"Lashonda swam 4 kilometers against the current in the same amount of time it took her to swim 16 kilometers with the current. The rate of the current was 3 kilometers per hour. How fast would Lashonda swim if there were no current?"

Answers

Answer 1

Answer:

5 km/h

Step-by-step explanation:

In this problem, Lashonda swam 4 km against the current. So the distance covered in this case is

[tex]d_1=4 km[/tex]

Calling [tex]v[/tex] the velocity of Lahonda without the current, and [tex]c[/tex] the velocity of the current, in this situation Lahonda's velocity is

[tex]v-c[/tex]

So we can write:

[tex]t_1=\frac{d_1}{v-c}[/tex]

where [tex]t_1[/tex] is the time taken to cover the distance.

When Lashonda swims with the current, her velocity is

[tex]v+c[/tex]

So we can write

[tex]t_2=\frac{d_2}{v+c}[/tex]

where

[tex]d_2=16 km[/tex] is the distance covered in this case, and [tex]t_2[/tex] the time taken.

The velocity of the current is

[tex]c=3 km/h[/tex]

Since Lashonad takes the same time to cover the two distances,

[tex]t_1=t_2[/tex]

So we can write

[tex]\frac{d_1}{v-c}=\frac{d_2}{v+c}[/tex]

And solving for v, we find Lashonda's velocity without the current:

[tex]d_1(v+c)=d_2(v-c)\\d_1 v+d_1c = d_2v-d_2c\\v(d_2-d_1)=c(d_1+d_2)\\v=\frac{d_2+d_2}{d_2-d_1}c=\frac{16+4}{16-4}(3)=5 km/h[/tex]

Answer 2

Final answer:

To find Lashonda's swimming speed without the current given the rate of the current and the distances swam with and against it.

Explanation:

The rate of the current is 3 kilometers per hour. To find the speed of Lashonda without the current, we can set up equations using the formula: speed = distance/time.

Let's denote Lashonda's speed in still water as x kilometers per hour. When swimming against the current, her effective speed is x - 3 km/h, and when swimming with the current, her effective speed is x + 3 km/h.

By setting up and solving the equations, we find Lashonda's speed without the current is 9 kilometers per hour.


Related Questions

Regions $A, B, C, J$ and $K$ represent ponds. Logs leave pond $A$ and float down flumes (represented by arrows) to eventually end up in pond $B$ or pond $C$. On leaving a pond, the logs are equally likely to use any available exit flume. Logs can only float in the direction the arrow is pointing. What is the probability that a log in pond $A$ will end up in pond $B$?

Answers

Answer:

Step-by-step explanation:

1 1/5

Answer:

5/18

Step-by-step explanation:

There is a 1/3 chance of going to k. From K, there is a 1/2 chance of going to b, so that way has a prob of 1/6. By the same concept, there is a 1/9 chance of going to B via J. The prob you are asking for is 5/18

June ran 1/4 of a mile in 3 minutes. How long will it take her to run a full mile?

Answers

Answer:

12 minutes !

Step-by-step explanation:

Hope this helps!!

Answer:

12 minutes

Step-by-step explanation:

3 x 4 = 12

y= arctan(-4x) when dy/dx at x = 3

Answers

Answer:

200\cdot25-84\cdot\frac{91}{12-65}\cdot\frac{8412}{1.000}-2000000\cdot46512

Step-by-step explanation:=−9.30227818×1010

The answer is D-12/d3

Determine which pair of points has a positive slope.

A. (5, -4), (-2, 1)
B. (-10, -2), (6,6)
C. (6, -10), (2, 10)
D. (5, -1), (-6, 6)

Answers

the answer is B, (-10,-2) , (6,6)

Here are the weights, in pounds, of a sample of 13 adult female golden retriever dogs: 59.0, 54.1, 53.7, 51.6, 57.5, 58.7, 58.0, 53.8, 48.9, 53.9, 51.6, 55.9, and 57.4. what are the degrees of freedom, and what's the critical value of t needed to construct a 95% confidence interval for the population mean weight of adult female golden retrievers? answer:

Answers

Answer:

95% confidence interval for the population mean weight of adult female golden retrievers is [53.01 pounds , 56.78 pounds].

Step-by-step explanation:

We are given that the weights, in pounds, of a sample of 13 adult female golden retriever dogs :

59.0, 54.1, 53.7, 51.6, 57.5, 58.7, 58.0, 53.8, 48.9, 53.9, 51.6, 55.9, and 57.4.

Firstly, the pivotal quantity for 95% confidence interval for the population mean is given by;

                         P.Q. = [tex]\frac{\bar X -\mu}{\frac{s}{\sqrt{n} } }[/tex]  ~ [tex]t_n_-_1[/tex]

where, [tex]\bar X[/tex] = sample mean weight =  [tex]\frac{\sum X }{n}[/tex]  = 54.9 pounds

            s = sample standard deviation =  [tex]\frac{\sum (X-\bar X)^{2} }{n-1}[/tex]  = 3.12 pounds

           n = sample of female = 13

           [tex]\mu[/tex] = population mean weight

Here for constructing 95% confidence interval we have used One-sample t test statistics because we don't know about population standard deviation.

So, 95% confidence interval for the population mean, [tex]\mu[/tex] is ;

P(-2.179 < [tex]t_1_2[/tex] < 2.179) = 0.95  {As the critical value of t at 12 degree

                                          of freedom are -2.179 & 2.179 with P = 2.5%}  

P(-2.179 < [tex]\frac{\bar X -\mu}{\frac{s}{\sqrt{n} } }[/tex] < 2.179) = 0.95

P( [tex]-2.179 \times {\frac{s}{\sqrt{n} } }[/tex] < [tex]{\bar X -\mu}[/tex] < [tex]2.179 \times {\frac{s}{\sqrt{n} } }[/tex] ) = 0.95

P( [tex]\bar X-2.179 \times {\frac{s}{\sqrt{n} } }[/tex] < [tex]\mu[/tex] < [tex]\bar X +2.179 \times {\frac{s}{\sqrt{n} } }[/tex] ) = 0.95

95% confidence interval for [tex]\mu[/tex] =  [tex]\bar X \pm 2.179 \times {\frac{s}{\sqrt{n} } }[/tex]

                                             = [ [tex]54.9 - 2.179 \times {\frac{3.12}{\sqrt{13} } }[/tex] , [tex]54.9 +2.179 \times {\frac{3.12}{\sqrt{13} } }[/tex] ]

                                             = [53.01 pounds , 56.78 pounds]

Therefore, 95% confidence interval for the population mean weight of adult female golden retrievers is [53.01 pounds , 56.78 pounds].

When a number is increased by 2.8%, the result is 56. What is the original number to
the nearest tenth?

Answers

Answer:

The original number was 54.5.

Step-by-step explanation:

If a number is increased by 2.8%, then it is 102.8% of it's original number.

In mathematics, "of" in virtually all cases means "multiplied by".

Therefore, we do the opposite:

1. Convert to a decimal.

102.8% = 1.028

2. Divide by the decimal.

[tex]56 \div 1.028 = 54.47[/tex]

3. Round it to the nearest tenth.

54.47 rounds to 54.5.

Final answer:

To find the original number when increased by 2.8%, we set up and solve an equation. The original number to the nearest tenth is approximately 54.4.

Explanation:

To find the original number, we can set up the equation:

x + 0.028x = 56

Simplifying gives:

1.028x = 56

Dividing both sides by 1.028 gives:

x = 56 / 1.028 ≈ 54.41

So, the original number to the nearest tenth is approximately 54.4.

Learn more about  Original Number :

https://brainly.com/question/24082954

SPJ2

Can someone please help with this?

Answers

Answer:

8 square units

Step-by-step explanation:

Draw vertical and horizontal lines, dividing the triangle into 9 equally sized smaller triangles.  4 of the smaller triangles are shaded, so the area of the square is 4/9 the area of the triangle.

A = 4/9 (½ (6)(6))

A = 8

Which of these is a correct expansion of (4x-2)(2x + 3)?
O A. 4x: 2x + 4x:3+ (-2): 2x + (-2): 3
O B. 4x. 27+ 4x• 3 + 2 + 2+ + 2-3
O c. 4x• 2x + (-2): 2x + 27.3+(-2) - 3​

Answers

Answer:

C

Step-by-step explanation

You have to do the rainbow move which is basically multiplying

4x*2x, 4x*3, -2*2x, -2*3

which then simplified would equal to 8x^2+8x-6

1. What is the shape of the distribution below?
(a) The distribution is symmetrical
(b) The distribution is not symmetrical

Answers

Answer: A

Step-by-step explanation: Because you have a dot in the middle and it is very equal

Answer: the distribution is symmetrical.

Step-by-step explanation:

Which expression is equivalent to 12x – 3x? *

8x
9
3(3x - x)
x(12-3)

Answers

X(12-3) which is 9x the same as the question

Answer:

x(12-3)

Step-by-step explanation:

The expression given is equal to 9x. The only given answer equivalent to 9x is the last one, x(12-3).

Derek has a cylindrical water bottle with a diameter of 4 centimeters and a height of 15 centimeters. If he filled the water 3/4 full of water, how much water is in the water bottle?

Answers

Answer:

141 3/8

Step-by-step explanation:

First find the volume by multiplying pi, the radius squared, and the height. Pi is 3.14. The radius is half the diameter, so it would be 2. 2^2 is 4. The height is 15. 3.14*4*15=188.5 Then multiply 3/4 and 188.5 to get your answer. 141.375 or 141 3/8.

MAY SOMEBODY HELP ME THANKS!
A water sprinkler sends water out in a circular pattern. How many feet away from the sprinkler can it spread water if the area formed by the watering pattern is 706.50 square​ feet? Use 3.14 for pi.
IM MARKING BRAINLIEST!!

Answers

Answer:

15 feet of water spread

Step-by-step explanation:

Area of the circular pattern is 706.50 sq. feet

Area = A = π r^2 = (3.14)* r^2

706.50 = (3.14)* r^2

r^2 =  706.50 / 3.14

r^2 =  706.50 / 3.14

r = root  (225)

r = 15 feet

Answer:

15 feet

Step-by-step explanation:

The area of a circle is pi*r^2, and we're using 3.14 as pi, so we get: area= 3.14 r^2

We plug 706.50 into the equation and get:

706.50 = 3.14 r^2

Divide both sides by 3.14:

225 = r^2

Square root both sides:

15 = r

y = 1/2x - 6
X = - 4

What is the solution to the system of equations?
titte



(-8, -4)
(-4,-8)
(-4,4)
(4,-4)​

Answers

Step-by-step explanation:

Putting value of x

Y = 1/2 ( - 4) - 6

Y = - 2 - 6

Y = - 8

( - 4, - 8)

find the percent of change to nearest percent:56 to 80 ​

Answers

Answer:

26 %

Step-by-step explanation:

you just go from 80 and count backwards all the way to 56 and count how many spaces or tally's that was and then you got your answer.

In order to answer the following question, please use the following image down below:

Find the value of x.

X=(Blank)

What is the value of X? Please show all the work on how you got your answer.

(If you can't explain your work, then it's fine. The only thing that I'm asking for is for you to show the work alongside your answer)

Answers

Answer:

12

Step-by-step explanation:

X^2 = (7+9)(9) -->

X^2 = 16(9) -->

X = 12

which is true regarding the system of equations 6x+2y=46 3x+y=23

Answers

Answer:

Step-by-step explanation:

hello :

the system is : 6x+2y=46

                       3x+y=23

if you multiply the second equation by : 2 you have 6x+2y =46(same  first equation )

conclusion : the system have infinity solutions ( graphically same line)

conclusion :

Lester's Cafe offers two kinds of espresso: single-shot and double-shot. Yesterday afternoon, the cafe sold 80 espressos in all, 80% of which were single-shot. How many single-shot espressos did the cafe sell?

Answers

Answer:

64 single-shot espressos

Step-by-step explanation:

Let's say that the cafe sold x single-shot espressos. The total number of espressos sold was 80, and 80% of that total 80 were single-shot. So, we have the equation:

x = 80% * 80

Remember that % just means "out of 100". So, 80% = 80/100:

x = (80/100) * 80 = 6400/100 = 64 single-shot espressos

Hope this helps!

Answer:

64

Step-by-step explanation:

80% of 80 were single-shots

80/100 × 80

64

Which expression is equivalent to the following complex fraction?

StartFraction negative 2 Over x EndFraction + StartFraction 5 Over y EndFraction divided by StartFraction 3 Over y EndFraction minus StartFraction 2 Over x EndFraction

Answers

Answer:

(-2y+5x) / (3x - 2y)

Step-by-step explanation:

If we write this sentence, we have:

((-2/x) + (5/y)) / ((3/y) - (2/x))

If we do LCM in the denominators of each fraction, we have:

((-2y+5x)/xy) / ((3x - 2y)/xy)

We can cut the 'xy' in the numerator and denominator of the whole fraction:

(-2y+5x) / (3x - 2y)

The final expression we have is (-2y+5x) / (3x - 2y)

Answer:

a

Step-by-step explanation:

(-2y+5x) / (3x-2y)

3. An amusement park charges $6 to enter, and $3 per game. If you paid a
total of $18, how many games did you play?

Answers

Answer:

You played 4 games

Step-by-step explanation:

You start with $18 and subtract 6 from the entry fee. Then, you divide the 12 you got from that and divide it by 3

Final answer:

To determine the number of games played, subtract the access fee from the total cost and then divide by the per-game price. In this case, the student paid for an access fee of $6, and played 4 games at $3 each to reach a total cost of $18.

Explanation:

The question posed is a basic algebra problem involving a fixed entry fee and a variable cost per game. The given information states that the access fee is $6 and the per-unit price, which in this case is the cost per game, is $3. If the total amount paid was $18, the number of games played can be calculated.

To solve, let's denote the number of games played as x. The total cost is made up of a fixed access fee plus the cost of the games played. The expression for the total cost is thus $6 (access fee) + $3x (cost of games).

The equation based on the total amount paid would be:

6 + 3x = 18

To find the value of x, we subtract the access fee from the total amount paid:

18 - 6 = 3x

That simplifies to:

12 = 3x

Which can then be solved by dividing both sides by 3:

x = 12 / 3

x = 4

The student thus played 4 games.

which of the following statements about rotations are true? select all that apply​

Answers

where are the selections?
There are no selections so I can’t help

Circle A has a circumference of 8/3 m. Circle B has a diameter that is 3/2 times as long as Circle A’s diameter. What is the circumference of Circle B?

Answers

Answer:

the answer is 4

Step-by-step explanation:

if my calculations are right

Serena has attached a 10 inch ribbon to the corners of a frame to hang it on the wall. The frame 9 inches wide. How far above the top of the frame will the hook need to be? Round

Answers

Answer: The hook would be 2.2 inches (approximately) above the top of the frame

Step-by-step explanation: Please refer to the picture attached for further details.

The top of the picture frame has been given as 9 inches and a 10 inch ribbon has been attached in order to hang it on a wall. The ribbon at the point of being hung up would be divided into 5 inches on either side (as shown in the picture). The line from the tip/hook down to the frame would divide the length of the frame into two equal lengths, that is 4.5 inches on either side of the hook. This would effectively give us two similar right angled triangles with sides 5 inches, 4.5 inches and a third side yet unknown. That third side is the distance from the hook to the top of the frame. The distance is calculated by using the Pythagoras theorem which states as follows;

AC^2 = AB^2 + BC^2

Where AC is the hypotenuse (longest side) and AB and BC are the other two sides

5^2 = 4.5^2 + BC^2

25 = 20.25 + BC^2

Subtract 20.25 from both sides of the equation

4.75 = BC^2

Add the square root sign to both sides of the equation

2.1794 = BC

Rounded up to the nearest tenth, the distance from the hook to the top of the frame will be 2.2 inches

To find the distance above the frame for hanging, use the Pythagorean theorem by considering the diagonal created by the ribbon. The hook needs to be approximately 5.39 inches above the top of the frame.

To find how far above the top of the frame the hook needs to be, we need to consider the diagonal of the frame created by the ribbon. Using the Pythagorean theorem, we can calculate this distance.

Width of the frame = 9 inchesLength of the ribbon attached diagonally = 10 inchesUsing Pythagorean theorem: (9)² + x² = (10)²x = square root of (10² - 9²)x = 5.39 inches

Therefore, the hook needs to be approximately 5.39 inches above the top of the frame.

Eighty-five percent of what number is 42.5?
A.
180
B.
36.125
C.
50
D.
30

Answers

The for this problem would be C, 50

Answer:

50

Step-by-step explanation:

Hope this helped

:)

What is the ratio for relative frequency?
Relative frequency = StartFraction row total Over column total EndFraction
Relative frequency = StartFraction row total Over total count EndFraction
Relative frequency = StartFraction total count Over subtotal count EndFraction
Relative frequency = StartFraction subtotal count Over total count EndFraction

Answers

Answer:

Relative frequency= subtotal count - total count

Step-by-step explanation:

Answer:

D.Relative frequency= subtotal count / total count

HELLPPP Mariah is shopping at the mall for a sweatshirt. She finds a sweatshirt that is marked down 55% off the original price of the sweatshirt is $78.25. What is the sale price of the sweatshirt?

Answers

Answer:

Her Original PRICE WAS $117.375

Step-by-step explanation:

If the sale price is 55% of the original price of the sweatshirt, the sale price is $78.25.

What is the percentage?

It's the ratio of two integers stated as a fraction of a hundred parts. It is a metric for comparing two sets of data, and it is expressed as a percentage using the percent symbol.

Given that, Mariah is shopping at the mall for a sweatshirt. She finds a sweatshirt that is marked down 55% off the original price of the sweatshirt is $78.25.

The usage of percentages is widespread and diverse. For instance, numerous data in the media, bank interest rates, retail discounts, and inflation rates are all reported as percentages. For comprehending the financial elements of daily life, percentages are crucial.

The sale price of the sweatshirt is,

sale price = 55% of the current price

sale price =(55/100)× $78.25

sale price = $43.03

Thus, if the sale price is 55% of the original price of the sweatshirt, the sale price is $78.25.

Learn more about the percentage here:

brainly.com/question/8011401

#SPJ2

What is 9.22 × 103 in standard form

Answers

Answer:

=>9.4966×10^2

Step-by-step explanation:

9.22×103

=>949.66

in standard form

=>9.4966×10^2

9.22x103 The Answerrrr is

Factor out a GCF


[tex]3x^{2} +12x[/tex]

Answers

Answer:

3x(x+4)

Step-by-step explanation:

3x^2+12x

3x^2 = 3*x*x

12x = 2*2*3*x

We can factor out 3x

3x (x+2*2)

3x(x+4)

HELP PLEASE!
Jackson runs around a track in the evening for exercise. How far does Jackson run each evening if he runs 3 times around the track shown in the diagram below? Round your answer to the nearest whole yard.

Answers

1042 I just took the test I can't remember if that is the right number but it is the largest number

9. Bryce goes och for a walk. He walks 9/8 miles from home. He walks back 1/2

mile before meeting up with his friend Mya. Write and simplify an expression (a

sum) that describes this situation.

Answers

Answer:

Expression:

[tex]\frac{9}{8}+(-\frac{1}{2})=\frac{5}{8}[/tex]

Step-by-step explanation:

We are given that

Bryce traveled distance from his home=[tex]\frac{9}{8}miles[/tex]

Bryce traveled distance back=[tex]\frac{1}{2}miles[/tex]

We have to find the expression and then simplify.

According to question

Total distance traveled by Bryce

=[tex]\frac{9}{8}+(-\frac{1}{2})[/tex]

This is required expression.

Total distance traveled by Bryce=[tex]\frac{9-4}{8}=\frac{5}{8}miles[/tex]

Hence, the total distance traveled by Bryce from his home=[tex]\frac{5}{8}miles[/tex]

Final answer:

To find the total distance Bryce walked, we add 9/8 miles to 1/2 mile, which equals 13/8 miles or simplified to 1 5/8 miles.

Explanation:

Bryce initially walks 9/8 miles from home. On his way back, he walks 1/2 mile before meeting up with his friend Mya. To describe this situation with an expression and simplify it, we add these distances together:

Total distance walked = 9/8 miles + 1/2 mile

To simplify, find a common denominator (which in this case is 8), and then add the numerators:

Total distance walked = (9/8) + (4/8)

Total distance walked = (9 + 4) / 8

Total distance walked = 13/8

Total distance walked = 1 5/8 miles

This is the sum describing the distance Bryce walked before meeting Mya, which simplifies to 1 and 5/8 miles.

The middle schools baseball team the badgers won 20 games last year this year they won 22 games what is the percentage increase of games one from this year to last year

Answers

Answer:

The correct answer is 10%.

Step-by-step explanation:

The middle school's baseball team the badgers won 20 games last year.

This year they won 22 games.

Increase in the number of wins = 22 - 20 = 2.

We need to find the percentage increase of games as compared to the last year. That is given by dividing the increase in wins divided by the wins last year multiplied by 100.

Percentage increase as compared to the last years is given by [tex]\frac{2}{20}[/tex] × 100 = 10%

There is an increase of 10% in the number of wins in this year as compared to the last year.

Other Questions
A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings? What made Jake suspicious about the man with the camera?he was wearing dark glasseshe took a photo of themhe was the same man who sold Jake the maphe had followed them all dayIts C