In right ABC, B is a right angle and sin C = x. sin A =
x^2-1
1-x^2
x
x^2+1
x^2

Answers

Answer 1

Answer:

x

Step-by-step explanation:

de nada

Answer 2

Sin A= 1-x² is the correct answer.

What is the Pythagoras theorem?

Pythagorean theorem, the well-known geometric theorem that the sum of the squares on the legs of a right triangle is equal to the square on the hypotenuse (the side opposite the right angle)—or, in familiar algebraic notation, a² + b² = c².

Given here, Sin C = x/1 and therefore Hypotenuse = 1 and perpendicular =x

thus Base=1-x² by phytogaraen theorem.

Thus Sin A=1-x² /1

Hence, Sin A= 1-x² is the correct answer.

Learn more about  Pythagoras theorem here:

https://brainly.com/question/343682

#SPJ2


Related Questions

!!!!!HURRY!!!!!!
Bethany used the steps below in an attempt to solve for angle B in triangle ABC.


Where is bethanys error?

Answers

The measure of angle B in triangle ABC is 63.9°. Hence, Bethany has done a mistake in step 2.

Given that, in the triangle ABC, AC=4.1 cm, AB=4.5 cm and BC=2.7 cm.

We need to find the measure of angle B.

What is the trigonometric function to find the angle in the triangle?

The trigonometric function to find the angle in the triangle is b²=a²+c²-2ac cosB.

Now, (4.1)²=(4.5)²+(2.7)²-2×4.5×2.7 cosB.

⇒16.81=20.25+7.29-24.3 cosB

⇒16.81-27.54=-24.3 cos B

⇒cos B=0.44

B=63.9°

The measure of angle B in triangle ABC is 63.9°. Hence, Bethany has done a mistake in step 2.

To learn more about the angles of a triangle visit:

https://brainly.com/question/27682397.

#SPJ2

Answer:

B. Bethany took the square root of each squared term before isolating cosB and solving for B.

Step-by-step explanation:

took the quiz

I need tynessa's coloring plzzz

Answers

Answer:

  4 +2n

Step-by-step explanation:

Tynessa has colored 4 red blocks in each figure. The number of blue blocks in each figure is the same as the figure number in both the top and bottom rows. That is, the total number of blue blocks is 2 times the figure number.

If the figure number is n, Tynessa might write the pattern rule as ...

  number of blocks = 4 + 2n

In a bag of 18
18
oranges, 12
12
have gone bad.

What is the ratio of good oranges to bad oranges?

Answers

Answer:

1 :2

Step-by-step explanation:

18 oranges

12 bad

-------

6 good

good: bad

6      :12

Divide each by 6

6/6    : 12/6

1 :2

The ratio of good oranges to bad oranges is 1:2.

To find the ratio of good oranges to bad oranges in a bag containing 18 oranges, where 12 oranges have gone bad, follow these steps:

Determine the number of good oranges:

Total oranges in the bag: 18Bad oranges: 12Good oranges: 18 - 12 = 6

Find the ratio of good oranges to bad oranges:

Good oranges: 6Bad oranges: 12

Simplify the ratio:

The ratio of good oranges to bad oranges can be written as 6:12.Simplify this by dividing both numbers by their greatest common divisor (GCD), which is 6.Simplified ratio: 6 ÷ 6 : 12 ÷ 6 = 1:2

what is one third of three sevenths equals

Answers

Answer:

0.14285714285

Hope this helps :)

Step-by-step explanation:

Answer:

.1428

Step-by-step explanation:

1/3 times 3/7= .1428

Please help meh please.

Answers

Answer:

d. 84.5

Step-by-step explanation:

You will have to put the numbers in order than cross out one from each side;

70x

80x

83      

86      

88x

88x

In doing this you have taken out B,E, and F.  The answer would have to be somewhere in between 83 and 86, which would be around 84 and 85, so therefore the answer would be 84.5

Which expression is an equivalent expression of 12x + 10 + 4y?
A. 2(6x+2y+6)
B. 3(4x + y + 10)
OC. 2(6x + 4y+8)
D.
2(6x + 5+ 2y)

Answers

Answer:

D. 2(6x + 5+ 2y)

Step-by-step explanation:

12x + 10 + 4y

Factor out a 2

2(6x+5+2y)

just factor out the 2 from the expression
12x + 10 + 4y

2(6x+5+2y)

How many different ways can 9 trumpet players in the marching band line up?

Answers

Answer:

362880 ways

Step-by-step explanation:

In this case, the order does matter therefore to know how many ways it can be aligned, we must resort to permutations.

The formula for permutations is:

P = n!

we know that there are 9 trumpet players, therefore:

P = 9!

P = 362880

So there are 362,880 ways to line up

Solve the inequality.

−4>−4/3s

The solution is ___

Answers

Answer:

3 < s

Step-by-step explanation:

−4>−4/3s

Multiply each side by -3/4 to isolate s.  Remember to flip the inequality since we are multiplying by a negative

-4 * -3/4 < -4/3s * -3/4

3 < s

The triangle on the grid will be translated two units down.
Which shows the triangle when it is translated two units down?

Answers

Answer:

c

Step-by-step explanation:

The points that show the triangle when it is translated two units down are (2, 3) (0, 1), and (2, 1).

What are transformations?

A function, f, that maps to itself are known as a transformation, or f: X- X. The pre-image X becomes the picture X following the transformation. This transformation can use any operation, or a combination of operations, including translation, rotation, reflection, and dilation. Translation, rotation, reflection, and dilation can all be used to move a function in one direction or another.

Given that the initial coordinate of triangles ABC are at points

(2, 1), (0, -1), (2, -1).

The coordinate base of the triangle must be (2, 1) and (2, -1)

When the triangle is translated two units down.

2 will be added to all its y coordinates. While the x coordinate remains the same

The new coordinate will be

(2, 2+1), (0, 2-1), (2, 2-1)

(2, 3) (0, 1) and (2, 1)

Hence the new coordinates are (2, 3) (0, 1), and (2, 1).

Learn more about transformations;

https://brainly.com/question/15200241

#SPJ5

The complete question is,

The triangle on the grid will be translated two units down. On a coordinate plane, triangle A B C has points (2, 1), (0, negative 1), (2, negative 1). Which shows the triangle when it is translated two units down

The hypotenuse of a right triangle is 10m and the length of one of the legs is 8m , find the length of the other leg of the triangle

Answers

Answer:

6 m

Step-by-step explanation:

a squared + b squared = c squared

8 squared plus ? squared = 10 squared

64 + ? = 100

100 - 64 = 36

the square root of 36 is 6

Final answer:

Using the Pythagorean theorem, the length of the other leg of the right triangle is found to be 6 meters.

Explanation:

The student is asking to find the length of the other leg of a right triangle, given the lengths of the hypotenuse (10m) and one leg (8m). To solve this problem, we use the Pythagorean theorem, which relates the lengths of the sides of a right triangle: a² + b² = c², where c is the hypotenuse and a and b are the legs of the triangle. Since the hypotenuse length (c) is 10m and one leg (a) is 8m, we can solve for the length of the other leg (b) using the equation 8² + b² = 10².

First, square the known length of one leg: 8² = 64.

Next, square the hypotenuse: 10² = 100.

Now, subtract the squared length of the known leg from the squared hypotenuse to find b²: 100 - 64 = 36.

Finally, take the square root of 36 to find b: √36 = 6m. So, the length of the other leg is 6 meters.

A sphere has a radius of 3.5 inches.

What is the volume of the sphere rounded to the nearest tenth?

Use 3.14 for pi.

Answers

Answer:

volume = 179.59

please give this the brainliest!!

Step-by-step explanation:

formula = V=4/3πr3

4/3·π·3.5^3

≈179.59438

A traveler is driving across the country and spots Gateway Arch in St. Louis, Missouri. She has read that the arch is 630 feet tall. Her angle of elevation to the top of the arch is 3º. How far away is Gateway Arch, to the nearest tenth of a mile?

Answers

Answer:

d = 12,021.1 ft

The Gateway Arch is 12,021.1 ft away

Step-by-step explanation:

Given;

Angle of elevation = 3°

Height of arch = 630 ft

Tanθ = opposite/adjacent

Opposite = 630 ft

Adjacent = d

Substituting the values;

Tan3 = 630/d

d = 630/tan3

d = 12,021.1 ft

The Gateway Arch is 12,021.1 ft away

Answer:

[tex]x = 12021.1\,ft\,(2.3\,mi)[/tex]

Step-by-step explanation:

The distance is given by the following trigonometric equation:

[tex]x = \frac{y}{\tan \alpha}[/tex]

[tex]x = \frac{630\,ft}{\tan 3^{\textdegree}}[/tex]

[tex]x = 12021.1\,ft\,(2.3\,mi)[/tex]

What is the value of h in the equation 3h-4=15+2?

Answers

Answer:

The value of h is 7.

Step-by-step explanation:

3h - 4 = 15 + 2

15 + 2 = 17

3h - 4 = 17

Add 4 to each side

3h = 21

Divide each side by 3

h = 7

Use a calculator to solve for xin the equation 2e^3x = 400. Round your answer to
three decimals.

Answers


the answer is

D. 1.766
Final answer:

To solve the equation 2e^3x = 400, we isolate e^3x and then use the natural logarithm to solve for x, which gives x ≈ 2.995 when rounded to three decimals.

Explanation:

The question asks us to solve the equation 2e^3x = 400 for the variable x. First, we isolate e^3x by dividing both sides of the equation by 2. We get: e^3x = 400/2 which is e^3x = 200. Finding x means solving for 'x' in an exponential equation, which involves using the natural logarithm.

So, our equation becomes: x = ln(200)/3. Using a calculator, x ≈ 2.995 when rounded to three decimals.

Learn more about Solving Exponential Equations#SPJ2

If r is an integer greater than 1, what is the value of (−1)r +1 if: a r is an odd integer

Answers

Answer:

The value of the given expresion is zero.

Step-by-step explanation:

I am assuming that, your exprssion is

[tex] {( - 1)}^{r} + 1[/tex]

where r is an integer greater than 1.

Let us see what a negative base 1 to an off exponent give us:

[tex] {( - 1)}^{1} =-1[/tex]

[tex] {( - 1)}^{3} =-1[/tex]

[tex] {( - 1)}^{5} =-1[/tex]

[tex] {( - 1)}^{7} =-1[/tex]

If r is odd, then

[tex] {( - 1)}^{r} = - 1[/tex]

This implies that:

[tex] {( - 1)}^{r} + 1 = - 1 + 1 = 0[/tex]

The value of the given expresion is 0.

PLS help meee i have posted this 3 othe times

Answers

Answer:

help with what

Step-by-step explanation:

Answer:

What do you want help with?

Step-by-step explanation:

Find the area of each trapezoid.

Answers

I can not see the trapezoid

- Rick has only 2 hour and 44 minutes until he needs to leave. He wants to watch a movie that goes
for 158 minutes. Does he have enough time to watch the whole movie before he has to leave?

Answers

Answer:

No he does not

Step-by-step explanation:

158 / 60 = 2.63

which is about a 3 hour long movie.

In a class of 150 students, 95 are taking Math, 75 are taking Science and 55 are taking both.What is the probability that a student is taking neither Math or science?

Answers

Answer:

[tex] \frac{7}{30} [/tex]

Step-by-step explanation:

In a class of 150 students, 95 are taking Math, 75 are taking Science and 55 are taking both.

We want to determine the probability that a student is taking neither Math or science.

The number taking only Math is

[tex] = 95 - 55 = 40[/tex]

The number taking only Science

[tex] = 75 - 55 = 20[/tex]

The number of students taking Math, Science, or both

[tex] = 40 + 55 + 20 = 115[/tex]

The number taking neither Mathematics or Science

[tex] = 150 - 115 = 35[/tex]

The probability that a student is taking neither Math or science

[tex] = \frac{35}{150} [/tex]

[tex] = \frac{7}{30} [/tex]

Consider the original complex figure and the reduction.

Figures not drawn to scale.

What is the scale factor of the reduction?
1/8
1/5
5
9

Answers

Answer:

1/8

Step-by-step explanation:

I'm going to try to explain this as easy as possible. What I did was take the original shape and divide it by the new shape. For this question, I solved it by dividing 32(the original base) by 4(the new base) and got 8. So the scale factor of the reduction was 1/8.

Answer:

1/8

Step-by-step explanation:

The only one that makes sense

how do I simplify this? -4k - 13 + 6k +23

Answers

-4k + 6k -13 +23

2k +10

you can even write it like this:

2 ( k+ 5)

calculate the area of this figure

Answers

THE AREA IS 78
Cause 13 x 12 is 156 and 156 divid by 2 is 78

Answer:

78.

Step-by-step explanation:

13/2=6.5

6.5X12=78.

78/2=39

39X2=39. You times it by 2 because there are two equivalent sides.

Question 2 and 3, if u just feel like answering one that’s okay

Answers

Answer:

[tex]w^{20}[/tex]; [tex]y^7[/tex]

Step-by-step explanation:

[tex](w^4)^5=\\w^{4*5}=\\w^{20}\\\\\frac{y^9}{y^2}=\\ y^{9-2}=\\y^7[/tex]

Answer:

1) =W20

2=Y7

Both 20 and 7 are exponents but i cannot type them in that format since I am  on a computer. Hope this helps!

Step-by-step explanation:

A number is selected at random from the set (2, 3, 4, ... 10). Which eventby definition, covers the entire sample space of this experiment?
A.
The number is greater than 2.
OB.
The number is not divisible by 5.
C.
The number is even or less than 12.
OD. The number is neither prime nor composite.
E.
The square root of the number is less than 3.

Answers

Answer:

C

Step-by-step explanation:

A doesn't include the term "2"

B doesn't include "5" or "10"

D doesn't include "10"

SO... it's C

Does anyone knows how to solve this question??

Answers

Answer:

24

Step-by-step explanation:

cos(x) is just a trigonometric function. To find it on a right triangle, you take the "adjacent" side, which should be the side next to the angle x, and divide it by the hypotenuse.

In this case, the adjacent side is 12. We don't know the hypotenuse, but we can figure it out using the Pythagorean Theorem: [tex]\sqrt{9^{2}+12^{2}}[/tex] = [tex]\sqrt{225}[/tex] = 15. So, the hypotenuse is 15.

Thus, cos(x) = 12/15 = 4/5. We want 30 * cos(x), so we get: 30 * (4/5) = 24, and that is our answer.

Answer:

24

Step-by-step explanation:

From the mnemonic SOHCAHTOA you would know that cos x = adjacent/hypotenuse.

Adjacent side is given as 12, but we must calculate the hypotenuse.

For that we use Pythagoras.

hypotenuse = √(9²+12²) = 15

Now you can calculate

30×cos(x) = 30×12/15 = 24

Find the area of the semicircle.
Either enter an exact answer in terms of
or use 3.14 for and enter your answer as a decimal.
units

Answers

Answer:

8 pie

Step-by-step explanation:

area of a circle is pie(radius squared)

radius is 4

4 squared is 16

divide by two because its a semi circle

Answer:

8pi

Step-by-step explanation:

A=pi*r^2

A=pi(4^2)

A=16pi

16pi would be the area if the circle was complete, but since this is a semicircle you just have to divide by two which would give us:

A=8pi

May You Please Help Me? :(
In triangle ABC, the length of side AB is 11 inches and the length of side BC is 18 inches. Which of the following could be the length of side AC?
1. 5 inches
2. 31 Inches
3. 34 inches
4. 19 inches

Answers

Option 3 “34 inches” is the answer because the sum of two sides of the triangle must be greater than the third side. If this rule is not obeyed then the third side will not complete the triangle and it will be not be joined.
11+18<34 true
11+34<18 true
18+34<11 true
Therefore this is a complete triangle.
Hope this helps you. Have a nice day and keep smiling!!

A rectangular restaurant kitchen has a perimeter of 34 meters and an area of 70 square meters. What are the dimensions of the kitchen?

Answers

Answer:

The kitchen has a length of 10 meters and a width of 7 meters.

Step-by-step explanation:

10x7=70 meters squared

10+10+7+7=34 meters

What is x rounded to the nearest tenth please help

Answers

Answer:

8.9

Step-by-step explanation:

i believe 8.9 would be X rounded to the nearest tenth

CAN SOMEONE PLEASE SOLVE THIS?????????? NEED HELP!!!!!!!!!!!!!!!!!!!

Answers

Answer:

x = 9, GH = 21, CD = 17

Step-by-step explanation:

Quadrilateral CDEF is a trapezoid in which G and H are mid points of the sides CF and DE respectively.

In a trapezoid, segment joining the mid points is equal to the half of the sum of the parallel sides.

[tex] \therefore \: GH = \frac{1}{2} (CD + FE) \\ \\ \therefore \:3x - 6 =\frac{1}{2} (2x - 1 + 25) \\ \\ \therefore \:3x - 6 =\frac{1}{2} (2x + 24) \\ \\ \therefore \:3x - 6 =\frac{1}{2} \times 2 (x + 12) \\ \\ \therefore \:3x - 6 = x + 12 \\ \\ \therefore \:3x - x = 12 + 6 \\ \\ \therefore \:2x = 18 \\ \\ \therefore \:x = \frac{18}{2} \\ \\ \huge\red{ \boxed{\therefore \:x = 9}} \\\\ \because \overline{GH} = 3x - 6 \\ \\\therefore \:\overline{GH} =3 \times 9 - 6 \\ \\ \therefore \:\overline{GH} =27 - 6 \\ \\ \huge\purple{ \boxed{\therefore \:\overline{GH} =21}} \\ \\ \because\overline{CD} = 2x - 1 \\\\ \therefore \:\overline{CD} =2 \times 9 - 1 \\ \\ \therefore \:\overline{CD} =18 - 1 \\ \\ \huge\pink{ \boxed{\therefore \:\overline{CD} =17}} \\ \\ [/tex]

Other Questions
What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings?