Pedro has 9 coins. His friend John gives him 9 more coins. Pedro decides to share his coins evenly with his two brothers. Which expression shows how many coins each brother will get

Answers

Answer 1

Answer:

6 if pedro and his two brother will have coins. If he doesnt get any for himself and gives it all to his brothers then they each get 9.

Step-by-step explanation:

I used my calculator.


Related Questions

CB is tangent to ⊙A at point C. Find the radius.

Circle A is shown. Line segment A C is a radii. Line segment B C is a tangent and it intersects with the circle at point C. A line is drawn from point B to point A and a point is drawn where the line intersects with the circle. The length of the radius is r, the length of C B is 8, and the length of B to the circle is 5.

CB ⊥ AC by the radius-tangent theorem, so ∠C is a right angle.

ΔABC is a right triangle, so apply the Pythagorean theorem.

Use the steps and solve for the radius.

r2 + 82 = (r + 5)2
r2 + 64 = r2 + 10r + 25

Answers

Answer:

The Answer is 39/10! I Did The Assignment!

Step-by-step explanation:

The radius is 3.9 units

What is radius of circle?

In geometry, the radius is defined as a line segment joining the center of the circle or a sphere to its circumference or boundary. It is an important part of circles and spheres which is generally abbreviated as 'r'. The plural of radius is "radii" which is used when we talk about more than one radius at a time. The largest line segment in a circle or sphere joining any points lying on the opposite side of the center is the diameter, and the length of the radius is half of the length of the diameter. It can be expressed as d/2, where 'd' is the diameter of the circle or sphere. Look at the image of a circle given below showing the relationship between radius and diameter.

given:

As, CB ⊥ AC by the radius-tangent theorem.

In ΔABC, applying the Pythagoras theorem

r² + 8² = (r+ 5)²

r² + 64= r² + 25 + 10 r

64 - 25 = 10 r

39 = 10r

r= 39/10

r= 3.9 units

Hence, the radius is 3.9 units.

Learn more about this concept here:

https://brainly.com/question/23051193

#SPJ2

5x - y ÷ 8 when x = 5 and y = 8

Answers

Answer:

24

Step-by-step explanation:

5x - y ÷ 8

Let x=5 and y=8

5(5) -8÷8

PEMDAS

multiply and divide from left to right

25 -8÷8

25 -1

Then add and subtract

24

24

Step-by-step explanation:

First I replaced x and y so the equation was:

5(5)-8/8

multiply 5*5

25-8/8

25-1

When you subtract the answer is 24

And I solved this equation using PEMDAS!

Hope that helps!!

What is the solution to the proportion 6/11 = m/121

Answers

Answer:

m=66

Step-by-step explanation:

Answer:

m=66

Step-by-step explanation:

Convert the following to find the unknown measure.
1) 42 Km = ?
miles
2) 37 oz = ?
grams
3) 15.3 L = ?
Quarts

Answers

Answer:

1) 42 Km = 26.0976 miles

2) 37 oz = 1048.93 grams

3) 15.3 L = 16.16733 quarts

Answer:

1. 26.0976

2. 1048.93

3. 16.16733

Yol drove 390.25 miles back home to surprise his brother for his birthday. The drive took 7 hours. What was Yol's average speed for the trip, in miles per hour?

Answers

Answer:

55.75 miles/hour is the average speed

Step-by-step explanation:

In this question, we are asked to calculate the average speed attained by Yol if he traveled a certain distance within a given time frame.

To calculate his average speed, what we do is to divide the distance travelled by Yol by the number of hours he traveled.

mathematically what we are saying is that

Average speed = Total distance/ Total time

From the question, the distance is 390.25 miles while the time is 7 hours

we now input these values

Average speed = 390.25/7 = 55.75 miles per hour is the average speed

what is the answer to this?

Answers

I think the answer is B

A presidential candidate plans to begin her campaign by visiting the capitals of 5 of the 50 states. If the five capitals are randomly selected without replacement, what is the probability that the route is Sacramento, Albany, Juneau, Hartford, and Bismarck, in that order?

Answers

Answer:

The probability is 1/254,251,200

Step-by-step explanation:

We proceed as follows;

Firstly, we are selecting 5 state capitals out of 50. The number of ways we can do this is 50P5 = 50!/5!(50-5)! = 254,251,200 ways

Now, out of this number of ways , only one route is desired in that particular order.

This means the probability of having the route scheduled in that particular order would be;

1/254,251,200

Answer:

0.000000003933

Step-by-step explanation:

As the candidate will visit the capitals of 5 of the 50 states, the probability of each capital being selected is 1/50.

As we want a probability of 5 specific capitals in a specific order, we can calculate the probability of each capital being chosed:

First city being Sacramento: Probability of 1/50

Second city being Albany: Probability of 1/49 (as the first city is not available now)

Third city being Juneau: Probability of 1/48

Fourth city being Hartford: Probability of 1/47

Fifth city being Bismarck: Probability of 1/46

So the final probability is 1/(50*49*48*47*46) = 0.000000003933

A bag contains 5 red balls 3 green beads and 2 blue beads if three beads are picked from the bag at radnom without replacement what is the probability that the beads that are picked are all different colors?

Answers

Answer:

1/4 or 0.25

Step-by-step explanation:

please kindly check the attached files for details

6c + 14 = -5c + 4 + 9c solve for c

Answers

Answer:

-5

Step-by-step explanation:

6c + 14 = -5c + 4 + 9c

6c + 14 = 4c + 4

- 4. - 4

--------------------------

6c + 10 = 4c

- 6c - 6c

-----------------------

10 = -2c

--------------

-2. -2

C = -5

Answer:

-5 = c

Step-by-step explanation:

Step 1

6c + 14 = -5c + 4 + 9c

subtract 4 to the other side, then subtract 6c to the opposing side

ex: 14-4 = -5c -6c +9c

then combined..   10= -2c

Step 2

divide -2 from 10 to solve for c.

ex: 10/-2 = c

solve... -5 = c

The roof of the house down the road is in the shape of a square pyramid. The length from the gutter to the top is ퟏퟓ풇풕.and the length of gutter on one side is ퟏퟖ풇풕.with no overlap. One bundle of shingles covers ퟐퟓsquare feet. How many bundles should you buy to cover

Answers

Answer:

Therefore, the number of bundles to be bought is 22 bundles

Step-by-step explanation:

Here we have;

Dimensions of roof

Square pyramid = 4 triangular sides

Base length of triangle = Length of gutter on one side = 18 ft

Height of triangle = Length from the gutter on one side to the top of the roof = 15 ft

∴ Area of one of the four triangles = 0.5 × Base × Height = 0.5 × 15 × 18 = 135 ft²

Total area of four sides of the pyramid = 4 × Area of one of the four triangles

∴ Total area of four sides of the pyramid = 4 × 135 ft² = 540 ft²

Area covered by one bundle of shingle = 25 ft²/bundle

Therefore number of bundles of shingles required = [tex]\frac{Total \, area \ of \, four \ sides \ of \ the \ pyramid}{Area \ covered \ by \ one \ bundle \ of \ shingle} = \frac{540 \ ft^2}{25 \ ft^2/bundle} = 21.6 \ bundles \approx 22 \ bundles[/tex]

Therefore, the number of bundles to be bought = 22 bundles.



A three-character code uses the letters D and Q. Either of the letters may be repeated.



​ Find the probability of a code with exactly two D’s.

Answers

Answer:

1/1 x 1/2 x 1/2 = 1/4

One times One-Half times One-Half Equals One-Fourth

The Probability is 1/4 or One-Fourth.

Step-by-step explanation:

There is a One-Half possibility on two of them for choosing D.

Multiply that by each other and than by 1.

What is the length of the missing leg?
15 m/
9 m
meters

Answers

I got you it is 12 square 144 it gives you 12

Answer:

The length of the missing leg is approximately 17.49 meters.

Explanation:

To find the length of the missing leg in a right triangle, you can use the Pythagorean theorem, which states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the lengths of the other two sides.

So, if one leg(hypotenuse) is 15 meters and the other leg(base) is 9 meters, and we denote the missing leg as [tex]\(x\)[/tex] meters, we have:

[tex]\[x^2 + 9^2 = 15^2\][/tex]

[tex]\[x^2 + 81 = 225\][/tex]

[tex]\[x^2 =144 \][/tex]

Now, to find [tex]\(x\)[/tex] , we take the square root of both sides:

[tex]\[x = \sqrt{144}\][/tex]

[tex]\[x = 12\][/tex]

Question:

A right triangle's leg is 9 and the hypotenuse is 15, what is the other leg s length?

Johnny is trying to figure out how many miles he rode on his bike today.
He knows his bike uses wheels that are 30" tall, and it takes him 1 second
for it to make one complete revolution. If he rode for 1 hour and 11
minutes, how many miles did he ride? Use 3.14 for pi and round your
answer to the nearest mile.(Please note that 60 seconds = 1 minute, 60
minutes = 1 hour, 12" = 1 ft, and 5,280 ft = 1 mile).
PLEASE HELP !

Answers

Answer:

   6 miles

Step-by-step explanation:

The time Johnny rode was ...

  1 h 11 min = (60 min) +(11 min) = 71 min = 71 × (60 sec) = 4260 sec

The distance of one revolution of the bike tire is ...

 C = πd = 3.14(30 in) = 94.2 in

So, the total distance Johnny rode was ...

 (4260 sec)×(94.2 in/sec) = 401,292 in

__

We know there are 5280 feet in a mile, and each of those is 12 inches. So, the number of inches in a mile is ...

  5280 ft = 5280×(12 in) = 63,360 in

__

The number of miles Johnny rode can be found by dividing the total distance by the distance in 1 mile:

  (401,292 in)/(63,360 in/mile) = 6.33 mile

Johnny rode about 6 miles in 1 hour 11 minutes.

What is the x axis label what is the y axis label the order pair ????? Is found in the scatter plot

Answers

Answer:

AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR TT UU VV WW XX YY ZZ

Step-by-step explanation:

Answer:

height goes on the  x–axis and, arm span goes on the y-axis, and the order pair is (30,27)

Step-by-step explanation:

Chef Selena is making her special dish that requires pasta, sauce, and onions.
She has 5 1/8 pounds of pasta, 6 pounds of sauce, and 47/8 pounds of onions.
How many servings of her dish can she make if each serving is 12 pounds?
Which two equations are needed to solve the problem?

Answers

Answer:

4/3 servings or her dish can be made

These are the 2 equations:

Total = 5 and 1/8 pounds + 6 pounds + 4 and 7/8 pounds

N = Total / 10

Step-by-step explanation:

We know 1 serving = 12 pounds

We want the number of servings able to make. call it N

N =  (Total pounds)/ (12 pounds/serving)

P = pasta per serving

S = sauce per serving

O= onions per serving

It appears that  

P*N = 5 and 1/8 pounds

S*N = 6 pounds

O*N  = 4 and 7/8 pounds

5 and 1/8 + 6 + 4 and 7/8 = Total

16 pounds total.

N = 16/12 = 4/3 servings

Total = 5 and 1/8 pounds + 6 pounds + 4 and 7/8 pounds

N = Total / 10

The tiles below represent the polynomial, what is the factorization of 2x2 + 7x + 6

Answers

Answer:d

Step-by-step explanation: just factor it out

The factorisation of the given polynomial is (x+2)(2x+3). Therefore, option D is the correct answer.

The given polynomial is 2x²+ 7x + 6.

We need to factorise the given polynomial.

How to factorise the quadratic polynomials?

In order to factorise a quadratic algebraic expression in the form ax² + bx + c into double brackets:

Multiply the end numbers together ( a and c ) then write out the factor pairs of this new number in order.We need a pair of factors that + to give the middle number ( b ) and x to give this new number.Group the terms and take common factors out.

Now, 2x²+ 7x + 6=2x²+ 4x +3x+ 6

=2x(x+2)+3(x+2)

=(x+2)(2x+3)

Therefore, option D is the correct answer.

To learn more about the factorisation visit:

https://brainly.com/question/20293447.

#SPJ2

The art and science of​ gathering, analyzing, and making inferences​ (predictions) from numerical information obtained in an experiment is called

Answers

Answer:

Statistics

Step-by-step explanation:

Statistics is the science of collecting and analysing numerical data in large quantities from a sample.

PLEASE HELP! I NEED TO DO THIS!! FOR 15 POINTS!!
Identify the slope and a point from the equation:


My Answer was X = (5, -7)
I think I'm wrong, please help!!

Answers

Answer:

m = 1/2  point (5, -7)

Step-by-step explanation:

The equation is in point slope from

y - y1 = m(x-x1)

where m is the slope and (x1,y1) is a point on the line

y+7 = 1/2(x-5)

Rewriting

y - -7 = 1/2 (x - 5)

We can see that 1/2 is the slope and (5, -7) is a point on the line

Answer:

a)

Step-by-step explanation:

y - y1 = m(x - x1)

m = ½

Point: (5,-7)

2. You put $3,800 dollars in a savings account. The bank will provide 1.8% interest every year. Write and solve a model that describes how much money will be in the account in 15 years.

Answers

Answer:

The money that will be in her account in 15 years is $4965.84

Step-by-step explanation:

Given data

Principal p= $3800

rate r= 1.8% - - - - - - 1.8/100=0.018

Time t= 15 years

Final amount A=?

The model that describes the e amount in the account is the compound interest model

A = P(1 + r)^t

Substituting our given data into this model we have

A= 3800(1+0.018)^1 5

A=3800(1.018)^15

A=3800*1.3068

A= $4965.84

A submarine dives as shown in the diagram.


To the nearest degree, determine the dive angle whose measure is x.

Answers

Answer:

Tan x = 125/500= 0.25

so x = arctan (0.25)

=14 degree

The measure of the diving angle is 14°.

What are trigonometric identities?

There are three commonly used trigonometric identities.

Sin x = Perpendicular / Hypotenuse

Cosec = Hypotenuse / Perpendicular

Cos x = Base / Hypotenuse

Sec x = Hypotenuse / Base

Tan x = Perpendicular / Base

Cot x = Base / Perpendicular

We have,

Sea level and 500 ft are parallel.

This means,

x° and end drive angles are alternate angles.

So,

tan x = 125/500

tan x = 0.25

x = [tex]tan^{-1}[/tex] (0.25)

x = 14°

Thus,

The measure of the diving angle is 14°.

Learn more about trigonometric identities here:

https://brainly.com/question/14746686

#SPJ3

how do i calculate the height of a parallelogram?

Answers

Answer:

A/b = Area/base

Step-by-step explanation:

1)If area of the parallelogram has been given :

Area of a parallelogram = bxh

Area of a parallelogram/b = h

2) And if the measure of the sides is given then use Pythagoras theorem to find the height

Hope this will help u mate

7 3/4 divide 1/3 kjkgcccccccccccccccffffffhhhhhhhhhhhhhhhhhhhhhhffffffffffffffhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg

Answers

Answer:

23 1/4

Step-by-step explanation:

factor the expression 3x^2 - 6x

Answers

Answer:

3x(x-2)

Step-by-step explanation:

1. find out the common factor in each components which is 3x

2. done.

To the nearest tenth percent, how many students played for exactly 4 hours?

Answers

How many students were there


Which is the correct classificatio
irrational number, 0.375
irrational number, 0,375
rational number, 0375
rational number, 0.375

Answers

Answer:

d

Step-by-step explanation:

D. Rational number, 0.375

I Got it Right

Hope i Helped ❤

Experience shows that a ski lodge will be full (153 guests) if there is a heavy snow fall while only partially full (62 guests) with a light snow fall. What is the expected number of guests if the probability for a heavy snow fall is .40

Answers

Answer:The expected number of guests if the probability for a heavy snow fall is .40 = 98.4

Step-by-step explanation:

The total number of guests for lodge to be full = 153

During heavy snow fall, the lodge will be full.

The expected number of guests during heavy snow fall = 153

During partial snow fall, the expected number of guests = 62

The probability of heavy snowfall = 0.4

The probability of partial snow fall = 1 - 0.4 = 0.6

The expected number of guests = [(0.4) (153)] + [(0.6) (62)]

= 61.2 + 37.2

 =  98.4

can someone help me find x pleaseeee

Answers

You can use the pythagoras’ theorem and just look at one right triangle.
The dimensions for one of the right triangles is (x/2), 8, and square root of 80.

a^2 + b^c = c^2
when c is the square root of 80.

Plug everything in
(x/2)^2 + 8^2 = (square root of 80)^2

That is equivalent to
((x^2)/4) + 64 = 80

Solve for x
((x^2)/4) = 16

Multiple by 4 on each side
x^2 = 64

Take the square root and you have you’re final answer
x = 8

Figure ABCD has vertices A(−3, 2), B(2, 2), C(2, −4), and D(−3, −2). What is the area of figure ABCD?

Answers

Answer:

30 units

Step-by-step explanation:

In order to find the side lengths, you can either draw it out, or imagine it in your head. I would recommend drawing it if you're unfamiliar to the topic.

So when you draw it out, you see that AB is the width of the rectangle, and BC is the length.

In order to calculate it, you'd have to keep in mind which direction each line goes. Since AB is horizontal, we would use the x coordinates to find the length. [tex]x_{1}[/tex]-[tex]x_{2}[/tex] is the formula, where A is [tex]x_{2}[/tex], since it is farther left.

width = 2 - (-3)

w = 5

Now, you'd do the same thing, but with BC, and [tex]y_{1}[/tex]-[tex]y_{2}[/tex]. In this case, B is [tex]y_{1}[/tex], since it is further up.

length = 2 - (-4)

l = 6

Now, multiply them to find the area of a rectangle.

5 x 6 = 30

I hope this helps!

What is the length of side AB of parallelogram ABCD?
units

Answers

Answer:

8 units

Step-by-step explanation:

did the assignment

Answer:

8

Step-by-step explanation:

Write an equation with slope of 2/3 and y intercept of -3

Answers

Answer:

y = [tex]\frac{2}{3}[/tex]x - 3

Slope-intercept form:  y = mx + b

(m is the slope, b is the y-intercept or the y value when x = 0 --> (0, y) or the point where the line crosses through the y-axis)

You know:

m = 2/3

b = -3      So substitute/plug it into the equation

y = mx + b

[tex]y=\frac{2}{3}x-3[/tex]

Other Questions
What are two causes of soil loss? Jana made a table to help her review the types of mutations for an exam. She started with the sequence THE MAN SAT TALL. Which statement best describes Janas error in the table? The insertion sequence should be the deletion sequence. The substitution sequence should be the insertion sequence. The insertion and deletion sequences should be switched. The substitution and deletion sequences should be switched. This group was formed in the Georgia General Assembly in 1960 for the purpose of gathering public reaction to Federal orders to integrate public schools within the state. From the Khan Academy Video on Impact of Media Evolution on Politics (Slide #2), what example of early newspapers influenced the ratification (passing) of our US Constitution? (Hint: we learned this earlier in the yearwhat group believed in a Strong Central Government?) What are the three domains of life?Plantae, Animalia, and Fungiclass, kingdom, and phylumEubacteria, family, and EukaryaBacteria, Archaea, and Eukarya 5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in