Kenji packed an exercise ball into a cylindrical package. The inflatable exercise ball is made out of vinyl. How much vinyl was used to make the exercise ball? Express your answer in terms of pi.​

Kenji Packed An Exercise Ball Into A Cylindrical Package. The Inflatable Exercise Ball Is Made Out Of

Answers

Answer 1

Considering it's surface area, it is found that [tex]48\pi \text{ft}^2[/tex] of vinyl was used to make the exercise ball.

What is the surface area of a cylinder?

The surface area of a cylinder of radius r and height h is given by:

[tex]S = 2\pi r(r + h)[/tex]

In this problem, we have that r = 3 ft and h = 5 ft, hence the surface area in ft² is given by:

[tex]S = 2\pi r(r + h) = 2\pi \times 3(3 + 5) = 48\pi[/tex]

Hence, [tex]48\pi \text{ft}^2[/tex] of vinyl was used to make the exercise ball.

More can be learned about the surface area of a cylinder at https://brainly.com/question/26702574


Related Questions

What is the answer for x-9=8

Answers

x=17 that’s answer and I hope it helps

Answer:

x=17

Step-by-step explanation:

To solve this, we can add 9 to each side of the equation. This will cancel out the 9 to only leave x by itself on one side

Once we add 9 to each side, we will be left with x=17

PLEASE HURRY I'M TAKING A TEST 20 PTS
Simplify the expression (in the picture)

Answers

Answer:

D

Step-by-step explanation:

2  ( x − 3 )

x  ( x + 1 )

Answer:

ANSWER IS D

Step-by-step explanation:

3. There are 350 people in an office building. A local deli randomly surveyed people in the building to determine the average amount spent on lunch each week. Two samples are shown.

Sample 1: {$30, $25, $10, $25, $10} and Sample 2: {$5, $60, $10, $30, $50}

(a) Calculate the mean and the median of each sample.

(b) Which sample has the least spread among its data values? Which sample has the least deviations from the mean among its values?

(c) A third sample was obtained: {$30, $25, $20, $20, $25}. Which data set in Part (a) has measures of center that align more closely with the mean and the median of the new sample? Based on the three samples, which sample is least representative of the population?

Answers

Answer:

(a)Sample 1

The Mean = 20

The median = 25

Sample 2

The Mean = 31

The median = 60

(b) Sample 1 has the least spread

Sample 1 has the least deviations from the mean

(c) Sample 1 align with the third sample

The least representative of the population is sample 1

Step-by-step explanation:

The mean is ∑fx/∑f

∑fx = 30 + 25 + 10 + 25 + 10 = 100

∑f = 5

Mean = 100/5 = 20

For the median, we arrange the data in increasing order;

10, 10, 25, 25, 30

The median = the middle number = 25

Sample 2

The mean is ∑fx/∑f

∑fx = 5 + 60 + 10 + 30 + 50 = 155

∑f = 5

Mean = 155/5 = 31

For the median, we arrange the data in increasing order;

5, 10, 30, 50, 60

The median = the middle number = 30

(b) Sample 1 range =$30 -$10 = $20

Sample 2 range =$65 -$5 = $60

Sample 1 has the least spread

Sample 1 standard deviation = 9.354

Sample 2 standard deviation =24.083

Sample 1 has the least deviations from the mean

(c) $30, $25, $20, $20, $25

Mean = 24

$20, $20, $25, $25, $30

Median = $25

∑fx = 120

Therefore sample 1 align with the third sample

The least representative of the population is sample 1 with ∑fx = 100.

A newborn child receives a $20,000 gift toward college education from her grandparents. How much will the 20,000 be worth in 17 years if it is invested at 7% and compounded quarterly?

Answers

Answer:

The amount the $20.000 will be worth in 17  years at compound interest is $65068.443

Step-by-step explanation:

Here we have the Principal, P = $20,000.00

The annual interest rate, r = 7% = 0.07

Time , t = 17 years

Number of compounding period per year, m = quarterly = 4

The compound interest can be found from the following formula;

[tex]Amount, \ A = P \left (1 + \frac{1}{r} \right )^{mt}[/tex]

Therefore, by plugging the values of the equation parameters, we have;

[tex]Amount, \ A = 20000 \left (1 + \frac{0.07}{4} \right )^{4 \times 17} = \$ 65068.443[/tex]

Therefore, the amount the $20.000 will be worth in 17  years at compound interest = $65068.443.

So, the amount of $20,000 be worth in 17 years if it is invested at 7% and compounded quarterly is $65068.443 and this can be determined by using the compound interest formula.

Given :

A newborn child receives a $20,000 gift toward college education from her grandparents.

The formula of compound interest is given by:

[tex]\rm A= P(1+\dfrac{r}{n})^{nt}[/tex]

where A is the final amount, P is the principal amount, r is the interest rate, n is the number of times interest applied per time period and t is the number of periods elapsed.

Substitute the known terms in the above formula:

[tex]\rm A = 20000(1+\dfrac{0.07}{4})^{4\times 17}[/tex]

[tex]\rm A = 20000(1.0175)^{68}[/tex]

A = $65068.443

So, the amount of $20,000 be worth in 17 years if it is invested at 7% and compounded quarterly is $65068.443.

For more information, refer to the link given below:

https://brainly.com/question/22803385

What is the value of f(12)-f(8) when f(x)=3x+9

Answers

Answer:

12

Step-by-step explanation:

f(x)=3x+9

f(12) = 3*12 +9

       36+9

        45

f(8) = 3*8+9

     =24+9

     = 33

f(12) - f(8) = 45-33

                    12

Concerned with poverty, 27 adults conduct a survey. According to the results 35% of adults are concerned with poverty. Let x= number of adults surveyed and y= adults concerned with poverty. If 200 adults are surveyed how many are concerned with poverty?

Answers

Answer:

70

Step-by-step explanation:

In this problem, 27 adults conduct a survey.

In the results of the survey, it is found that 35% of the adults are concerned with poverty.

If we call:

x = number of adults surveyed

y = adults concerned with poverty

This means that we can write the following relationship:

[tex]y=0.35x[/tex] (1)

where [tex]0.35[/tex] represents the percentage of adults concerned with poverty, rewritten in decimal form ([tex]0.35=\frac{35}{100}[/tex])

Later, we are told that 200 adults are surveyed, so now we have

x = 200

So substituting into eq(1) we can find how many of these adults are concerned with poverty:

[tex]y=0.35\cdot 200 =70[/tex]

can you solve this equation?

Answers

Answer:

x=31

Step-by-step explanation:

(x-31)/4=0

multiply each side by 4 so that you have x-31=0.

x-31=0

add 31 to each side.

x=31

Answer:

No, unless you set it equal to zero.

Step-by-step explanation:

(x-31)/4=0

((x-31)/4) times 4 = 0 times 4

x-31=0

x-31 +31 =0 + 31

x=31

The area of a circle is 4π square kilometers. What is the radius? Write your answer in simplest form.

Answers

Answer:

2 km

Step-by-step explanation:

4π = π × r²

r² = 4

r = 2

For what values of theta (0 less than or equal to theta less than or equal to 2pi) do maximum r values occur on the graph the polar equation r=4+3 sin3theta? Note that the maximum r-value occurs at a point that is the maximum distance from the pole.

Answers

Answer:

Step-by-step explanation:

To find the values of the angle which makes maximum r you use the derivative of r

[tex]\frac{dr}{d\theta}=\frac{1}{3}sin(3\theta)[/tex]

If you equals this derivative to zero you obtain the value of the angle:

[tex]\frac{dr}{d\theta}=0\\\\cos3\theta=0\\\\3\theta=\frac{\pi}{2}\\\\\theta=\frac{\pi}{6}[/tex]

However, the values of 5π/6 and 9π/6 are also available, because makes the sinusoidal function equal  to 1.

hence, the answer is:

[tex]\theta_1=\frac{\pi}{6} \\\\\theta_2=\frac{5\pi}{6}\\\\\theta_3=\frac{9\pi}{6}=\frac{3\pi}{2}[/tex]

answer b

Final answer:

The maximum values of r for the polar equation r=4+3 sin 3θ occur at the angles where sin 3θ = 1, within the range of 0 to 2π. Solving the equation 3θ = nπ/2 for odd integers n gives the values of θ where r is maximum, which must be checked against the range [0, 2π].

Explanation:

We can find the maximum values of r for the polar equation r=4+3 sin 3θ by looking for the values of θ that give the maximum value for the sinusoidal function sin 3θ.

Since we know that the sine function reaches its maximum value of 1, we can find the values of θ that satisfy the condition sin 3θ = 1 within the given range of θ from 0 to 2π.

Thus, the equation becomes r = 4 + 3(1), which simplifies to r = 7.
Now, we seek to solve 3θ = nπ/2 where n is an odd integer since the sine function is maximum at π/2, 3π/2, 5π/2, and so on. Therefore, we obtain θ values of π/6, π/2, 5π/6, etc., until we reach the limit of 2π.

We must also consider the range of the function which brings us to the fact that θ must lie within [0, 2π].
Thus, we have to evaluate this for values such as θ = π/6, 5π/6, 3π/2, and so on, checking which of these are within the specified range and hence can be considered valid solutions where maximum r values occur.

Choose the linear function below that does not have the same y-intercept as the other functions.

Answers

Answer:

The answer is a

Step-by-step explanation:

On a coordinate plane, a line goes through points (negative 1, negative 2) and (0, 1).

The linear function that does not have the same y-intercept  as the other functions is: Option A

How to find the y-intercept?

The general form of the equation of a Line in slope intercept form is expressed as:

y = mx + c

where:

m is slope

c is y-intercept

1) In this graph, the y-intercept which is where the line crosses the y-axis is: y = 1

2) The y-intercept in the equation y = -8x + 3 is:

y = 3

3) The y-intercept here will be:

y = 3

4) The y-intercept in the equation y = 2x + 3 is:

y = 3

If 32 units represent $2,080, find the value of 6 units.

Answers

Final answer:

To find the value of 6 units when 32 units are worth $2,080, calculate the per unit value by dividing $2,080 by 32 to get $65 per unit, then multiply by 6 to obtain the value of 6 units, which is $390.

Explanation:

The question asks to find the value of 6 units given that 32 units represent $2,080. To solve this, we first find the value of one unit by dividing the total amount of money by the number of units. So, $2,080 divided by 32 units gives us the value per unit.

Next, we multiply the value of one unit by the number of units we want to find the value for, which is 6 units. This will give us the value for 6 units. Let's go through the steps:

Calculate the value of one unit: $2,080 ÷ 32 units = $65 per unit.Find the value of 6 units: $65 per unit × 6 units = $390.

Therefore, the value of 6 units is $390.

A standardized​ exam's scores are normally distributed. In a recent​ year, the mean test score was 1491 and the standard deviation was 312. The test scores of four students selected at random are 1910​, 1230​, 2190​, and 1380. Find the​ z-scores that correspond to each value and determine whether any of the values are unusual.

Answers

Answer:

[tex]z(1910)=1.3429\\\\z(1230)=-0.9006\\\\z(2190)=2.2404\\\\z(1380)=-0.3558[/tex]

Step-by-step explanation:

-Given the population mean is [tex]\mu=1491[/tex]and  the standard deviation is [tex]\sigma=312[/tex], we calculate the z-scores using the formula:

[tex]z=\frac{\bar x-\mu}{\sigma}[/tex]

#The z-score for 1910 can be calculated as:

[tex]z(1910)=\frac{x-\mu}{\sigma}\\\\=\frac{1910-1491}{312}\\\\=\frac{419}{312}\\\\=1.3429[/tex]

#The z-score for 1230can be calculated as:

[tex]z(1230)=\frac{x-\mu}{\sigma}\\\\=\frac{1230-1491}{312}\\\\=\frac{-281}{312}\\\\=-0.9006[/tex]

#The z-score for 2190 is calculated as follows:

[tex]z(2190)=\frac{x-\mu}{\sigma}\\\\=\frac{2190-1491}{312}\\\\=\frac{699}{312}\\\\=2.2404[/tex]

#The z-score for 1380 is calculated as:

[tex]z(1380)=\frac{x-\mu}{\sigma}\\\\=\frac{1380-1491}{312}\\\\=\frac{-111}{312}\\\\=-0.3558[/tex]

Last year,alex earened a monthly salary of $250, and ben earned a monthly salary of $180. This year, each of them received a pay increase of 25% this year, how much more did alex earn in one month then ben

Answers

Answer: Alex earned $87.5 more than Ben

Step-by-step explanation:

Last year,Alex earned a monthly salary of $250. This year, he received a pay increase of 25%. It means that the amount by which his pay was increased is

25/100 × 250 = 62.5

His new monthly salary would be

250 + 62.5 = $312.5

Last yearBen earned a monthly salary of $180. This year, he also received a pay increase of 25%. It means that the amount by which his pay was increased is

25/100 × 1800 = 45

His new monthly salary would be

180 + 45 = $225

The difference between the amount earned by Alex and Ben monthly is

312.5 - 225 = $87.5

Round to 2 SF
646.42
plz

Answers

Answer:

650

Step-by-step explanation:

2sf= the first two figures

so you count to the first two sf numbers so in this case

it would be 64 then you look at the next one.  But if it is 4 or below  you round or if it is 5 and above you rounded up

in this case the third digit is a 6 so you would round up to 5

answer =650

Final answer:

The number 646.42 can be rounded to two significant figures by increasing the second significant figure up by one because the third figure is 6 which is greater than 5. Therefore, 646.42 becomes 650.

Explanation:

You are requesting to round the number 646.42 to two significant figures (SF). Significant figures are the meaningful digits in a number. For example, in 646.42, there are five significant figures: 6, 4, 6, 4, 2.

To round to two significant figures, we look at the number in the third position, which is another 6. If this number is 5 or greater, we round the second significant figure up. If it is less than 5, we keep the second figure the same. Here, the next number after the two significant figure (6 and 4) is 6, which is more than 5, so you will round 4 up to 5.

Thus, rounded to two significant figures, 646.42 becomes 650.

Learn more about Rounding Numbers here:

https://brainly.com/question/19166897

#SPJ3

Cooking oil is delivered to your restaurant in 5-gallon buckets. For easier pouring, the oil is stored in one-liter containers. How many one-liter containers are needed to completely empty the 5-gallon bucket?

Answers

Answer:

19 !

Step-by-step explanation: make me brainlist

What is the simplified form of 3.1 - 5.8n - 4n + 8?

Answers

Answer:

-9.8n + 11.1

Step-by-step explanation:

1. Combine like terms

      -5.8n - 4n = -9.8n

      3.1 + 8 = 11.1

2. -9.8n +11.1

Answer:

-9.8n+11.1

Step-by-step explanation:

You have to add all like terms. That means that -5.8n and -4n have to be added together along with 3.1 and 8. That gets you -9.8n+11.1.

help me please for brainliest!

Answers

Answer:

1)option b

2)option a

Step-by-step explanation:

1) circumference = 62.8 in

=> 2πr= 62.8

=> r= 62.8/(2×3.14)= 10 in

diameter = 2×10 in = 20 in

2)diameter = 14m

radius = 7 m

Area of the circle= πr² =3.14(7)²=3.14×49

= 153.86

=153.9 m²

Answer:

Q1) B

Q2) A

Step-by-step explanation:

Q1) The equation for working out the circumference of a circle is 2 × π × r or π × d, but here we are asked to do the reverse so,

π × d = 62.8

d = 62.8 ÷ π

d = 19.9

So the answer to the Q1) is 20 inches

Q2) We have to work out the area of the circle so we utilise the formula

π × r² . We only have the diameter but we can half it to find the radius so

14 ÷ 2 = 7. So 7 is the radius, now we substitute into the formula π × r²

3.14 × 7² = 153.86

What do you notice? What do you wonder?
watches TV
W
not much TV
plays sports
no sports

Answers

I need to see a picture

F (x) = 5x-10 determine x when f (x) = 15

Answers

5(15) = 75
75-10 = 65

Answer: 5=x

Step-by-step explanation:

Ok, so if F(x)=15, then the equation would look like this: [tex]15=5x-10[/tex]

The next step would be to add the 10 over from the right to the left side to get [tex]25=5x[/tex]

Now divide both sides by 5 to get the answer.

What is a residual value??

Answers

Answer:

In accounting, residual value is another name for salvage value, the remaining value of an asset after it has been fully depreciated. The residual value derives its calculation from a base price, calculated after depreciation.

You measure 50 textbooks' weights, and find they have a mean weight of 52 ounces. Assume the population standard deviation is 14.6 ounces. Based on this, construct a 90% confidence interval for the true population mean textbook weight.

Answers

The 90% confidence interval = 48.603 < μ < 55.397

Explanation:

Given:

Mean = 52

Standard deviation = 14.6

Sample size, n = 50

Confidence Interval, c = 90%

                                  c = 0.9

Significance level, α = 1 - c

                                  = 1 - 0.9

                                  = 0.1

Critical value, z(α/2) = z(0.05) = 1.645

Critical value = ± 1.645

Margin of error, E = [tex]z(\alpha /2) X \frac{SD}{\sqrt{n} }[/tex]

                             [tex]=1.645 X\frac{14.6}{\sqrt{50} } \\\\= 3.3965[/tex]

Limits of 90% confidence interval are given by:

Lower limit = μ - E

                  = 52 - 3.397

                  = 48.603

Upper limit = μ + E

                  = 52 + 3.397

                  = 55.397

Thus, 90% confidence interval = 48.603 < μ < 55.397

                 

Lynn and Dawn tossed a coin 30 times and got heads 18 times. What is the experimental probability of tossing heads using Lynn and Dawn’s results?

3/5

5/3

2/3

Answers

Answer:

3/5

Step-by-step explanation:

Answer:

Your answer should be 3/5

Steph needs to help her parents put a fence around their pool. They want the fence to be square and want each side to measure 666 meters. They already have 101010 meters of fencing.
How many more meters of fencing should they buy?

Answers

Steph's parents need to buy 1654 meters more of fencing.

To find out how many more meters of fencing Steph's parents need to buy, let's first calculate the perimeter of the square fence.

Since all sides of a square are equal, if each side measures 666 meters, then the perimeter of the square is:

[tex]Perimeter = 4 * Side[/tex]

Given that each side measures 666 meters:

[tex]Perimeter = 4 * 666[/tex]

Now, let's calculate the total perimeter:

[tex]Perimeter = 4 * 666[/tex]

[tex]Perimeter = 2664 meters[/tex]

Now, let's see how much fencing they already have and how much more they need to buy:

[tex]Fencing already obtained = 1010 meters[/tex]

[tex]Fencing needed = Perimeter - Fencing already obtained[/tex]

[tex]Fencing needed = 2664 meters - 1010 meters[/tex]

[tex]Fencing needed = 1654 meters[/tex]

Complete correct question:

Steph needs to help her parents put a fence around their pool. They want the fence to be square and want each side to measure 666 meters. They already have 101010 meters of fencing. How many more meters of fencing should they buy?

A shark is swimming 28 ft below sea level. If the angle of depression from a boat on the water to the shark is 19 degrees, what is the horizontal distance between the boat and the shark?

Answers

Answer:

81,3 ft to the nearest tenth.

Step-by-step explanation:

Tan 19 = 28 / h  where h = the horizontal distance.

h = 28 / tan 19

h = 81.3 ft.

Final answer:

To calculate the horizontal distance between the boat and the shark, the tangent of the angle of depression (19 degrees) is set equal to the vertical depth (28 ft) divided by the horizontal distance. The horizontal distance is found to be approximately 81.32 ft.

Explanation:

To determine the horizontal distance between the boat and the shark when the shark is swimming 28 ft below sea level and the angle of depression from the boat to the shark is 19 degrees, we can use trigonometry, specifically the tangent function. The angle of depression corresponds to the angle between the horizontal sightline from the boat and the line of sight to the shark.

In the right-angled triangle formed by the vertical depth of the shark, the horizontal distance to the shark, and the line of sight from the boat, the angle at the boat's position is 19 degrees and the opposite side (depth) is 28 ft. Using the formula tangent of an angle equals the opposite side divided by the adjacent side (tan(θ) = opposite/adjacent), we get:

tan(19°) = 28/horizontal distance

Therefore, the horizontal distance = 28 / tan(19°) = 28/0.3443

Calculating this, we get the horizontal distance to be approximately 81.32 ft.

MATH PROBLEM NEED HELP NOW! (look at photo)

Answers

Answer:

I don’t see photo

Step-by-step explanation:

I

Don’t

See

The

Photo

Where is the photo????

HELP ASAP


Which rational number is greater than −3 1/3 but less than − 4/5?

A − 9/7
B −0.19
C − 22/5
D −0.4


Answers

Answer: A − 9/7

Step-by-step explanation:

Hi, to answer this question we have to convert all the numbers into decimal form.

-3 1/3 = - (3x3+1)/3 =-10/3 = - 3.3334

-4/5 = -0.8

Since he number must greater than −3 1/3 but less than − 4/5.

−3 1/3 < x < − 4/5.

- 3.3334 < x < -0.8

The correct option is A = -9/7 , because in decimal form is equal to -1.28-

- 3.3334 < -1.28 < -0.8

Gabe is twenty years older than his children. Laura is forty years older than her grandchildren. All members ages add to 290. Write an equation that would represent this scenario.

Answers

Answer:

290=(20+c)+(40+g)

Step-by-step explanation:

c=Gabe's children's age

g=Laura's grandchildren's age

all add up to 290

Simplify the expression:

4m + 6m +3

Answers

Answer: [tex]10m+3[/tex]

Combine Like Terms

[tex]4m+6m+3\\(4m+6m)+(3)\\10m+3[/tex]

Answer:

10m + 3

Step-by-step explanation:

You are supposed to add the like terms which are 4m and 6m to equal 10m

4m + 6m + 3

=

10m + 3

please give me brainliest

Can you tell me the answer to this: 2y = 2x + 2

Answers

Answer:

y = x + 2, assuming you need it in slope-intercept form.

Step-by-step explanation:

Isolate the y-value by dividing 2 from both sides of the equation.

Answer:I have no idea I just need points sorry lol :(

Step-by-step explanation:

Which correctly uses bar notation to represent the repeating decimal for StartFraction 6 Over 11 EndFraction 0.5ModifyingAbove 4 with bar 0.54ModifyingAbove 54 with bar 0.ModifyingAbove 54 with bar 0.ModifyingAbove 545 with bar

Answers

Answer:

Option C is your Correct Answer

Step-by-step explanation:

Answer:

c .54 w/ bar

Step-by-step explanation:

Other Questions
PLS PLS HELP 30 PTS AND BRAINLIEST IF CORRECTBanksy Art Self-Destructs After Selling for $1.4MBy Rowena SalazarAnonymous artist Banksy stunned the art world on October 6, 2018 with a prank that caused one of his paintings to self-destruct. Moments after "Girl With Balloon" sold for $1.4M via phone auction at Sotheby's auction house, an alarm sounded. Then, a remote-controlled mechanism slid the canvas down its frame where a shredder was hidden. Several videos and photos show the painting hanging halfway shredded outside of its frame."Girl With Balloon" was a spray paint on canvas work completed in 2006 and shows a small child reaching up toward a heart-shaped red balloon. The original work was stenciled on a wall in east London and is one of Bansky's most recognizable images.Banksy, an England-based graffiti artist, is also considered a political activist and vandal. He has remained anonymous since gaining fame for his stenciled graffiti art, usually spray-painting his murals in the middle of the night. Banksy often incorporates dark humor, political messaging, and social commentary into his art. He openly criticizes commercialism, once even selling works of his art at a New York Central Park pop-up shop for $60 a piece, far below their value. In 2007, he graffitied "ONE NATION UNDER CCTV" on the side of a British postal service building."Graffiti art has a hard enough life as it is, before you add hedge-fund managers wanting to chop it out and hang it over the fireplace," the New York Times quoted Banksy in 2013. "For the sake of keeping all street art where it belongs, I'd encourage people not to buy anything by anybody, unless it was created for sale in the first place." (Ryzick, M. "Another Banksy Mural to Go from Wall to Auction." The New York Times, 12 August 2013).Soon after shredding his own painting, which sold for a record-high price, Banksy posted a photo on his Instagram account of the half-shredded painting with a caption reading "Going, going, gone " He also posted a video describing how "a few years ago I secretly built a shredder into a painting in case it was ever put up for auction " He captioned the video with a quote from Pablo Picasso"The urge to destroy is also a creative urge."From the Financial District Times"'Girl With Balloon' already broke an important auctions record for Bansky, selling for $1.4M. After its recent shredding, we certainly expect this important work to raise the bar even further. While casual art observers consider the work to be destroyed, collectors are drawn to its one-of-a-kind circumstance. We wouldn't be surprised if it's already doubled in value."In a paragraph of at least five sentences, address Banksy's advice "not to buy anything by anybody, unless it was created for sale in the first place." Include at least one specific reference to each excerpt in your response. QUESTION 2 Objectives: I . identify potential and kinetic energy in a situation and draw corresponding energy bar charts, II . calculate gravitational and elastic potential energy, III . draw & analyze potential energy functions, and (d) use conservation of energy to relate the total energy at one time to total energy at another time. ------------------------------------------- Bungee Jump: you will step off with zero initial vertical velocity from a platform a height h above the ground. The bungee cord will act like a giant extensional spring that will, you hope, provide an upward force on becoming taut. After weighing you (you have a mass M), the operator has selected a bungee cordwith an un-stretched length of d and a spring constant of k. Consider yourself to be a single point i.e., use the particle model. Choosing the ground as your origin (and the z-axis directed upwards), answer the following questions about your bungee jumping adventure in terms of M, h, d, k, z, and the gravitational field strength, g. Answer with variables. ------------------------------------------- a) Write an expression for the stretching ?L of the cord in terms of d and z and for the total potential energy U of the jumper-bungee-Earth system for each situation (consider the latter two situations together). b) Which type of potential energy ( UG or US ) is largest for large z (early in the fall)? For small z (late in the fall)? c) Sketch a graph of your gravitational potential energy, UG(z) vs your height, z, from z = 0 to z = h, on the left plot. Then sketch a graph of your elastic potential energy, US(z) on the center plot. Finally on the rightmost plot, sketch a graph of your total potential energy1 U(z) = UG(z) + US(z). Do these plots on your own without the help of a computer or calculator. 1.) 2x9y=14 2.) x=6y+7 please help!! 40% of OatyPop cereal boxes contain a prize. Hannahplans to keep buying cereal until she gets a prize. What isthe probability that Hannah only has to buy 3 or lessboxes before getting a prize?We need to design a simulation. Which random device can we use to BESTrepresent this situation?Use a double-sided coin andassign heads as the prize andtails as no prize.Use a number cube with thenumbers 1 through 6 and assign1 through 2 as the prize and 3through 6 as no prize.Use a random number generatorranging from 1 to 10 and assign1 through 4 as the prize and 5through 10 as no prize.Use a deck of cards and assignspades as the prize and allother suits as no prize. There are three groups that contain carbon but are not organic compounds:carbon chlorides carbon oxides carbon iodides carbides carbonates When should you use the median and interquartile range as your measure of center and measure of variability tocompare populations shown on a box plot? Check all that applywhen there are outliers in the data setswhen there are no big gaps in the middle of the data setswhen the plots representing the data are symmetricalwhen the plots representing the data are nonsymmetricalwhen there are no outliers in the data setIntroDone To assist with a class demonstration, a student (whose mass is 60 kg) filled a water balloon with 2 kg of water. He then climbed to the second floor (10 metres) of the school and held the balloon out of a window. How much work did the student do? What is it called when plants give off water vapor as a waste product? Jason is entering a weight lifting contest. Gurrently, his maximum bench press weight is 105 pounds. If he increases the weight by 7 pounds each week, What is the maximum weight he be able to bench press after 13 weeks? Which statement best summarizes the central idea of thisexcerpt?DOUO One must know the process of hiring servants.0 It is important to always honor one's servants.O It is necessary to choose trustworthy servants.O The intelligence of servants must be considered.herofich 1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes. if tan 0= -3/8 which expression is equivalent to cot0? A fairground ride spins its occupants inside a flying saucer-shaped container. If the horizontal circular path the riders follow has a 6.75 m radius, at how many revolutions per minute are the riders subjected to a centripetal acceleration equal to that of gravity