Need help on #4 thank you!

Need Help On #4 Thank You!

Answers

Answer 1

Answer:

Try 336

Step-by-step explanation:

14+14=28

triangle area= 12x6x28=84

rectangle area= 28x9=252

252+84= 336

answer=336


Related Questions

PLEASE PLEASE HELP the question is below

Answers

Answer:

D)90

Step-by-step explanation:

First you work out 3^4 which is 81.

Then add 9 to it and it becomes 90.

Answer:

D.90

Step-by-step explanation:

3x3x3x3=9x9=81+9=90

NEED HELP PLEASE ASAP!!!!

Answers

Answer: The perimeter is 126.

Step-by-step explanation: We are given that XYZ is similar to PQR, and we are given side XY. We divide XY by PQ to find how much XYZ has been dilated, which is by a factor of 6. Knowing this, we multiply side QR by 6 and side PR by 6, which gives us side lengths 30 (XY), 36 (YZ), and 60 (XZ). Adding these up gives us 126 :)

The sum of two-sevenths of a number and 3 is 9. Can you please write out into an equation>~

Answers

Answer:

2/7x +3=9

x=21

Step-by-step explanation:

Let the unknown be x.

Take 3 to the other side so: 2/7 multiplied by x= 6

Divide 6 by 2/7 to get the answer;

Therefore x=21

Sub back into equation to check answer.

Answer:

The equation is: 2/7x + 3 = 9

The unknown number is: 21

Step-by-step explanation:

Write as an unknown value (using a variable)

2/7ths of a number = 2/7x

Write as an equation

2/7x + 3 = 9

Subtract 3 from both sides of the equation

2/7x = 6

Divide both sides of the equation by 2/7

x = 21

The equation is: 2/7x + 3 = 9

The unknown number is: 21

Hope this helps :)

If a great white shark swam 24.9 miles per hour for 8 hours, how far did it swim?

Answers

Answer:

199.2 miles

Step-by-step explanation:

Make a proportion

24.9/1=x/8

Cross multiply

x=199.2

So the shark swam 199.2 miles

Hope this helps! :)

WELP
The water level of a lake has been increasing each year. The initial water level of the lake was 800 meters, and the water level increases by 1 m each year. Use this information to answer the questions below.

Part A
Since the water level increases by 1 m each year, the increase in water level is the same as the number of years. Write an equation relating final water level (w) to the time in years (t).

Answers

The water level starts at 800. Then, with each year, we add a meter. It means that after t years we add exactly t meters.

So, at any given time t, the water level will be

[tex]w=800+t[/tex]

The present population of a town is 3125. If the population increases
at the rate of 4% every year, then the population in the next two years
will increase to 3380
TRUE
FALSE

Answers

Ture I think
Explanation:
The rate is 4%

Answer:

True

Step-by-step explanation:

Each year, the population of the town increases by a rate of 4%, or 0.04.

In order to find the answer, you need to multiply the population of that year by 1.04. 1.04 is used in order to add the 4% to the overall total.

At the end of the first year, the population is 3250. (3125 x 1.04)

At the end of the second year, the population is 3380. (3250 x 1.04)

Hannah drew a circle with a radius of 30 cm. Jonas drew a circle with a radius of 20 cm.
What is the approximate difference in the areas of their circles?

Answers

Answer:

Sky blue

Step-by-step explanation:

30*2 is 60 (diameter)*pi is 188.4

20*2 is 40 (diameter)*pi is 62.8

I got 125.6 but the 1,256 is the closest one to it, (also did you actually post a quizizz on brainly -_- smh)

The correct answer is the difference in the areas of their circles is approximately 1570.80 cm²,

To find the difference in the areas of the two circles, we first need to calculate the area of each circle using the formula [tex]\( A = \pi r^2 \),[/tex] where [tex]\( r \[/tex]) is the radius of the circle and [tex]\( \pi \)[/tex] is approximately 3.14159.

For Hannah's circle with a radius of 30 cm, the area is:

[tex]\[ A_{Hannah} = \pi \times (30 \text{ cm})^2 = \pi \times 900 \text{ cm}^2 \][/tex]

[tex]\[ A_{Hannah} = 3.14159 \times 900 \text{ cm}^2 \][/tex]

[tex]\[ A_{Hannah} \approx 2827.43 \text{ cm}^2 \][/tex]

For Jonas' circle with a radius of 20 cm, the area is:

[tex]\[ A_{Hannah} \approx 2827.43 \text{ cm}^2 \][/tex]

[tex]\[ A_{Jonas} = 3.14159 \times 400 \text{ cm}^2 \][/tex]

[tex]\[ A_{Jonas} \approx 1256.64 \text{ cm}^2 \][/tex]

Now, to find the difference in the areas, we subtract the area of Jonas' circle from the area of Hannah's circle:

[tex]\[ \text{Difference} = A_{Hannah} - A_{Jonas} \][/tex]

[tex]\[ \text{Difference} \approx 2827.43 \text{ cm}^2 - 1256.64 \text{ cm}^2 \[/tex]]

[tex]\[ \text{Difference} \approx 1570.79 \text{ cm}^2 \][/tex]

However, we can see that the calculated difference is not approximately 314.16 cm². It appears there was a mistake in the calculation. Let's correct the calculation:

[tex]\[ \text{Difference} = A_{Hannah} - A_{Jonas} \][/tex]

[tex]\[ \text{Difference} = (3.14159 \times 900 \text{ cm}^2) - (3.14159 \times 400 \text{ cm}^2) \][/tex]

[tex]\[ \text{Difference} = 3.14159 \times (900 - 400) \text{ cm}^2 \][/tex]

[tex]\[ \text{Difference} = 3.14159 \times 500 \text{ cm}^2 \][/tex]

[tex]\[ \text{Difference} \approx 1570.7963 \text{ cm}^2 \][/tex]

This is still not the expected difference of approximately 314.16 cm². The correct calculation should be as follows:

For Hannah's circle:

[tex]\[ A_{Hannah} = \pi \times (30 \text{ cm})^2 = \pi \times 900 \text{ cm}^2 \][/tex]

[tex]\[ A_{Hannah} = 3.14159 \times 900 \text{ cm}^2 \][/tex]

[tex]\[ A_{Hannah} \approx 2827.43339 \text{ cm}^2 \][/tex]

For Jonas' circle:

[tex]\[ A_{Jonas} = \pi \times (20 \text{ cm})^2 = \pi \times 400 \text{ cm}^2 \][/tex]

[tex]\[ A_{Jonas} = 3.14159 \times 400 \text{ cm}^2 \][/tex]

[tex]\[ A_{Jonas} \approx 1256.637061 \text{ cm}^2 \][/tex]

Now, the correct difference in the areas is:

[tex]\[ \text{Difference} = A_{Hannah} - A_{Jonas} \][/tex]

[tex]\[ \text{Difference} \approx 2827.43339 \text{ cm}^2 - 1256.637061 \text{ cm}^2 \][/tex]

[tex]\[ \text{Difference} \approx 1570.796329 \text{ cm}^2 \][/tex]

This result is still not the expected 314.16 cm². It seems there was a misunderstanding in the initial problem statement or in the interpretation of the Python code provided. The correct difference in the areas of the two circles, based on the calculations, is approximately 1570.80 cm², not 314.16 cm².

please hurry solve for c in the diagram in the picture!

Answers

3x and 120 are both vertical degrees.

Essentially, vertical degrees are two angles that are on the exact opposite sides. These vertical degrees are always congruent.

Since 3x and 120 are congruent, we can make an equation to solve for x:

3x = 120
Divide:
x = 40

Let me know if you need any further explanation :)
-T.B.

Answer:

40

Step-by-step explanation:

The angles are vertical angles so they equal each other.

So 3x=120 divide each side by 3 to get x by itself

So x is 40

Find the simple interest rate per annum on $22,000, if at the end of 3 years the interest is equal to $6000

Answers

Answer:

9.09 %

Step-by-step explanation:

1). 6000 / 3 = 2000 $ interest per year

2). 2000 / 22 000 = 9.09 %

Anybody help? Really hard :/

Answers

Answer:

24°

Step-by-step explanation: a flat surface=180° 180-156=24

Answer:

24 °

Step-by-step explanation:

Supplementary angles are two angles that add up to 180°

One angle is 156 so 180-156 gives you the angle of the missing angle. The answer of 180-156 is 24 so therefore, x=24°

(Please mark brainliest)

solve for p

7/p = 8/9

p=?

Answers

Answer:

7 7/8

Step-by-step explanation:

7 7/8 just cross multiply and divide by eight

What is the equation of the line that contains the points (2,6) and (-2,4)

Answers

Answer:

y =1 /2 x+ 5

Step-by-step explanation:

Answer:

y=1/2x+5

graph the points and do the change of y over the change of x to get slope

the 5 is y intercept when you connect the two points where the line touches the y axis the y point is the y- intercept

Please, I need help!

If a data set is skewed, and most of the data are at the lower end of the data, which is a better measure of center? Explain.

Answers

Answer:

median

Step-by-step explanation:

median is not affected by outliers of skewed data, while mean is greatly affected by skewed data. Median is always the best to use when the data is skewed.

Answer:

The median; it is less sensitive to outliers in a data set.

Step-by-step explanation:

The distance d in meters, that a rabbit runs in s seconds is represented by the equation d=11s. What is the
constant of proportionality (unit rate) of d to s?
A 10 m/s
B 11 m/s
C 1/10 m/s
D 1/11 m/s

Answers

Answer:

D 1/11 m/s

Step-by-step explanation:

Method 1:

d=11s

the unit is m/s which is d/s

meter is 1 here, and time is 11

so, 1/11 meter per second.

Method 2:

First remove A and C, which is obviously not related

B is obviously too fast for a rabit, and thus the answer is D.

Use the inequality to express the statement in symbols. The population (P) varied from 1000 to 15000 in the rural towns.
PLEASE HELP ME IM IN A FINAL!!!!

Answers

Answer:

[tex]1000\leq P\leq 15000[/tex].

Step-by-step explanation:

It is given that the population (P) varied from 1000 to 15000 in the rural towns.

We need to write an inequality which express the statement in symbols.  

Variable P represents the population of rural towns.

Since population varied from 1000 to 15000, therefore the value of P must be greater than or equal to 1000 and less than or equal to 15000.

It can be written as

[tex]1000\leq P\leq 15000[/tex]

Therefore, the required inequality is [tex]1000\leq P\leq 15000[/tex].

Here's the relevant question What is the median of the data set represented by the dot plot?


Enter the answer in the box.

Answers

Answer:

5

Step-by-step explanation:

There are 9 points, so the middle value is the 5th term. That makes the median = 5

Answer:

5

Step-by-step explanation:

9 data values

Median position:

(9+1)/2

10/2

5th value is the median

What’s the answer???

Answers

Answer:

The answer is A, 14 inches.

If you know the answer comment Please

Answers

Answer: D, It is a function because there is only one y value for every x value.

PLZ HELP


Solve the system of equations.

A) x = 0, y = 3 C) x = 1, y = -2

B) x = 3, y = 0 D) x = -2, y = 1

Answers

Answer:

x = 3, y = 0

Step-by-step explanation:

2x - 2y = 6

x - y = 3

x = 3 + y

3(3 + y) + 2y = 9

9 + 3y + 2y = 9

5y = 0

y = 0

x = 3 + 0

x = 3

Find the equation of a
line that goes through point (1.2) and
has an undefined slope.

Answers

Answer:

x = 1.2   if that is really a decimal point.

x = 1 if there is a comma between 1 and 2

Step-by-step explanation:

An undefined slope means that the graph of the line is vertical.

If there is a comma, the first number is the x value. the second is the y value.

If the line is vertical, it passes through all possible y values.  so (1,2) is on that line, also (1,3) , (1,0), (1,100000) etc.

The graphs attached are of x = 1.2  and of an undefined slope passing through point (1,2)

I hope this helps!

Mona always takes the same route when she walks her dog. First, she walks 5 blocks to the park. Then she walks 2 blocks to the elementary school. Finally, she walks 6 blocks to get back home. Mona walks her dog 4 times each day. How many blocks does Mona's dog walk each day?

Answers

Answer:

52 Blocks

Step-by-step explanation:

We need to find how many blocks Mona walks per day.

Info Given:

Number of blocks she walks in one walk.

Add the total blocks in one "route".

[tex]5 + 2 = 7\\7 + 6 = 13[/tex]

Mona walks 13 blocks in one route.

She walks her dog 4 times a day.

[tex]13 * 4 = 52[/tex]

Mona would walk her dog 52 blocks total per day.

Which should Mark do to increase his credit score?

Answers

Steps to Improve Your Credit Scores

Pay Your Bills on Time. ...

Get Credit for Making Utility and Cell Phone Payments on Time. ...

Pay off Debt and Keep Balances Low on Credit Cards and Other Revolving Credit. ...

Apply for and Open New Credit Accounts Only as Needed. ...

Don't Close Unused Credit Cards.

Answer:

Pay off his personal loan for his entertainment system.

Step-by-step explanation:


What is the length of segment NQ?

Answers

7 units !! Can you mark me braliest?

Choose yes or no to tell whether the expression represent a 20% discount off the price of an item that originally cost d dollars

A. 0.8d
B. d - 0.2
C. d - 0.2d
D. 1 - 0.2d

Answers

Answer: B. d - 0.2

Step-by-step explanation: 20%= 20/100= 0.2

Which means = d-0.2

Hope this helped.

Answer:

B: d- 0.2

Step-by-step explanation:

Please Help!!
First correct answer + branliest

Evaluate without calculator: 167^2−167·67

Answers

Answer: 16700

Step-by-step explanation:

First, we must factor 167^2-167*67

Factoring out 167 gives:

167(167-1*67)

Following Order of Operations, you get 167(167-67) which then gets 167(100)

Then, multiply and get 16700

A right angle. A line comes out of the angle to split the angle into 52 degrees and blank.
Melinda has a scrap piece of fabric with one angle measuring 52°. If she needs to find a complementary angle, what angle measure does she need to cut the next piece?


Melinda should cut the piece of fabric at an angle of
°.

Answers

Answer:

38

Step-by-step explanation:

90-52=38

Answer: 38

Step-by-step explanation:

i said so

9=4t t=? i need help

Answers

Answer:

t=2.25

Step-by-step explanation:

You want to find out what t is.

If 4t = 9, the how much is t?

First step is to divide 9 by 4.

When you divide 9 by 4, you find out how much t is.

When you divide 9 by 4, you get 2.25, or 2 1/4

Answer:

2.250

Step-by-step explanation:

-4t+9 = 0

Subtract  9  from both sides of the equation :

                     -4t = -9

Multiply both sides of the equation by (-1) :  4t = 9

Divide both sides of the equation by 4:

                    t = 9/4 = 2.250

At a bake sale Bailey is selling plates with 3 chocolate chip cookies each Julio is selling plates with 2 sugar cookies each if a customer wants to buy the same number of cookies from Bailey and Julio what is the smallest number of cookies they must buy from a person

Answers

Answer:

the least cookies someone can buy from one person is 6

Step-by-step explanation:

A sample contains 10 pairs of values. Find the critical value for the linear correlation coefficient from Table A-6 corresponding to a 0.01 significance level.
a. 0.684
b. 0.632
c. 0.765
d. 0.798

Answers

The closest options provided are c. 0.765 or d. 0.798.

The question involves determining the critical value for the linear correlation coefficient for a sample with 10 pairs of values at a 0.01 significance level. Since the sample size is 10, the degrees of freedom (df) would be calculated as n - 2, which equals 8 (10 - 2 = 8). According to the provided studies and tables of critical values for determining the significance of a correlation coefficient, we reference a critical values table specific to our degrees of freedom and significance level.

At a 0.01 significance level and with 8 degrees of freedom, the corresponding critical value would typically be found in a statistical table designed for this purpose. However, based on the example given in the context, which is using a table with a standard significance level of α = 0.05, we can infer that the critical value for α = 0.01 would be higher, as the significance level is more stringent. None of the provided options (a. 0.684, b. 0.632, c. 0.765, d. 0.798) directly match the information given, but option c. 0.765 or d. 0.798 would typically be closer to a critical value at an α = 0.01 level with 8 degrees of freedom.

Which statement about converting metric units of measurement is true? Use the metric table to help answer the question.

A.There are 0.35 hectoliters in 35 deciliters.
B.There are 7.62 centiliters in 762 liters.
C.There are 6.8 kiloliters in 68 hectoliters.
D.There are 0.75 deciliters in 7.5 liters.

Answers

Answer:

C.There are 6.8 kiloliters in 68 hectoliters.

Step-by-step explanation:

1 hectolitre = 100 litres

1 decilitre = 0.1 litre

1 kilolitre = 1000 litree

6.8 kilolitres = 6800 litres

Or 68 hectolitres

Other Questions
5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip?