Red-green color blindness is an X-linked recessive disorder that is passed through generations and can be traced by using a pedigree.

A pedigree is shown. Sam, Bella, Joshua, and Tim have filled-in shapes. Lisa and Monica have half-filled shapes.

Which individuals in the pedigree are identified and labeled carriers for red-green color blindness?
A. Lisa and Monica
B. Sam, Tim, Bella, and Joshua
C. Ben, Jenny, Mike, Carol, Katie, and Chris
D. Ben and Lisa

Answers

Answer 1
B. Sam, Tim, Bella, and Joshua
Answer 2

Answer:

b :))

Explanation:


Related Questions

Which list contains only abiotic conditions that might be found in a pond ecosystem? *
1 point
Temperature of the water, green plant populations, dissolved minerals in the water
Temperature of the water, dissolved oxygen in the water, dissolved minerals in the water
Bacteria, dissolved minerals in the water, temperature of the water
Dissolved oxygen in the water, fish populations, insect populations

Answers

Answer:

Temperature of the water, dissolved oxygen in the water, dissolved minerals in the water

Explanation:

Abiotic conditions strictly comprises on non-living elements. In the first statement, green plant population is mentioned which is a biotic factor.

In the 3rd statement, bacteria are listed which are biotic entities. Their presence suggest the involvement of biogeochemical cycles in the lake, thus, highlighting both biotic and non-biotic conditions.

In the 4th statement, fish and insect population is mentioned which are also biological entities.

Only second statement is correct because it essentially talks about the abiotic conditions such as temperature, dissolved oxygen and dissolved minerals. Although these parameters could affect the life inside the pond (which cannot be exculded in reality); nevertheless, the need of statement is to identify only those parameters which are abiotic.

Nitrogen: A element only found solely in storage sites of plants and soil
Check all the statements that are true in regards to the carbon cycle*
10 points
Photosynthesis is the process that releases oxygen into the atmosphere
O
Carbon dioxide is taken in as a reactant throughout the process of cellular respiration
The ocean, living things, rocks and soil all act as reservoirs for carbon
Only animals go through the process of respiration
O
Gas, oil and coal are fossil fuels that are primarily composed of carbon

Answers

Answer:

Photosynthesis is a process that releases for oxygen into the atmosphere.

The ocean, living things, rocks and soil are all reservoir of carbon.

Gas, oil and coal are fossil fuels that are primarily composed of carbon.

Explanation:

Carbon cycle is a biogeochemical cycle in which carbon compounds are converted and released in the environment. It involved processes where carbondioxide is used with water and light energy in the process of photosynthesis to produce food and release oxygen to the atmosphere. It also involve the process of respiration where carbondioxide is released to the atmosphere after taking in oxygen. It is also involve a process that release carbon when burning of fossil fuels and decay of dead organisms.

Carbo is considered the major composition of living organisms sand it's also the components of biological molecules.

Each category represents one of the functions of proteins. Match each example with the appropriate function.

Answers

Answer:

Maintaining homeostasis: Insulin controls the concentration of sugar in the bloodProviding structure: Collagen makes skin strong yet flexibleRegulating chemical reactions: Pepsin works in the stomach to speed up the breakdown of food.Fighting disease: IgA prevents the buildup of viruses and bacteria in the gut.

Explanation:

Homeostasis is the maintenance of internal environment of the cell with respect to the external environment. In the first statement, insulin is controlling the sugar level in the blood cells. Thus it is an example of homeostasis.

Collagen is an abundantly found protein in the mammals. It provides structural support to the connective tissues, bones, and muscles.

Pepsin is a digestive enzyme that breaks down proteins into respective amino acids. Our food normally have proteins which are thus degraded by the action of pepsin enzyme.

Immunoglobulin A or "IgA" is an antibody that play a vital role in immune/defense system. More precisely, it provides protection against viral and bacterial infections, e.g. influenza virus infection.

Final answer:

Proteins in a cell can serve multiple functions, such as acting as enzymes to accelerate internal chemical reactions, acting as hormones that send signals across the body, functioning as antibodies to battle foreign bodies in the immune system, or carrying essential molecules like oxygen as done by hemoglobin.

Explanation:

Without the specific examples and options for their functional categories, it's challenging to provide precise solutions to your question efficiently. However, I can help you understand the main functions that proteins can have in a cell based on standard biology knowledge. First, there are enzymes that act as catalysts to speed up chemical reactions within cells. Second, proteins can be hormones that transmit signals from one part of the body to another. Third,  antibodies are proteins helping in immune responses by identifying and neutralizing foreign bodies like bacteria and viruses. Lastly, proteins, such as hemoglobin, can transport molecules like oxygen throughout the body.

Learn more about Functions of Proteins here:

https://brainly.com/question/33555927

#SPJ3

Why is the disposal of nuclear waste a greater problem than the disposal of the trash that you and you family need to get rid of

Answers

Answer:

nuclear waste has radiation, which is harmful to humans, so nuclear waste has to be stored in special facilities. Nuclear waste takes a lot longer than regular waste to decompose too.

Explanation:

The leaves and petals of dicots are found in multiples of____ or____.
A.four; five
B.five; six

Answers

A. four;five is the answere

Answer:

a

Explanation:

usatestprep

The graph below shows the population of mice in an ecosystem where the mice are not allowed to enter or leave.
Which best describes the population at point B?
A.The death rate is higher than the birthrate.
B.The birthrate is higher than the death rate
C.It has reached its carrying capacity
D.The population is decreasing

Answers

It’s birthrate is higher than its death rate

Natality, mortality, and growth in populations that exhibit a logistic growth model depend on the density. Option B.The birthrate is higher than the death rate

What is logistoc growth?

Populations exhibiting a logistic growth model depend on density.

Natality and mortality depend on the population size, meaning that there is no independence between population growth and population density.

When a population grows in a limited space, density rises gradually and eventually affects the multiplication rate. The population per capita growth rate decreases as population size increases. The population reaches a maximum point known as the carrying capacity, K.

The carrying capacity might be affected by different factors, known as limiting factors, which might be a result of the population density (for example, competition) or might be density-independent.

What is carrying capacity?

Carrying capacity refers to the maximum point at which the environment can support a growing population.

K is a constant. It coincides with the population size when natality rate and mortality rate are equal to each other. This is the equilibrium point.

• If the population size, N, is inferior to K ⇒ the population still grows.

• When N approximates to K, the population's growth speed decreases.

• When N=K, the population reaches equilibrium,

• When N is superior to K (N>K), the population must decrease in size because there are not enough resources to maintain that size.

In the exposed example, option B best describes the population at point B. The birth rate is higher than the death rate. At this point the population is experiencing exponential increase in size.

You will learn more about logistic growth at

https://brainly.com/question/15631218

Land plants are divided into two main groups. They are_____and_____.
A.vascular; nonvascular
B.flowering; nonflowering

Answers

Answer:

Land plants are divided into two main groups. They are vascular and non vascular

The answer is a but I’m Not really sure

What are reactants in biology

Answers

Answer:

A substance that undergoes a change during a reaction.

Explanation:

Answer: A substance that undergoes a change during a reaction.

The image shows Isotherms on a map.

What temperature pattern do the isotherms show?

A. lemperatures increase from south to north.
B. There is a zone of low temperatures in the Southwest.
C. There is a zone of high temperatures in the center of the country.
D. Temperatures increase from the center of the country toward the Southwest.​

Answers

Answer:

According to the information on the map, the temperature pattern showing the isotherms is temperatures increase from the center of the country toward the Southwest (option D).

Explanation:

Isotherms are lines drawn on a map to show areas that -according to their geographical characteristics- have the same temperature level. with the same temperature levels.

On the map presented, an increase in temperature from north to south can be clearly seen, with the temperature in the centre (20°) showing a pattern of increase towards the southwest (30, 40 and 50°).

Learn more:

Isotherms https://brainly.com/question/11775811

Answer:

According to the information on the map, the temperature pattern showing the isotherms is temperatures increase from the center of the country toward the Southwest (option D).

Explanation:

Explanation: Isotherms are lines drawn on a map to show areas that -according to their geographical characteristics- have the same temperature level. with the same temperature levels.

GIVING BRAINLIEST!!!
scientists suggest that galaxies are moving away from earth due to
a - dark energy
b - doppler shift
c - gravity
d - solar energy

Answers

Its dark enegry

Dark energy is like a rapid ageing proces to the earth, its not that the galxaies are moving away from us than that the earth is get bigger.

It’s answer A hope this help you

in order to replicate itself, a virus must first do what

Answers

Viruses must first penetrate and enter the cell before viral replication can occur.

Remora fish get free food by hanging out with sharks. Sharks are not affected by
the remora. Which type of symbiotic relationship is this? *

Answers

Answer:

This is a symbiotic relationship of commensalism

Explanation:

Commensalism is when one animal in a symbiotic relationship gets something out of the relationship without harming or benefiting the other. If the fish were to be helping the shark, it would be mutualism (since they both get something out of the relationship). If the fish were to be harming the shark it would be a parasitic relationship. Since the fish is neither hurting or aiding the shark, it is a commensalistic symbiotic relationship!

8. Which of the following is a requirement for exponential growth of a
population?
O A. There's competition from other organisms.
O B. There's a finite number of resources.
O C. There are no limiting factors.
O D. The population is in a climax community.

Answers

It would have to be B. because for something to grow it needs resources such as food and water.

Answer:

C. There are no limiting factors.

Explanation:

A mutation near the middle of a gene changes the DNA to the following nucleotides: ATT. What
kind of mutation occurred in this situation?
A) missense mutation
B) nonsense mutation
C) silent mutation
D) none of these

Answers

Answer:

A mutation near the middle of a gene changes the DNA to the following nucleotides: ATT. What  kind of mutation occurred in this situation?

missense mutation

Explanation:

A major problem with the use of electrical energy is that _____ A. It is not easily stored b. There are very few ways to create it c. It cannot be converted into other forms of energy d. If cannot be used to do work

Answers

Answer:

B

Explanation:

How are animals and plants different? How are they the same? Be specific.

Answers

plants give off oxygen and take in carbon dioxide and animals take in oxygen and give off carbon dioxide.

A scientist found a new species in a rain forest. The species was small and green in color. She examined one of its many cells and found that the celll has a nucleus but no cell wall. To which kingdom does this species most likely belong?

Answers

This species most likely belong to the animal kingdom, because it is multicellular with no cell wall.

Members of the kingdom Animalia are eukaryotes (organisms with true nucleus), multicellular and their cells do not have cell wall. If the cell had a cell wall, the specie could be a plant or fungi, but it does not have a cell wall so it is an animal. Animals exist in various sizes and colors and their cells contain many organelles that perform several functions that are important for their survival.

Answer:

animals, because it is multicellular with no cell wall

Explanation:

animals, because it is multicellular with no cell wall

Carbon dioxide goes from a solid to a gas without becoming a liquid. This is a chemical change.
True
False

Answers

Answer:

I think its true

Explanation:

hope this helps

True, If it’s not correct I’m really sorry.

Which of the following is an example of conduction A a dog bowl of water warms up out in the sun B leftovers become warm when reheated in the microwave. C campers warm up while sitting by a campfire D a metal spoon becomes warm when placed in a cup of hot tea

Answers

Answer:

Which of the following is an example of conduction?

a metal spoon becomes warm when placed in a cup of hot tea

Explanation:

      Answer: D, a metal spoon becomes warm when placed in a cup of hot tea.                                                                                                                                                                                

      Explanation: Conduction is the transfer of energy through matter from particle to particle. It is the transfer and distribution of heat energy from atom to atom within a substance. For example, a spoon in a cup of hot soup becomes warmer because the heat from the soup is conducted along the spoon.

seasons why do we have them

Answers

We have seasons because the earth is tilted as it makes its way around the sun. So its always pointed in one way at the sun, causing different asmophere as we go around the sun.

Charlie lifts a box with a force of 500 N and sets it on a table top 1.2 m above its starting position. Lauren pushes an identical box up a 5 m ramp from the floor to the top of the same table. Which person did more work? Please explain.

Answers

Answer:

Explanation:

Workdone is the force applied to move a body in a specified direction.  

  Work done  = Force x distance

For first box;

          Work done  = 500 x 1.2  = 600J

For the second box = 500 x 5  = 2500J

Lauren did more work compared to Charlie because he move the box through a larger height which is the distance in this scenario.

Final answer:

Charlie and Lauren both elevate boxes to the same height, but assuming no friction and only addressing vertical displacement, Charlie does 600 J of work, while Lauren would do more due to the 5 m displacement along the ramp, resulting in 2500 J if the full force is applied over the entire distance.

Explanation:

The student is asking about the concept of work in physics, which is calculated as the product of force and displacement in the direction of the force. In this scenario, both Charlie and Lauren are performing work to elevate boxes to the same height, but the question is which person did more work. The key concept is that work is force times the displacement in the direction of the force. So, for Charlie, who lifts the box directly upward for a displacement of 1.2 m with a force of 500 N, the work done can be calculated by the formula:

W = F × d = 500 N × 1.2 m = 600 J (joules)

Lauren's situation is slightly more complex because she is pushing the box up a ramp. Nevertheless, if we assume no friction and only account for the vertical displacement, which is the same height that Charlie lifted the box, the work done by both would be the same because they displaced the box the same vertical distance against gravity. However, if we consider the actual distance moved along the ramp and the force applied, Lauren would exert the force over a longer displacement of 5 m:

W = F × d = 500 N × 5 m = 2500 J

Therefore, assuming that Lauren applies the force through the entire length of the ramp, she would indeed do more work due to the longer displacement even though the vertical change in both situations is the same. This indicates that not all of the 500 N force from Lauren is directed towards raising the height of the box; some of it is directed along the ramp to overcome gravity and any potential friction.

What idea did Hardy and Weinberg disprove?

A. There are seven conditions for equilibrium.

B. Dominant alleles become more common in each generation.

C. The gene pool for a population frequently changes.

D. Allele frequency is stable between generations.

Answers

B: Dominant alleles become more common in each generation

According to Hardy-Weinberg the allelic frequencies remain the same through generations. Option is B. dominant alleles become more common in each generation.

What are the Hardy-Weinberg theory?

The Hardy-Weinberg equilibrium is a theory that states that when a population is in equilibrium, its allelic and genotypic frequencies remain the same through generations.

No evolutive forces are acting on these populations (natural selection, genetic flow, genetic drift, mutation), there are random matings, no superposed generations, and the population size is infinite.

The correct option is B. They disproved that dominant alleles become more common in each generation.

This can not be true since allelic frequencies remain the same through generations.

You can learn more about the Hardy-Weinberg theory at

https://brainly.com/question/16823644

https://brainly.com/question/1748149

#SPJ2

A raccoon consumes 500 calories of food. 50 of those
calories are converted to biomass. In other words:

Answers

Final answer:

The subject of this question is the conversion of calories to biomass in a raccoon's diet. This process is known as energy transfer or energy flow in an ecosystem.

Explanation:

In biology, the subject of this question is the conversion of calories to biomass in a raccoon's diet. This process is known as energy transfer or energy flow in an ecosystem.



Calories are a unit of energy, and when a raccoon consumes food, it uses some of that energy for its own metabolic processes and converts the remaining energy into biomass, which is the living tissue of the raccoon's body.



In this case, if the raccoon consumes 500 calories and 50 calories are converted to biomass, the remaining 450 calories are used by the raccoon for its bodily functions.

Learn more about calories to biomass conversion here:

https://brainly.com/question/34851608

#SPJ3

According to the question, out of the 500 calories consumed by the raccoon, only 50 are converted into biomass. In simpler terms, for every 500 calories of food it eats, the raccoon uses 50 calories to build up its body mass.

When the raccoon consumes 500 calories of food, it undergoes various metabolic processes to utilize this energy. Out of these 500 calories, only 50 calories are converted into biomass. This conversion involves synthesizing new molecules and tissues, such as muscle, fat, and organs, contributing to the raccoon's growth and maintenance.Metabolic rate is the amount of energy expended by an animal over a specific time. In the case of the raccoon, only a small portion of the consumed calories is converted into biomass. The remaining 450 calories are likely expended as energy to power the raccoon's daily activities, including locomotion, thermoregulation, and cellular functions like respiration and digestion. These calories are transformed into kinetic energy, heat, and other forms of metabolic energy to sustain the raccoon's life processes

Which of these may be a matter of serious concern for an ENVIRONMENTALIST?
1.increase in tigers which is a threat to herbivourous animals
2.involment of more tribal people in the conservation than proffesionals
3.commercial extraction of timber and other forest produce to meet urban demands
4.exploitation of migrated labourers by contractors in a construction site

Answers

Answer:

the answer is #3

Explanation:

FIRST PERSON CORRECT WILL BE MARKED BRAINLIEST
Which of the following is not a reason the human population is growing exponentially?
A. modern medicines prevent many childhood diseases

B. advancements in technology mean people can move if they deplete resources in an area.

C. food production has increased as a result of advancements in science and technology

D. infectious diseases can spread in crowded areas

Answers

Answer:

D

Explanation:

D is a reason population would fall

Answer:

Option (d). Infectious diseases can spread in crowded areas is not a reason the human population is growing exponentially.

What are the causes for human population?

Good healthcareIncrease in birthrateFood securityLack of educationCultural influenceLack of future planning

Why other options are incorrect?

The other options are incorrect because they are the reason behind human population rather than option (d) which is not the reason.Thus, option (d) is correct answer.

For more questions on human population,

https://brainly.com/question/8516302

#SPJ2

Black bears eat both plants and small animals in their ecosystem. Which of
the following terms best describes a black bear?
A. Producer
OB. Herbivore
O
C. Omnivore
D. Carnivore

Answers

Answer:

The answer is C. Omnivore

Explanation:

An omnivore is an animal that eats both plants and animals

C. omnivore I Just done this Question.

Describe what scientists mean when they refer to an ecological community such as that shared by the leopards and lions.

Answers

Answer:

An ecological community can be described as all the different species of organisms i.e all the different plants and animals, living in a particular habitat at a specified time.

An ecological community will consist of:

Predators: Organisms which feed on other organisms.

Preys: The organisms eaten by predators.

Competitors: Different organisms feeding on the same prey and hence, competing for it. For example the leopards and the lions in a community.

Final answer:

An ecological community refers to interacting populations of different species in a specific habitat. Ecologists study these communities to understand species interactions and competition for resources. Factors like habitat conditions and available species determine which organisms can exist within a particular community.

Explanation:

When scientists refer to an ecological community, they are describing a group of interacting populations of different species occupying a given habitat. For instance, the lion and leopard populations living within the same geographic region. The concept of an ecological community also entails the diversity of these species in terms of their number and relative abundance.

Ecologists study these communities to understand how these species interact with each other and compete for the same resources. These species interactions, include predation, herbivory, competition, and pollination, can regulate population sizes and affect other ecological processes impacting diversity.

Within this framework, numerous factors influence the make-up and dynamics of a community, such as the habitat's latitude, rainfall, topography, and the range of species available. These variables are crucial as they determine which organisms can thrive within a particular area.

Learn more about Ecological Community here:

https://brainly.com/question/33648509

#SPJ3

Foaung Log
A log was cut from a tree and put in water. The log floated on its side so that half the log was above the water surface
Another log was cut from the same tree. This log was twice as long and twice as wide. How does the larger log float
compared with the smaller log?
1. Choose the best answer.

• More than half of the larger log floats above the water surface.
Half of the larger log floats above the water surface
Less than half of the larger log floats above the water surface

Answers

Answer:

The larger log floats the same as the smaller one, so the correct answer is that half of the larger log floats above the water surface (second option).

Explanation:

An object's ability to float when in water depends on its density, so two objects with different densities will float differently. Density is the relationship between the mass and volume of a material.

Objects with low density float more than denser objects, regardless of the amount of material.

Since the trunks come from the same tree, it can be assumed that they both have the same density, so they will float the same way, regardless of the size of each one.

Learn more:

Density calculation https://brainly.com/question/952755

5 pieces of evidence that supports climate change

Answers

Answer:

1.Climate change is real and man-made, and there is overwhelming scientific consensus that this is true

2.All major climate change reports are thoroughly researched and based on the most accurate, up-to-date science

3.Climate change studies are transparent

4.Addressing climate change will strengthen the economy

5.Federal climate change reports are credible because they are written by scientists, not politicians

Explanation:

I just use these on a test and got it right

how a 300-N force can combine with a 100-N force on sled

Answers

Answer:

If a 300-N force pushes you forward on a sled, and a 100-N force pushes you back (i.e. the wind), the resultant net force is still 200-N forward

Explanation:

Other Questions
QUESTION 2 Objectives: I . identify potential and kinetic energy in a situation and draw corresponding energy bar charts, II . calculate gravitational and elastic potential energy, III . draw & analyze potential energy functions, and (d) use conservation of energy to relate the total energy at one time to total energy at another time. ------------------------------------------- Bungee Jump: you will step off with zero initial vertical velocity from a platform a height h above the ground. The bungee cord will act like a giant extensional spring that will, you hope, provide an upward force on becoming taut. After weighing you (you have a mass M), the operator has selected a bungee cordwith an un-stretched length of d and a spring constant of k. Consider yourself to be a single point i.e., use the particle model. Choosing the ground as your origin (and the z-axis directed upwards), answer the following questions about your bungee jumping adventure in terms of M, h, d, k, z, and the gravitational field strength, g. Answer with variables. ------------------------------------------- a) Write an expression for the stretching ?L of the cord in terms of d and z and for the total potential energy U of the jumper-bungee-Earth system for each situation (consider the latter two situations together). b) Which type of potential energy ( UG or US ) is largest for large z (early in the fall)? For small z (late in the fall)? c) Sketch a graph of your gravitational potential energy, UG(z) vs your height, z, from z = 0 to z = h, on the left plot. Then sketch a graph of your elastic potential energy, US(z) on the center plot. Finally on the rightmost plot, sketch a graph of your total potential energy1 U(z) = UG(z) + US(z). Do these plots on your own without the help of a computer or calculator. 1.) 2x9y=14 2.) x=6y+7 please help!! 40% of OatyPop cereal boxes contain a prize. Hannahplans to keep buying cereal until she gets a prize. What isthe probability that Hannah only has to buy 3 or lessboxes before getting a prize?We need to design a simulation. Which random device can we use to BESTrepresent this situation?Use a double-sided coin andassign heads as the prize andtails as no prize.Use a number cube with thenumbers 1 through 6 and assign1 through 2 as the prize and 3through 6 as no prize.Use a random number generatorranging from 1 to 10 and assign1 through 4 as the prize and 5through 10 as no prize.Use a deck of cards and assignspades as the prize and allother suits as no prize. There are three groups that contain carbon but are not organic compounds:carbon chlorides carbon oxides carbon iodides carbides carbonates When should you use the median and interquartile range as your measure of center and measure of variability tocompare populations shown on a box plot? Check all that applywhen there are outliers in the data setswhen there are no big gaps in the middle of the data setswhen the plots representing the data are symmetricalwhen the plots representing the data are nonsymmetricalwhen there are no outliers in the data setIntroDone To assist with a class demonstration, a student (whose mass is 60 kg) filled a water balloon with 2 kg of water. He then climbed to the second floor (10 metres) of the school and held the balloon out of a window. How much work did the student do? What is it called when plants give off water vapor as a waste product? Jason is entering a weight lifting contest. Gurrently, his maximum bench press weight is 105 pounds. If he increases the weight by 7 pounds each week, What is the maximum weight he be able to bench press after 13 weeks? Which statement best summarizes the central idea of thisexcerpt?DOUO One must know the process of hiring servants.0 It is important to always honor one's servants.O It is necessary to choose trustworthy servants.O The intelligence of servants must be considered.herofich 1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes. if tan 0= -3/8 which expression is equivalent to cot0? A fairground ride spins its occupants inside a flying saucer-shaped container. If the horizontal circular path the riders follow has a 6.75 m radius, at how many revolutions per minute are the riders subjected to a centripetal acceleration equal to that of gravity What should you expect to happen if you participate in a poetry workshop?