Multiply.

(2.5×10−^8)(9×10−^10)

Express your answer in scientific notation.

A. 2.25×10−^19

B. 2.25×10−^17

C. 2.25×10−^16

D. 2.25×10−^18


HELP ME QUICK PLZ MY TEST IS TIMED!
AND I ONLY HAVE LIKE 10 MORE MIN ö ♥

Answers

Answer 1

Answer:

B. 2.25×10−^17

Step-by-step explanation:

Answer 2

Answer:

2.25×10−^17

I took the test so im 100% sure

Good luck


Related Questions

20/30 as a decimal rounded to the nearest tenth

Answers

Answer:

1.5

Step-by-step explanation:

Answer:

0.7

Step-by-step explanation:

30 cannot be multiplied to give a power of 10, so to find the decimal you have to divide: 2/3 = 2/3 + 2 ÷ 3

2 divided by 3 is 0.6666666... It is a recurring decimal.

However it is not practical to use recurring decimals in calculations, so the decimal is usually rounded off to 2 or 3 decimal places depending on the accuracy required for the answer.

Verbal expression for r+4

Answers

Answer:

a number increased by 4

Step-by-step explanation:

r = a number

increased by four = +4

four more than the number R

Step-by-step explanation: with the word than you would flip it to r+4

write an expression for the amount of money (in dollars) in n nickels

Answers

Answer:

m1.00 +n0.20

Step-by-step explanation:

20 times 5 equal one dollar

Final answer:

The amount of money in n nickels can be expressed as 5n.

Explanation:

The expression for the amount of money in n nickels can be written as 5n. Since each nickel is worth 5 cents, multiplying the number of nickels by 5 will give the amount in dollars. For example, if you have 3 nickels, the expression would be 5 x 3 = 15 dollars.

Learn more about money in nickels here:

https://brainly.com/question/32788723

#SPJ2

A number q plus 8 is less than or equal to 15​

Answers

Answer:

q≤7

Step-by-step explanation:

q+8≤15

1) Subtract 8 from both sides:

q≤7

Answer:

[tex]\displaystyle 7 ≥ q; q + 8 ≤ 15[/tex]

Step-by-step explanation:

q + 8 ≤ 15

- 8 - 8

_______

[tex]\displaystyle q ≤ 7[/tex]

** The above answer is written in reverse, which is the exact same result.

I am joyous to assist you anytime.

What is the lcm of 24,36,and, 60?

Answers

Answer:  360

Step-by-step explanation:

LCM is least common multiple.  In other words, what number is divisible by 24, 36, and 60?

Factor each term.  See what they have in common and then multiply the common term by all of the leftovers.

                24                        36                         60

                 ∧                          ∧                           ∧

             12   2                    12  3                      12  5

                   

They all have a 12 in common.  The leftovers are 2, 3, & 5.

So, the LCM is 12 × 2 × 3 × 5   = 360

How do you solve this?​

Answers

you call that 28x∉ then add√÷ um turn it around and come out  answer

2(4+2x) > 5x+5
Solve the inequality

Answers

Answer:

x < 3

Step-by-step explanation:

Apply distributive property on the left of the inequality to get rid of the parenthesis:

8+4x > 5x+5

subtract 4x from both sides to group all terms with x on the right:

8 > 5x-4x+5

8 > x +5

Now subtract 5 from both sides to collect all numerical terms on the left:

8 - 5 > x

3 > x

Therefore the solution to the inequality are of those real numbers strictly smaller than 3.

The inequality can be written as x < 3 or also as we had it initially: 3 > x

Notice that the opening of the angle symbol is always facing the number 3 , meaning that 3 is the larger of the two numerical objects that are compared.

64.8 divided by 7 showing using long division

Answers

Answer:

9.257

Step-by-step explanation:

7 goes into 64 nine times with the remainder of 1. Bring the decimal point up and the 8 down. 7 goes into 18 two times with the remainder of 4. 7 goes into 40 5 times with the remainder of 5. 7 goes into 50 7 times. That equals 9.257.

Have a nice day!!!!!! :-)

KA

Final answer:

To divide 64.8 by 7 using long division, calculate how many times 7 can be subtracted from each part of the number 64.8 in sequence. This results in the final answer of 9.25.

Explanation:

To find 64.8 divided by 7 using long division, first write down 64.8 with a division bar over it and 7 on the left side of the bar. You would write:

7 | 64.8

Next, ask: How many times does 7 go into 64? This is 9 times since 7 times 9 is 63. Record the 9 above the line and record the product (63) below 64. Subtract 63 from 64 to get 1.

Bring down the 8 (from 64.8) to the right of the 1. Now you have 18. Ask how many times does 7 go into 18? This is 2 times. So you add the digit 2 next to 9 on top of the bar. 7 times 2 is 14.

Subtract 14 from 18 to get 4. As the decimal point should be straight up from where it is in the 64.8, record a decimal point.

Now, since there's no more numbers to bring down, you can add a 0 to 40. 7 goes into 40, 5 times. Therefore, we add 5 next to the 2 after the decimal point. So, 64.8 divided by 7 is 9.25.

Learn more about Long Division here:

https://brainly.com/question/32236265

#SPJ11

8-5b=-7 solve please

Answers

Answer:

Step-by-step explanation:

subtract 8

-5b=-15

divide negative 5

b=3

Answer the answer to your question is b=3

How many times dose 24 go into 1,392

Answers

Answer:

58

Step-by-step explanation:

1392/24=58

Answer: 24 goes into the number 1,392, 58 times

Which scale would produce the largest scale drawing of an object when compared to the actual object?

A. 1 inch : 5 feet

B. 1 inch : 30 inches

C. 1 foot : 12 yards

D. 1 centimeter : 1 meter

Answers

Covert the ratios so they are all the same measurement type.

A. 5 feet = 5 x 12 = 60 inches.

The scale becomes 1:60

B. 1:30

C. 12 yards = 12 x 3 = 36 feet x 12 = 432 inches.

The scale is 12:432  = 1:36

D. 1 meter = 39.37 inches.

1 inch = 2.54 cm

39.37 x 2.54 = 99.99 inches

The scale converted to inches becomes 1 :100 inches.

The first number would be the size of the drawing, the second number is the size of the actual object

If you use all 4 scale factors for a real object that is 100 inches:

A would need 100/60 = 1.67 inches.

B would need 100/30 = 3.3 inches.

C would need 100/36 = 2.78 inches.

D would need 100/100 = 1 inch.

The larger scaled drawing would be B.

Answer:

Option B.

Step-by-step explanation:

We need to find which scale would produce the largest scale drawing of an object when compared to the actual object.

First of all cover all units in inches.

In option 1,

1 inch : 5 feet

We know that

1 feet = 12 inch → 5 feet = 60 inch

So the ratio in inches is 1:60. It means the scale factor is 60.

In option 2,

1 inch : 30 inches

So the ratio in inches is 1:30. It means the scale factor is 30.

In option 3,

1 foot : 12 yards

12 inches : 12 yards                     (1 feet = 12 inch)

1 inch : 1 yards

1 inch : 36 inch                     (1 yard = 36 inch)

So the ratio in inches is 1:36. It means the scale factor is 36.

In option 4,

1 centimeter : 1 meter

1 centimeter : 100 centimeter         (1 m = 100 cm)

1 inch : 100 inch

So the ratio in inches is 1:100. It means the scale factor is 100.

Option B has smallest scale factor, so it will produce the largest scale drawing of an object when compared to the actual object.

Therefore, the correct option is B.

Represent the following sentence as an algebraic expression, where "a number" is the letter x. number is decreased by 2.

Answers

Answer:

x-2

x decreased by 2 equals x-2.

Have a nice day!!!!!!!!!! :-)

KA

I need urgent!!
The first people answer this question I give brainliest.

Directions:use the chart below to help answer the questions that follow

C.jeremy sister,Susie ,borrowed the money from their mom to pay for her order. The mother has agreed to deduct an equal amount of money from suzie allowance each week for the next five weeks to repay the loan . What is the weekly change in suzie allowance?

Numerical answer:

Explanation:


D. Jeremy grandparents want to change their order. They want to order three daisies and one geranium, instead of your daisies. How does this change affect the amount of their order? Explain how you arrived at your answer.


E. Jeremy approaches three people who do not want to buy any plants; however,they wish to donate some money for the fundraiser when Jeremy delivers the plants one week later. If the people promise to donate a total of $14.40, what will be the average cash donation?


F. Jeremy spends one week collecting orders.If 22 people purchase plants totaling $270,what is the average amount of Jeremy sale?

Numerical answer:

Explanation:

Answers

A) The total for the plants she buys is 8.50, so the change in her checking account would be -8.50, because they will take 8.50 out of her account when the check is cashed, the amount in her account is lowered.

B) Mr. Clark's total is 11.25. If he pays with a 20, subtract the plant total from 20:

20 - 11.25 = 8.75 is the amount of change Jeremy owes him.

The amount of money Jeremy collects would be that amount higher than what he needs.

C)  Suzie owed 2.50, divide the amount she borrowed by the number of weeks her mom is keeping money:

2.50 / 5 = 0.50

Her allowance will be 0.50 less than what she normally would get.

D) Grandparents original amount = $15.00

3 daises = 3 x 3.75 = 11.25

1 geranium = 2.25

Total for new order = 11.25 + 2.25 = 13.50

Difference = 15 - 13.50 = 1.50

The new order would be $1.50 less.

E) Divide the total amount of the donation by the number of people:

14.40 / 3 = $4.80

F) Divide total amount by total people:

270 / 22 = $12.27 average

Solve a = 2x + 6xz for x

Answers

To solve the equation a = 2x + 6xz for x, isolate x on one side of the equation by following the steps: subtract 6xz from both sides, factor out x, and divide both sides by (2 + 6z).

To solve the equation a = 2x + 6xz for x, we need to isolate x on one side of the equation. Here are the steps:

Start with the equation: a = 2x + 6xz

Subtract 6xz from both sides: a - 6xz = 2x

Factor out x on the right side: a - 6xz = x(2 + 6z)

Divide both sides by (2 + 6z): (a - 6xz) / (2 + 6z) = x

Therefore, the solution for x is x = (a - 6xz) / (2 + 6z).

For more such questions on equation, click on:

https://brainly.com/question/18322830

#SPJ2

A regular prism has two congruent rectangles as its bases. How can one base be transformed to carry onto the other?

One base must be translated to carry onto the other base


One base must be rotated to carry onto the other base


It is impossible to carry one base onto the other base


One base must be reflected to carry onto the other base

Answers

Answer:

One base must be translated to carry onto the other base

Step-by-step explanation:

A regular prism has two congruent rectangles as its bases. Since the bases of the prism are congruent and oriented the same way, neither reflection nor rotation will work to carry one base onto the other. It doesn't matter how many sides a geometric shape has.

Therefore the correct option is:

One base must be translated to carry onto the other base.

a cheetah can run 27 m per second that means that a travels 27 m in 1 second at this rate how far can it travel in 8 Seconds​

Answers

Answer:

5.4 m/s2

Step-by-step explanation:

Answer: 216 meters per 8th second

Step-by-step explanation:

do 27 times 8 it will give you 216

2 cubed minus 2 squared

Answers

Hello!

your answer is: 4

2 cubed is also written as: 2³

2 squared is also written as: 2²

so the re-written equation is: 2³ - 2²

To solve, simplify by doing the exponents.

2³ = 8

2² = 4

8 - 4 = 4

I hope this helps, and have a nice day!

For which equation would x = 12 be a solution?

12 ÷ x > 12
12 - x ≥ 4
12x < 200

Answers

Answer:

12x < 200

Step-by-step explanation:

Substitute x = 12 into the left side of the inequality and compare with right side, that is

12 ÷ 12 = 1 < 12 ← not a solution

12 - 12 = 0 < 4 ← not a solution

12 × 12 = 144 < 200 ← this is a solution

If K={(x, y) I x-y=5), is Set K a function?
Yes
No

Answers

Answer:

NO!

NO NUMBER VARIABLES CAN BE CALLED A FUNCTION

Cask’n’Cork wine shop has a markup rate of 15%. What price will the shop charge for a bottle of zinfandel wine that costs $12.48 wholesale?

Answers

Answer:$14.35

Step-by-step explanation:

The shop will charge $14.352 as markup price.

What is Equation Modelling?

Equation modelling is the process of writing a mathematical verbal expression in the form of a mathematical expression for correct analysis, observations and results of the given problem.

We have Cask’n’Cork wine shop that has a markup rate of 15%. A bottle of zinfandel wine costs $12.48 wholesale.

Assume that the shop charges $x. Then, we can write -

x = 12.48 + 15% of 12.48

x = 12.48 + (15/100) x 12.48

x = 12.48 + (3/20) x 12.48

x = 12.48 + 1.872

x = 14.352

Therefore, the shop will charge $14.352 as markup price.

To solve more questions on Equation Modelling, visit the link below -

brainly.com/question/14441381

#SPJ5

What is the equation of the line that is perpendicular to Y= -2/3X+4 and that passes through (-2,-2)?

Y= 3/2x-10/3
Y=3/3x-5
Y=3/2x+1
Y=3/2x-2/3​

Answers

Answer:

[tex]y = \frac{3}{2}x + 1[/tex]

Step-by-step explanation:

-2 = 1½[-2] + b

-3

1 = b

y = 1½x + 1

** 1½ = 3⁄2

Perpendicular Lines have OPPOSITE MULTIPLICATIVE INVERSE RATE OF CHANGES [SLOPES]:

-⅔ →

I am joyous to assist you anytime.

Answer:

y=3/2x+1

Step-by-step explanation:

You’re trying to find the perpendicular like equation of y=-2/3x+4 that passes through (-2,-2). Use reciprocal of slope -2/3= 3/2. use y=mx+b and plug in info, (-2,-2) will be plugged in for both y and x and 3/2 will be plugged in for m making -2=(3/2)(-2)+b. Multiply the () to get -2=-3+b, add 3 to both sides of the equation to get 1=b. Use your info to make the finished equation y=3/2x+1

How many user must mike recruit in order for him to steam movies for free? The service costs $43.75 a month, but mikes rate is reduced by $1.25 for each new subscriber that he gets to sign up.

Answers

Answer:

35 subscribers

Step-by-step explanation:

Divide $43.75 by $1.25.

$43.75/$1.25 = 35

For each subscriber he gets, his service goes down by $1.25.

Since 35 * $1.25 = $43.75, for 35 new subscribers, his service will go down by $43.75.

He pays $43.75, so if the service goes down by $43.75, he will pay nothing since $43.75 - $43.75 = 0.

Answer: 35 subscribers

Follow below steps:

To determine how many users Mike must recruit for him to stream movies for free, we need to set up a simple algebraic equation. Mike's service costs $43.75 per month, and for each new subscriber he recruits, his rate is reduced by $1.25. Let's say the number of users Mike needs to recruit is represented by x.

The cost reduction for recruiting x users would be $1.25x. To get a free service, the total cost reduction must equal the monthly service cost of $43.75. Thus, the equation is $1.25x = $43.75.

To solve for x, we divide both sides by $1.25:

x = $43.75 / $1.25

x = 35

Therefore, Mike must recruit 35 new subscribers to stream movies for free.

(Geometry) The answers are x = 15 and y = 9 but I don't know how. Help me understand this

Answers

Check the picture below.

[tex]\bf \stackrel{\measuredangle DAC}{4y+2x}~~=~~\stackrel{\measuredangle BCA}{9y-x}\implies 2x=5y-x\implies 3x=5y\implies \boxed{x=\cfrac{5y}{3}} \\\\[-0.35em] ~\dotfill\\\\ \stackrel{\measuredangle DAB}{[(4y+2x)+35]}~~+~~\stackrel{\measuredangle ADC}{5x+4}~~=~~180\implies 4y+2x+5x+39 = 180 \\\\\\ 4y+7x+39=180\implies 4y+7x=141\implies \stackrel{\textit{substituting "x"}}{4y+7\left( \boxed{\cfrac{5y}{3}} \right)} = 141[/tex]

[tex]\bf 4y+\cfrac{35y}{3}=141\implies \stackrel{\textit{multiplying both sides by }\stackrel{LCD}{3}}{3\left( 4y+\cfrac{35y}{3} \right)=3(141)}\implies 12y+35y=423 \\\\\\ 47y=423\implies y=\cfrac{423}{47}\implies \blacktriangleright y = 9 \blacktriangleleft \\\\[-0.35em] ~\dotfill\\\\ \stackrel{\textit{since we know that}}{x=\cfrac{5y}{3}}\implies x = \cfrac{5(9)}{3}\implies \blacktriangleright x = 15 \blacktriangleleft[/tex]

A gas engine is 6% efficient. What portion of a 12 gallon tank of gas is wasted?

Answers

Answer:

282/25

Step-by-step explanation:

[tex]efficient \: = 12 \times \frac{6}{100} \\ \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: = \frac{72}{100} \\ \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: = \frac{18}{25 } \\ so \: \\ west \: = 12- \frac{18}{25} \\ \: \: \: \: \: \: \: \: \: \: \: \: = \frac{282}{25} \: \: gallon[/tex]

plzzzz...

mark it as a brilliant answer

The wasted portion of gallon tank will be "[tex]\frac{282}{25}[/tex]". A further solution is provided below.

Given:

Efficient percent = 6%Number of gallon = 12

Now,

The efficient portion will be:

= [tex]12\times \frac{6}{100}[/tex]

= [tex]\frac{72}{100}[/tex]

= [tex]\frac{18}{25}[/tex]

hence,

The wasted portion of gallon tank will be:

= [tex]12-\frac{18}{25}[/tex]

= [tex]\frac{282}{25} \ gallon[/tex]

Learn more:

https://brainly.com/question/958478

find the slope of the line

Answers

Answer:

Undefined or No solution

Step-by-step explanation:

Because this line is a straight, vertical line, it means that the slope is undefined, or no solution. Any time you see a straight line going up and down, this will be true. However, if you see a horizonal line, this will not be true.

Which ordered pair is a solution of the equation? -3x-y=6

Answers

There are an infinite number of solutions, but some that work are (-2,0), (1,-3), and (0,-6)

The correct answer is (B) Only (-3, 3).

To determine which ordered pair is a solution of the equation, you need to substitute the values of \( x \) and \( y \) into the equation and see if it holds true. Let's check:

For option A: (-4, 4)
Substituting into the equation: \( -3(-4) - 4 - 6 = 12 - 4 - 6 = 2 \) which is not equal to 0, so it's not a solution.

For option B: (-3, 3)
Substituting into the equation: \( -3(-3) - 3 - 6 = 9 - 3 - 6 = 0 \) which is equal to 0, so it is a solution.

Thus, the correct answer is (B) Only (-3, 3).

Complete question :

Which ordered pair is a solution of the equation?

-3x-y-6

Choose 1 answer:

A Only (-4, 4)

B Only (-3, 3)

C Both (-4, 4) and (-3,3)

D Neither.

the output of a function is 7 more than 3 times the input find the input when the output is -8​

Answers

Answer:

The input is -5 when the output is -8

Step-by-step explanation:

Let

y-----> the output

x ----> the input

we know that

The linear equation that represent this problem is

[tex]y=3x+7[/tex]

so

For y=-8

substitute in the equation and solve for x

[tex]-8=3x+7[/tex]

Subtract 7 both sides

[tex]-8-7=3x\\-15=3x[/tex]

Divide by 3 both sides

[tex]x=-5[/tex]

therefore

The input is -5 when the output is -8

Markus receives dollar bills from his grandfather for on week. On the first day he received $1; on the second day he received $2, on third day he received $4, and on the fourth day he received $8. If this continues, how much money will Markus have by the end of the week?

Answers

Answer: $127

Step-by-step explanation:

5th day: 8 * 2 = 16

6th day: 16 * 2 = 32

7th day: 32 * 2 = 64

Then add all the money he got throughout the week,

1 + 2 + 4 + 8 + 16 + 32 + 64

= 127

The graph shows the relationship between the volume of a rectangular prism and the volume of a square pyramid with an identical base and height. A coordinate plane showing Prism versus Pyramid. The x-axis shows Pyramid Volume in cubic units and the y-axis shows Prism Volume in cubic units. The line starts at (0, 0) and passes through (1, 3), (2, 6) and (3, 9). What is the slope of the line?

Answers

Answer:

The slope of the line is 3

Step-by-step explanation:

we know that

A relationship between two variables, x, and y, represent a proportional variation if it can be expressed in the form [tex]y/x=k[/tex] or [tex]y=kx[/tex]

In a proportional relationship the constant of proportionality k is equal to the slope m of the line and the line passes through the origin

In this problem we have a line that passes through the origin,

so

The graph shows a proportional relation ship

[tex]k=y/x[/tex]

For (1,3) ------> [tex]k=3/1=3[/tex]

For (2,6) ------> [tex]k=6/2=3[/tex]

For (3,9) ------> [tex]k=9/3=3[/tex]

The equation is

[tex]y=3x[/tex]

The slope of the line is 3

Answer:

The slope of the line is 3.

Step-by-step explanation:

In the graph x-axis shows Pyramid Volume in cubic units and the y-axis shows Prism Volume in cubic units.

The line starts at (0, 0) and passes through (1, 3), (2, 6) and (3, 9).

If a line passes through two points [tex](x_1,y_1)[/tex] and [tex](x_2,y_2)[/tex], then the slope of the line is

[tex]m=\frac{y_2-y_1}{x_2-x_1}[/tex]

Consider any two points of the line: (0, 0) and (1, 3). So, the slope of the given line is

[tex]m=\frac{3-0}{1-0}[/tex]

[tex]m=3[/tex]

Therefore, the slope of the line is 3.

Sergei estimated 149% of 67 by performing the following steps. Which statement is true?
(70)(150%)
- (70)(100% + 50%)
- (70)(100%) + (70)(50%)
- (70)(1)+ (70) )
- 70+35
- 105
The estimate is less than the actual answer because the percent and the number were both rounded down.
The estimate is less than the actual answer because the percent and the number were both rounded up.
The estimate is greater than the actual answer because the percent and the number were both rounded down.
The estimate is greater than the actual answer because the percent and the number were both rounded up.

Answers

Answer: Last option.

Step-by-step explanation:

In order to estimate the percent "n" of a number"x", you need easy numbers to work with, therefore you can round  "n" and "x" up or down; but it is important to remember that this estimation does not give you an exact value.

You can observe that Sergei's first step was to round 149% and 67 up, getting this result:

[tex]=105[/tex]

To verify if this estimate is less or greater than the actual answer, we can find the actual answer. This is:

[tex]\frac{67*149}{100}=99.83[/tex]

Therefore, we can conclude that the estimate is greater than the actual answer because the percent and the number were both rounded up.

Answer:

D

Step-by-step explanation:

I did it on Edgen 2020

Other Questions
Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph? Consider a river flowing toward a lake at an average velocity of 3 m/s at a rate of 500m3/sat a location 90 m above the lake surface. Determine the total mechanical energy of the river water per unit mass and the power generation potential of the entire river at that location. Angelo made the decision to outsource the software components of his consulting company so he could focus on the companys ________, which are sources of competitive advantage, make a contribution to perceived customer benefits, have application in a wide variety of markets, and are difficult to imitate. Food web starting with sun and pointing to grasshopper and squirrel; Grasshopper pointing to squirrel, wolf, and snake; squirrel pointing to wolf, snake, and bird; wolf pointing to decomposition with worms and mushrooms; snake pointing to wolf and decomposition with worms and mushrooms; bird pointing to decomposition with worms and mushrooms; decomposition pointing to the sun stating soil nutrients.If we removed the decomposers from this food web, how would it affect the balance of the ecosystem? There would be an increase in dead matter and a lack of nutrients in the soil. There would be a decrease in dead matter and a lack of nutrients in the soil. There would be an increase in dead matter and an increase in nutrients in the soil. There would be a decrease in dead matter and an increase in nutrients in the soil. Which of the following would NOT be considered an investment in human capital?Aobtaining a college degreeBpurchasing a new computerCattending a first-aid classDpaying for cooking lessons For a class Foo, one difference between a variable declared Foo * and a variable declared Foo & is that only the variable declared Foo & can potentially have the value NULL.Select one:a. FALSEb. TRUE how do chemicals affect our lives? what is the region of very calm seas and little to no wind on either side of equator? Which was not one of the major disagreements that the framers faced at the Constitutional Convention?The process for adding future states to the union.Balancing the power of the large and small states.Balancing the power between the state governments and the federal government.What should be done about slavery. A construction company has built 30 houses so far this year at a total cost to the company of $7.5 million. If the company builds a 31st house, its total cost will increase to $7.76 million. Which of the following statements is correct?a. For the first 30 houses, the average cost per house was $250,000.b. The marginal cost of the 31st house, if it is built, will be $260,000.c. If the company can experience a marginal benefit of $275,000 by building the 31st house, then the company should build it.d. All of the above are correct. Adriana is a member of a culture that does not believe in birth control, but she recognizes that another culture has the right to decide about birth control because they are different. What is this an example of? At what distance from a long straight wire carrying acurrentof 5.0A is the magnitude of the magnetic field due to thewireequal to the strength of the Earth's magnetic field of about5.0 x10^-5 T? An object, initially at rest, moves with a constant acceleration of 10 m/s2. How far will it travel in (a) 2.0 s and (b) 4.0 s? If this object had an initial velocity of 4 m/s, how far will it travel in (C) 2.0 s and (d) 4.0 s?