!!
x + 2y = 10
3x + 4y = 8
Which point is the solution to the system of equations?
A) (7, 1.5)
B) (11,-12)
C) (-11, -12)
D) (-12, 11)

Answers

I think the answer will be A

Another couple of probability questions, I will give 20 points for 2 questions! I will also mark brainliest to whoever answers CORRECTLY!!! Plz help!

Answers

Answer:

1. [tex]\frac{5}{162}[/tex]

2. [tex]\frac{3}{8}[/tex]

Step-by-step explanation:

For the first problem, the probability of spinning an odd number is [tex]\frac{5}{9}[/tex]. The probability of landing on heads is [tex]\frac{1}{2}[/tex], and then the probability of landing on a 3 is [tex]\frac{1}{9}[/tex]. Multiplying all of these together, you get [tex]\frac{5}{162}[/tex]. For the second problem, the probability of spinning a number greater than one is [tex]\frac{3}{4}[/tex], and the probability of landing on tails is [tex]\frac{1}{2}[/tex]. Multiplying these together, you get [tex]\frac{3}{8}[/tex]. Hope this helps!

1. Evaluate x2 + 3x for x = 8

Answers

Step-by-step explanation:

Putting value of x

(8)2 + 3(8)

64 + 24

= 88

Answer:

The answer is 88

Step-by-step explanation:

since x=8

x^2= 64

3x=3×8

=24

x^2+3x= 64+24

=88

4(x-2)=3(x-3) what is the answer

Answers

The answer is -1

Step-by-step explanation:

PLEASE I NEED HELP WITH THIS!!!!​

Answers

Answer:

oh yeah thats the 3rd one

Step-by-step explanation:

An animal shelter spends $2.00 per day to care for each bird and $5.00 per day to care for each cat. Gabriel noticed that the shelter spent $44.00 caring for birds and cats on Friday. Gabriel found a record showing that there were a total of 13 birds and cats on Friday. How many birds were at the shelter on Friday?

Answers

Answer:

7 birds

Step-by-step explanation:

Let b = number of birds

c = number of cats

We know there were 13 birds and cats

b+c =13

It is $2 per bird and $5 per cat for a total of $44

2b+5c =44

 Solve b+c =13 for c by subtracting b from each side

c = 13-b

Now we can substitute this into the second equation

2b+5c =44

2b + 5(13-b) =44

Now distribute

2b+65 -5b = 44

Combine like terms

-3b +65 =44

Subtract 65 from each side

-3b +65-65 =44-65

-3b = -21

Divide each side by -3

-3b/-3 = -21/-3

b=7

There were 7 birds

We could also find the number of cats

c =13-7

c =6

Answer:

7 birds

Step-by-step explanation:

No. of birds: x

No. of cats: y

2x + 5y = 44

x + y = 13

x = 13 - y

2(13 - y) + 5y = 44

26 - 2y + 5y = 44

3y = 18

y = 6

x = 13 - 6

x = 7

Leave your answer in terms of pi. Find the circumference.

Answers

Answer:

[tex]2\pi \: r \\ 2 \times \pi \times 7 \\ = 14\pi[/tex]

Lynn put 3 7/8 gallons of gas in her gas tank. if there are now 18 1/6 gallons in the tank, how many gallons did she start with?? Please I need an answer ASAP worth 25 points!!!!

Answers

She started with 17/8 gallons.

Lynn starts with 14.3 gallons in her gas tank.

What is the Subtraction operation?

Subtraction is a mathematical operation that deducts the right-hand operand from the left-hand operand.

for example 4 -2 = 2

She put 3 7/8 gallons of gas in her gas tank. if there are now 18 1/6 gallons in the tank.

We have to determine the number of gallons did she start with

As per the given question, the required evaluation would be as:

Initial gallons = current gallons - put gallons

Initial gallons = 18 1/6 - 3 7/8

Convert the improper fractions into decimals,

Initial gallons = 18.167 - 3.875

Apply the subtraction operation, and we get

Initial gallons = 14.292 ≈ 14.3

Therefore, she starts with 14.3 gallons in her gas tank.

Learn more about Subtraction operations here:

brainly.com/question/25834626

#SPJ5

Please help! I will mark you as brainliest!

Answers

Answer:

[tex]\frac{2}{3}[/tex]

Step-by-step explanation:

Sum the frequency column to find the total number of students

total = 2 + 9 + 5 + 5 + 3 = 24

number of students finished in less than 20 mins = 2 + 9 + 5 = 16

fraction of students = [tex]\frac{16}{24}[/tex] = [tex]\frac{2}{3}[/tex]

Solve for x using the Master Product.
6x2 – 13x – 5 = 0

Answers

Final answer:

The quadratic equation 6x2 – 13x – 5 = 0 is solved using the Master Product method by factoring and solving for 'x' to get the solutions x = -1/3 and x = 5/2.

Explanation:

To solve the quadratic equation 6x2 – 13x – 5 = 0 using the Master Product, we'll first look at the coefficients of the quadratic, which are 6, -13, and -5. The Master Product method involves finding two numbers that multiply to the product of the coefficient of x2 (which is 6) and the constant term (which is -5), and add up to the coefficient of x (which is -13). The product of 6 and -5 is -30, and we're looking for two numbers that multiply to -30 and add up to -13.

These numbers are -15 and 2 because (-15) * 2 = -30 and (-15) + 2 = -13. We can use these numbers to split the middle term, -13x, into -15x and 2x, and rewrite the quadratic equation as 6x2 - 15x + 2x - 5 = 0. Grouping the terms in pairs and factoring by grouping gives us (3x)(2x - 5) + 1(2x - 5) = 0. Factoring out the common binomial (2x - 5), we get (3x + 1)(2x - 5) = 0. Setting each factor equal to zero, we can solve for x: 3x + 1 = 0 or 2x - 5 = 0, which gives us x = -1/3 or x = 5/2.

PleaSe answer this question fast all inappropriate answers will be deleted and no points will be given and the best will be marked brainliest. have a good day :)

Answers

Answer:

OC = 16.7 cm

OAB = 332.9 cm² (1d.p)

OABD = 589.9 cm²(1d.p)

ABD = 257.1 cm²

Step-by-step explanation:

It is given that OC is 90° perpendicular to the line AB. In order to find OC, you can use Trigonmoetric formula, cosθ = adj./hypo. :

cosθ = adj./hypo.

adj. = OC cm

hypo. = 26 cm

θ = 100° ÷ 2

= 50°

cos 50 = OC/26

OC = 26 cos 50

= 16.7 cm (1d.p)

Next, is to find the area of triangle OAB using A = (1/2)×a×b×sinc :

a = 26 cm

b = 26 cm

c = 100°

A = (1/2)×26×26×sin 100

=332.87 cm² (2d.p)

Then, find the area of sector OABD using A = (θ/360)×π×r² :

θ = 100°

r = 26 cm

A = (100/360)×π×26²

= 589.92 cm² (2d.p)

Lastly, to find the area of segment ABD, you can to substract the area of triangle from the area of sector :

A = 589.92 - 332.87

= 257.1 cm² (1d.p)

What are these numbers rounded to the nearest hundreds plz. Help

Answers

Answer:

1. 425,300

2. 105,000

3. 45,500

4. 35,500

5. 212.37


an equation for the line that has a slope of 1/2 and passes through the point (-2,5)

Answers

Answer:

[tex]y = 1/2x + 6[/tex]

Step-by-step explanation:

Step 1:  Find the equation

[tex](y - y_1) = m(x - x_1)[/tex]

[tex](y - (5)) = 1/2(x - (-2))[/tex]

[tex]y - 5 = 1/2(x + 2)[/tex]

[tex]y - 5 + 5 = 1/2x + 1 + 5[/tex]

[tex]y = 1/2x + 6[/tex]

Answer:  [tex]y = 1/2x + 6[/tex]

The triangles are congruent by SSS or HL

Which transformation(s) can map MNQ onto PQN


Translation only

Reflection only

Rotation, then reflection

Rotation, then translation

Answers

Answer:

Rotation, then translation

Step-by-step explanation:

At first, the triangle MNQ rotates around the point center Q 180° counter clockwise without change the distance among the three points so it does change the shape the the object.

Then,  we apply translation towards right so that it will became ΔPQN without resizing or rotating the object.

Hence,  transformation(s) can map MNQ onto PQN are Rotation, then translation

5x - y - 4z = -16
x + 3y+ z= 5
2x+ 4y - 3z= 1

Answers

Answer:

Step-by-step explanation:

hello :

look this solution :

The segments represent roads in a town, measured in miles. Theo drove from the post office to the grocery store. How many miles did he travel?

Answers

Answer:

16 miles

Step-by-step explanation:

The graph is counting by 2, and there are 8 spaces between the Grocery store and the post office.  8(2) = 16

Answer: 16

Step-by-step explanation:

(I need help) Diameter is 32.8ft how do you do the Radius,Area,Circumference?

Answers

Radius = 16.4
Area = 844.96
Circumference: 103.04

Answer:

well the diameter is half of the circle so radius is half of that

the formula for that is 3.14*r

so your answer should be 50.025

Can someone help me with this hint it’s not c but someone plz help me I don’t get it

Answers

Answer: 27

Step-by-step explanation:

A cylinder has a radius of 9 inches and a height of 7 inches. What is it he volume of this cylinder

Answers

Answer:

1808.64

Step-by-step explanation:

Estimate the perimeter of the figure to the nearest whole number.

Answers

Final answer:

To estimate the perimeter, we use the given information of the width of the rectangle, which is 1.25 cm. Assuming the lengths are similar, we estimate them to be 1.25 cm as well. Using these measurements, we calculate the perimeter of the figure to be approximately 5 cm.

Explanation:

To estimate the perimeter of the figure, we need to determine the measurements. The given information states that the rectangle is at least 1.0 cm wide but not 2.0 cm wide. Using the tick marks on the ruler, we can estimate the width to be 1.25 cm. Since the perimeter of a rectangle is the sum of all its sides, we find the perimeter by multiplying the width by 2 and adding it to the sum of the two lengths. However, we don't have information about the lengths, so we can't find the exact perimeter, but we can estimate it based on the width. Assuming the lengths are similar, we can use the estimated width of 1.25 cm to estimate the lengths as well.



To estimate the lengths, we can assume that each length is greater than the width. Let's assume the lengths are also 1.25 cm. The perimeter can then be estimated by multiplying the width by 2 and adding it to the sum of the two lengths: (1.25 cm * 2) + (1.25 cm + 1.25 cm) = 2.5 cm + 2.5 cm = 5 cm. Therefore, we estimate the perimeter of the figure to be approximately 5 cm.

The estimated perimeter of the pentagon is 19 units.

To estimate the perimeter of the given pentagon, we need to find the length of each side and add them together. The pentagon has a base of four units and the other sides are three units each.

To find the perimeter, we add the lengths of all the sides. In this case, the base has a length of four units, and there are five sides of three units each.

Calculating the perimeter:
4 + 3 + 3 + 3 + 3 + 3 = 19 units

Therefore, the estimated perimeter of the pentagon is 19 units.

Other Questions
This group was formed in the Georgia General Assembly in 1960 for the purpose of gathering public reaction to Federal orders to integrate public schools within the state. From the Khan Academy Video on Impact of Media Evolution on Politics (Slide #2), what example of early newspapers influenced the ratification (passing) of our US Constitution? (Hint: we learned this earlier in the yearwhat group believed in a Strong Central Government?) What are the three domains of life?Plantae, Animalia, and Fungiclass, kingdom, and phylumEubacteria, family, and EukaryaBacteria, Archaea, and Eukarya 5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4