*PLEASE HELP WILL GIVE BRAINLIEST*

1. Good sleep habits can have many positive outcomes in addition to supporting good physical health. Describe two such additional benefits. Include specific examples to support you descriptions.

2. A balanced diet helps you obtain all the necessary nutrients.

a. Identify a vitamin or mineral that is typically a shortfall nutrient.

b. Explain how you can meet the need for this nutrient.

c. Describe how obtaining sufficient amounts of this nutrient can prevent disease.

Answers

Answer 1
1 good sleeping habits can give you more energy during the day and a study has found a link between insufficient sleep and some serious health problems, such as heart disease, heart attacks, diabetes, and obesity.
2 false a balanced diet can not give you all the nessesary nutrients. A. shortfall nutritents include vitamin A, vitamin E, magnesium, folate, iron, potassium, vitamin D, and calcium. B...You could take vitamins supplements which can give your body enough of these vitamins.C.. having enough proper vitamins can help prenvent lots of diseases like Rickets. Vitamin D deficiency is often associated with rickets , a disease that causes the softening of bones in children usually resulting in fractures and deformities, also Scurvy a disease to be directly linked to a vitamin deficiency.

Related Questions

Cindy's exercise routine consists of lifting weights every other day. While she can bench press more than her body weight, she has trouble keeping up with her friend Sandra on bike rides. In a couple of sentences, explain what Cindy can do in her training to increase her muscular endurance. Can someone help me answer this please

Answers

Muscular endurance analyses include energy to some extent. If you have very weak top figure tissues, you’re going to have a tough period exerting yourself up. Hence you may only be ready to do a couple of push ups before everything crumbles out.

To improve muscular endurance you must repeatedly work and contract the muscle groups you aim to develop. Circuit training involves body weight exercise such as sit-ups, press-ups, and squat thrusts.

When you have good ________, you are able to flex, extend, and rotate your spine. core endurance muscular flexibility muscular control core strength

Answers

The correct answer is core strength

The core refers to an area of the body that includes the mid-section, abdominal area, your sides, and your back. A person with good core strength is able to stabilize, flex, extend and rotate these mid-section areas, including their spine. 

Answer: core strength

When you have good core strength, your core muscles are strong, including your abdominal muscles, back muscles and those around the pelvis. You are able to flex, extend, and rotate your spine. Core-strength exercises are usually done on a carpeted floor or mat.

On average how many calories of food do we eat w no important nutrients per day

Answers

On average, a woman needs to eat 2000 calories per day, and a man needs to eat 2500.
Hopes this helps, please mark brainliest.

What are three essential tasks required from an effective multidisciplinary Healthcare team?

Answers

Final answer:

An effective multidisciplinary healthcare team must identify and overcome health barriers, create sustainable health interventions, and ensure excellent communication and collaboration among team members.

Explanation:

An effective multidisciplinary healthcare team is crucial for providing comprehensive patient care. The three essential tasks required from such a team include:

Identifying and defining critical problems and barriers to health - Team members need to pinpoint the main issues affecting a patient's health and work together to create a cohesive plan to overcome these challenges.Designing sustainable health education and disease prevention interventions - The team must develop and implement strategies that promote long-term health benefits for patients and the larger community.Effective communication and collaboration - To ensure quality care and efficient treatment, team members must communicate openly and work together seamlessly. This includes respecting each other's roles, using checklists to prevent errors (such as confirming a patient's identity, surgical site, and procedure), and discussing each team member's concerns for patient care like the surgeon, anesthesia staff, and nursing staff do during surgical procedures.

Challenges like work overload, heavy physical work, and interpersonal conflicts need addressing to maintain team effectiveness.

Learn more about Healthcare team here:

https://brainly.com/question/33217106

#SPJ12

The patient is here because the cyst in her chest has come to a head and is still painful even though she has been on antibiotics for a week. I offered to drain it for her. After obtaining consent, we infiltrated the area with 1 cc of 1% lidocaine with epinephrine, prepped the area with Betadine and incised and opened the cyst in the relaxed skin tension lines of her chest, and removed the cystic material. There was no obvious purulence. We are going to have her clean this with a Q-tip. We will let it heal on its own and eventually excise it. I will have her come back a week from Tuesday to reschedule surgery. What CPT® and ICD-10-CM codes are reported?

Answers

The correct CPT would be 10060 and the reported ICD-10-CM codes are L72.9. The provider had perform an incision and drainage procedure for the cyst on the chest. In the CPT Index for Incision and Drainage/Cyst/Skin, 10060 and 10061 are for I & D of a cyst. However, only one cyst was drained making 10060 the correct code. Moreover, in the ICD-10-CM Alphabetic Index for Cyst/skin and you are referred to L72.9. 

 

Answer:

1. CPT Code 10060: Incision and drainage of abscesses (anthrax, suppurative hydradenitis, skin or subcutaneous abscess, cyst, boil or paronychia).

2.ICD L729: follicular cyst of the skin and subcutaneous tissue, unspecified: market size, prevalence, incidence, quality results, the best hospitals and doctors.

Explanation:

1.In the incision of the abscess and its drainage the skin is opened and the pus is drained. An abscess is defined as an accumulation of pus in a wound that becomes inflamed, hot, and swollen. It is produced by bacteria. An abscess requires opening and draining if it is delimited in soft tissues, such as in the thigh.

2. An epidermal cyst is a circular and firm lesion that is located intradermally or subcutaneously. It is the most frequent of cutaneous cysts. Their size ranges between 0.5 and 5 cm and they have an opening where the contents of the cyst can be drained.

Food preparation equipment shall be certified or classified for sanitation by

Answers

Final answer:

Food preparation equipment is usually certified for sanitation by a non-profit organization known as NSF International. They set standards for food safety and sanitation, and certify a variety of food preparation equipment.

Explanation:

Food preparation equipment is typically certified or classified for sanitation by an organization known as NSF International, which stands for National Sanitation Foundation. This non-profit organization sets standards for food safety and sanitation to ensure that food service operations are doing their part to prevent foodborne illness. They certify a range of food preparation equipment including refrigerators, cutting boards, knives, ovens, and more. The certification is crucial as it ensures that the equipment is designed and constructed in a way that it can be cleaned and sanitized properly.

Learn more about Food Preparation Equipment Sanitation here:

https://brainly.com/question/34697860

#SPJ12

Food preparation equipment should be certified or classified for sanitation by certain organizations and agencies to ensure safety and prevent the transmission of diseases.

Food preparation equipment should be certified or classified for sanitation by certain organizations and agencies. In the United States, these include the FDA (Food and Drug Administration), CDC (Centers for Disease Control and Prevention), and EPA (Environmental Protection Agency).

These organizations ensure that the equipment meets safety and sanitation standards to prevent the transmission of diseases and maintain public health.

To know more about Food preparation here:

https://brainly.com/question/29886661

#SPJ12

Some foods are preserved with heat and then cooled again before ever reaching a food service establishment. This process, called _______, is used on foods like dairy products, eggs, and wine.

Answers

The process is called pasteurization.
Some foods are preserved with heat and then cooled again before ever reaching a food service establishment. This process, called _______, is used on foods like dairy products, eggs, and wine.

Answer: 
[tex]food~ preservation[/tex]

The best way to destroy harmful germs that may be present in meat is to?

Answers

Become vegetarian...

JUST KIDDING!

Rinse you're meat very well and make sure it is cooked thoroughly.

Answer:

The correct answer is: cooking.

Explanation:

Cooking food often has a hygienic function and eliminates the presence of possible pathogens. The effects vary depending on the type of cooking used and, therefore, the degrees that are applied. Thus, at more than 70 ° C, the pathogenic microorganisms are destroyed, although some do not withstand temperatures above 55 ° C. In many cases, microbial growth is linked to temperature changes. Therefore, heat control is very important to ensure that food is safe.

Heat is an important source of pathogen destruction. The hygienizing function of cooking is due to the fact that there are many pathogenic microorganisms that do not withstand temperatures above 55 ° C. At these degrees, which are reached in most cooking methods, bacterial accumulations begin to degrade and do so more as the temperature is maintained over time or if it increases.

Enzo sits with a small group of friends at lunch. Occasionally, he drinks alcohol from his parents’ liquor cabinet and stays home, even though his friends invite him to go places. He likes to play video games in his free time and is slightly overweight. Which behaviors are signs that Enzo may need professional mental health treatment? Check all that apply. drinking alcohol being overweight playing video games withdrawing from activities having a small group of friends

Answers

Final answer:

The signs Enzo may need mental health treatment include his drinking of alcohol and withdrawal from social activities. Being overweight may also be relevant depending on underlying behaviors. Socializing with a small group and gaming are not necessarily signs of mental health issues.

Explanation:

Enzo's behaviors that may signal the need for professional mental health treatment include drinking alcohol, withdrawing from activities, and potentially being overweight, if it stems from or leads to unhealthy eating patterns or psychological stress. Drinking alcohol, especially from a young age, can be a sign of attempting to self-medicate or cope with underlying issues. Withdrawing from activities that one previously enjoyed can be a symptom of depression or social anxiety. While being overweight in itself is not a direct indicator of mental health issues, it can be connected if it is related to unhealthy behaviors or emotional distress.

Having a small group of friends or playing video games are not inherently signs of mental health issues unless these behaviors coincide with signs of addiction, isolation, or are used as ways of escaping from reality to the detriment of daily functioning.

which of the following is a normal part of a healthy, mature male reproductive system?
A) a painless lump or swelling in the testicle
B) a change in the way a testicle feels
C) nocturnal emissions
D) an inguinal gland

Answers

I would go with B.), because when a boy goes through puberty, changes clearly happen, and it makes sense. So, I would go with B.

The normal part of a healthy, mature male reproductive system is nocturnal emissions.

Nocturnal emissions, commonly referred to as wet dreams, are a normal part of male sexual health and typically occur during adolescence and young adulthood, though they may continue throughout life. During a nocturnal emission, involuntary ejaculation of semen occurs during sleep. It is part of the normal reproductive function and does not signify any underlying health issues.

In which of the following places is a young male most likely to develop cancer?
A.cervix
B.testicle
C.ovary
D.prostate

Answers

Answer: Testicular cancer is the cancer that a young male may develop.

The correct answer is B.

Explanation:

Prostate cancer is found more in older males, but has been found in younger males also. However, testicular cancer is more commonly found in younger males. Men do have a cervix not ovaries and can't develop this type of cancer.

Testicular cancer is the most likely type of cancer a young male can develop, with a higher incidence in males of European descent. It manifests with symptoms such as a lump in the testicle and pain in the scrotum, and diagnosis often requires a biopsy. The correct answer is option B) testicle.

A young male is most likely to develop cancer in the testicle. Testicular cancer is the most common cancer affecting young males, particularly between the ages of 20 and 39 years. It occurs in the testes, which are the reproductive organs responsible for producing sperm and secreting testosterone. This type of cancer is more frequent in males of European descent compared to African ancestry. Testicular cancer can present signs such as a lump or swelling in one testis, fluid in the scrotum, and pain or tenderness in the area. A biopsy may be needed for an accurate diagnosis when testicular cancer is suspected.

Thus, the correct answer to the student's question is option B) testicle.

When Kyle wonders if he made the right decision to eat fruit instead of candy, what is he most likely doing?

1)learning about the decision
2)reflecting on the decision made
3)taking ownership of the decision
4)identifying alternatives to the decision

Answers

The answer is here:
2)reflecting on the decision made

When Kyle wonders if he made the right decision to eat fruit instead of candy, he is reflecting on the decision he made.

What is decision?"It is a conclusion or resolution reached after consideration."What do you mean by right decision?"It means that picking a choice among all the options which seem to be the right one for the individual or group."What do you mean by reflection on the decision?It means to analyze the decision that you have made.It gives clarity about the decision, to plan a strategy, etc.

Kyle is analyzing the choices or decision that he had made while choosing between eating fruit or candy.

Hence, the correct option is: 2)reflecting on the decision made.

To know more about decision making here

https://brainly.com/question/13244895

#SPJ2

Juan has had his corpus callosum cut. When he touches something with his right hand, what happens?

Answers

a corpus callosum transfers information from one hemisphere to the other. So if he touches something with his right hand, he will feel it on his left side.

Juan, with his corpus callosum cut, will have impaired communication between his brain's hemispheres. If he is right-handed, he might still be able to identify and describe objects with his right hand since it is controlled by the left hemisphere with speech and language functions. This is a manifestation of split-brain syndrome caused by the severed corpus callosum.

When Juan, who has had his corpus callosum cut, touches something with his right hand, the sensory information is processed in his brain's right hemisphere. However, due to the severed corpus callosum, this information cannot be shared with the left hemisphere, where the language and speech centers typically reside. As a result, if Juan is right-handed and touches an object, he may be able to identify it and describe it because the right hand is controlled by the left hemisphere, which also houses speech and language functions. Yet, this integration of sensory and language processing cannot occur as efficiently as it would for someone with an intact corpus callosum.

In instances where people have had their corpus callosum cut to treat conditions like severe epilepsy, a phenomenon known as split-brain syndrome can occur. This condition provides insights into the unique functions of the two hemispheres. For example, if a split-brain patient is asked to pick up an object with the left hand (which is controlled by the right hemisphere), they may complete the task successfully but still be unable to verbally identify the object due to the disconnection between the hemispheres.

You are playing basketball with some friends at a local court. One of your friends falls and twists her ankle after making a great shot. She seems to be in pain and can’t put weight on her ankle, but she is not bleeding. What injury has your friend most likely sustained, and what should you do to treat it?

Answers

Well she most likely broke her ankle or popped it out of place or something. I would try to get her to the nearest emergency room so things won't get worse than it already is, or if I'm not able to go I would most definitely call 911 so they can send the paramedic's.
She has probably twisted or sprains her ankle and the best way to treat it is to put ice, let it rest, and depending on the severity, you may need to take them to the hospital.

A person who must be twice as close to an object to see it as clearly as a person with normal vision activity has

Answers

the answer is near sighted

What is the reason for the cleaning step in the 5-step dishwashing process


Answers

The cleaning step in a five step dishwashing process is to get all of the food and gunk off of the dishes. This is important becuase the food, over time, will get stuck onto the plate which will cuase bacteria to get stored on the dish which will mke the dish unsanitary. Without cleaning properly with soap and water someone could get sick which is why this step is very crucial.



Hope this helps ~Sky

Is the primary function of lymphocytes is immunological.
a. True
b. False?

Answers

True! Lymphocytes are a type of white blood cell that function as a part of the immune system.

The statement that the primary function of lymphocytes is immunological. is true.

What are  lymphocytes?

Most animals have lymphocytes as a sort of white blood cell in their immune systems. T cells, B cells, and innate lymphoid cells are all types of lymphocytes, with natural killer cells being a significant subtype. They are the primary class of cells in lymph, thus the term "lymphocyte." White blood cells known as lymphocytes serve as an essential component of the immune system. a particular immune cell subset that is produced in the bone marrow and is present in both the blood and lymph tissue.

B lymphocytes and T lymphocytes are the two primary types of lymphocytes. T lymphocytes aid in the management of immune responses and the killing of tumor cells, whereas B lymphocytes produce antibodies.

Learn more about lymphocytes at

https://brainly.com/question/1995778

#SPJ6

What is the relationship between the acts and EHR as it impacts your role as a Medical Assistant?

Answers

The use of EHR would impact much on the role of the Medical Assistant as it would avoid medical errors. This then would lessen lawsuits thus money would not be put into trash. This would also help the Medical assistant in documenting properly the information.

What service would mostlt likely be provided by the americsn diabetie association to someone who has diabetes?

Answers

The American Diabetes Association leads the fight against the deadly consequences of diabetes and fights for those affected by diabetes.
-fund research to prevent, cure and manage diabetes.
-deliver services to hundreds of communities.
-provide objective and credible information.
-give voice to those denied their rights because of diabetes.

Tina’s 76-year-old great aunt comes into the clinic for a visit and you find that she frequently asks you to repeat what you say. During the Rinne test, you find that air conduction is greater than bone conduction in her left ear. What is your differential diagnosis? What additional assessments would you perform?

Answers

Based in the Rinne test that air conduction is greater than bone conduction, my differential diagnosis would include a punctured eardrum, a buildup of earwax, an ear infection, a fluid in the middle ear or a damage to the small bones within the middle ear. 

Moreover, I would perform Weber test on Tina’s aunt for additional assessment if there were any sensorineural hearing loss that lead to the damage of the auditory nerve, hair cells in the inner ear, or the cochlea, which can occur from sustained loud noise exposure or common aging process.

 

The term refers to the muscles' ability to work without fatigue

Answers

the answer is muscle endurance

Which is better injecting insulin before meal or after using long meal?

Answers

after a meal but check your rate before a meal.
 

According to Florida’s implied consent Law, signing an application for a drivers license signifies that you___to take a test of your blood, breath, or urine for the presence of alcohol or drugs
A. Agree
B. Follow the judges order
C. May agree or disagree

Answers

Agree! Smiles all around.

What are the major functions of the respiratory system?

Answers

The major functions of the respiratory system is to provide the blood with oxygen to fuel it to deliver oxygen into the other parts of the body

Hope this helps you!

Answer:

Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood

Explanation:

hope it helps you :)

The graph shows the percentage of calories that children and adolescents get from fast food.

Approximately what percentage of calories do obese adolescents obtain from fast food?

1) 10.1
2) 16.4
3) 8.8
4) 18.6

Answers

18.6 . D is the answer.

concerns a person's thoughts. deals with feelings.

Answers

I believe the answer would be emotions.

so it is mental health and emotional health

hope this helps :)

Which exercise is likely to target the abdominal muscles? Bicep curls Running Russian twist Biking

Answers

The exercise is likely to target the abdominal muscles in the running twist. Option C is correct.

Russian twist primarily targets the obliques, rectus abdominis, and transverse abdominis. It also targets hip flexors and provides stability to the torso.

The Russian twist is one of the most effective abdominal exercises. It works the obliques as well as the transverse abdominals, both of which are important for maintaining good posture.

It also helps to tone and burn fat while toning the waistline. It also strengthens the spine muscles while improving balance and flexibility.

Therefore, the correct option is option C.

To learn more about abdominal muscles, refer to the link:

https://brainly.com/question/12885640

#SPJ3

The Affordable Care Act was passed in 2010.

Since the Affordable Care Act was passed, many more people in the United States have ______ than before.

Answers

Final answer:

The Affordable Care Act (Obamacare) significantly increased the number of Americans with health insurance, with approximately 20 million gaining coverage, reducing the uninsured rate from 16% in 2010 to around 8.6% by 2020.

Explanation:

Since the Affordable Care Act was passed in 2010, many more people in the United States have health insurance than before. The ACA, also known as Obamacare, introduced mandates, subsidies, and provisions to reduce healthcare costs and expand insurance coverage.

In particular, it addressed issues of underinsurance by subsidizing insurance for low-income individuals and prohibiting denial of coverage due to preexisting conditions. This legislation led to a significant decrease in the uninsured rate, from 16% of the population in 2010 to around 8.6% by 2020, meaning that 20 million Americans gained coverage under the ACA.

The habitual manner in which people explain the things that happen to them is their explanatory style.

True

False

Answers

The habitual manner in which people explain the things that happen to them is their explanatory style: false
Explanatory styles is the way in which people perceive or explain the events in their lives. It is in the habitual way in which people explain the bad things that happen to them. In reality, it is a habit- a way of thinking that people use when all others factors are equal and when there are not clear-cut right and wrong answers

~true

~Manii

In Eastern cultures, ----- form an important part of the family, and their opinions are highly regarded in family decisions.

Answers

In Eastern cultures, elders form an important part of the family, and their opinions are highly regarded in family decisions. Most countries in East Asia have established a culture of close-knit family and along with this is a tradition to value the elders. Every advice coming from the elders are always taken with utmost respect.

Answer: Elders

Explanation:

Other Questions
Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other Polands energy resources can be described as _____. a. based on large deposits of coal b. rich in petroleum c. large deposits of sulfur d. large deposits of copper If a circle has a radius of 18 feet what's the closest approximation for circumference Has complete control of the laws rules and affairs of a country Plz jphelp me answer this year 7 question and explain how u got the answer. If the most industrialized countries all signed a climate-change treaty with the goal of keeping the sea at its current level, which would be a free rider benefiting from a positive externality of the treaty America wanted to end japan's aggression by placing a(n) _______ to cut off the oil and scrap metal supply. Eva is jumping on a trampoline. Her height h at time t can be modeled by the equation h=-16t^2+20t+6. Would Eva reach a height of 14 feet? A traveler's budget and needs are considered by a _________ when arranging a trip. Which antibiotic was most effective in inhibiting the growth ofe. coli?