Rewrite 10^32 x 10^6 using a single exponent

Answers

Answer 1

10^38

Step-by-step explanation:

Given that,

10^32 x 10^6

Here the base is same (10) and the powers are 32 and 6.

These 2 bases are in multiplication form so the powers can be added up.

10^32 x 10^6 = 10^(32+6)

= 10^38


Related Questions

HELP PLS 30) PTS
--------
Calculate the bases of the trapezoid.
The diagonal of the trapezoid divides the central section into parts, one of which makes up 62.5% of the other . Find the bases when the middle section is 26 cm.

The answer . The longer base of the trapeze is__ cm and shorter__ cm.

Answers

Answer:

32 ; 20

Step-by-step explanation:

Middle section: 26

Sum of parallel lengths: 2 × 26 = 52

Ratio of the sides:

100% : 62.5%

8 : 5

5/(8+5) × 52

20

8/(8+5) × 52

32

Bobby and his family went to the playground. The slide is 13
feet long. The end of the slide is 7 feet away from the stairs. The
stairs extend 2 feet higher than the end of the slide. How tall are
the stairs?

Answers

Answer:

it would be close to 12 ft im not 100% sure though the measurements are a little off

Step-by-step explanation:

hypotenuse is 13

then you have the adjacent = 7

13^2 = 169

7^2= 49

169-49=120

the square root of 121 is 11 wich is fairly close to 120(doesnt have one because its not exact)

there is two extra feet so 11 +2 is 13 but there  was a little less then 11 so i had sid roughly around 12

brainliest, please???

Final answer:

The total height of the stairs can be found by adding the distance from the ground to the end of the slide (7 feet) and the extra height of the stairs (2 feet). This adds up to a total height of 9 feet for the stairs.

Explanation:

The subject of the question is Mathematics, and it's suitable for a Middle School level. The problem can be solved using basic addition, and the concept of distance and height.

First, identify the length of the slide, which is 13 feet. Next, you're told that the end of the slide is 7 feet away from the stairs. This distance represents the height from the ground to the end of the slide. Lastly, you're told that the stairs extend 2 feet higher than the end of the slide.

Add these two distances together. So, the total height of the stairs is 7 feet (height to end of slide) plus 2 feet (additional height of stairs) equaling 9 feet.

So, the stairs are 9 feet tall.

Learn more about Height Calculation here:

https://brainly.com/question/30400637

#SPJ2

Ted and Katie have served up a total of $94 Tata saved six dollars less than four times as much is Katie how much has Katie saved

Answers

Answer:

Katie saved $20.

Step-by-step explanation:

I assume that "served" is a typo for "saved". Also, I assume that Tata and Ted are the same person.

Let the amount Katie saved = k

Then, ted saved $6 less than 4 times k, or 4k - 6.

The total saved by both is k + 4k - 6.

The total saved by both is $94.

k + 4k - 6 = 94

5k - 6 = 94

5k = 100

k = 20

Answer: Katie saved $20.

Final answer:

To determine the amount Katie has saved, two equations were set up based on the given information. The equations were solved simultaneously to find that Katie has saved $20.

Explanation:

Let's denote the amount Katie has saved as K and the amount Tata has saved as T. According to the problem, Tata saved six dollars less than four times as much as Katie, which we can write as T = 4K - 6. Additionally, we know that together they have saved a total of $94, so we can express this as K + T = 94. Substituting the expression for T from the first equation into the second equation, we get K + (4K - 6) = 94. Simplifying this, we get 5K - 6 = 94. By adding 6 to both sides, we obtain 5K = 100, and dividing by 5, we find that K = 20. Therefore, Katie has saved $20.

Tim install 50 square feet of his floor in 45 mins. At this rate how long does it take him to install 495 square feet. Is that 99.5 or 445.5?

Answers

Answer:

the answer is 445.5

Step-by-step explanation:

what I did was divide 50 by 495 and got 9.9 then since it took 45 minutes every 50 square feet of floor i multiplied 45 x 9.9 and got 445.5  


Identify the location of the values used to create a box
plot
A= B=
C=
D =
E =

Answers

Answer:A= minimum value

B=lower quartile

C=median

D= upper quartile

E= maxuim value

Step-by-step explanation:

Final answer:

A box plot displays the distribution of data based on a five-number summary: minimum, first quartile, median, third quartile, and maximum. It provides insights into the data's distribution, potential outliers, and comparisons of data sets.

Explanation:

The student's question involves the creation and interpretation of a box plot, which is a standardized way of displaying the distribution of data based on a five-number summary: minimum, first quartile (Q1), median, third quartile (Q3), and maximum. To graph a box-and-whisker plot for the given data values, one must first calculate the five-number summary:

Minimum (A): The smallest data value.First quartile (B): The median of the lower half of the data set. This marks the 25th percentile, meaning 25% of the data fall below this value.Median (C): The middle value of the dataset when ordered from least to greatest, which also splits the data into two halves.Third quartile (D): The median of the upper half of the data set. This marks the 75th percentile, so 75% of the data fall below this value.Maximum (E): The largest data value.

Once these values are determined, one can create a box plot where the box represents the interquartile range (IQR), stretching from Q1 to Q3, with a line at the median (C). Whiskers extend from the box to the minimum (A) and maximum (E) values. Analyzing the box plot can give insights into the data set, such as the distribution of the data, any potential outliers, and the comparison of different data sets.

What is 8+7times15 so what is it tell me now

Answers

The answer is 113. As said by the calculator


27x+3=6
Whats is x in that problem

Answers

Answer:

x=1/3

Step-by-step explanation:

You have to isolate the variable, so you must first separate the constants from the variable. Add 3 on both sides to cancel out the minus three and to move it to the other side. Now you have 27x=9. It's pretty simple from there just use your calculator and divide 27x/27 and also 9/27. That leaves you with 1/3

Final answer:

To solve for x in the equation 27x+3=6, we subtract 3 from both sides, divide both sides by 27, and get the solution x = 1/9.

Explanation:

To solve for x in the equation 27x+3=6, we'll start by isolating the variable x. First, subtract 3 from both sides of the equation to get 27x = 3. Then, divide both sides by 27 to find the value of x.

Subtract 3 from both sides: 27x + 3 - 3 = 6 - 3Simplify: 27x = 3Divide both sides by 27: x = 3 / 27Simplify the fraction: x = 1/9

Therefore, the solution to the equation is x = 1/9.

A coat is marked down 40% off the original price. If the
original price was S115.00, what is the sale price of the
coat before sales tax?​

Answers

Answer:

$69.00

Step-by-step explanation:

Hi there,

In order to solve this problem, I used this formula:

Dollar Markdown = (markdown %)(original price)

You will end up with Markdown = (0.4) (115).

(Be sure to convert the percentage to a decimal value. (ex. 40% = 0.4))

After multiplying, we find that 46 dollars is 40% of the original price.

For the final step, simply subtract the original price by the amount marked down to get $69.00.

Hope this was useful. Cheers.

The graph of which function is decreasing over the interval (–4, ∞)?

Answers

Step-by-step explanation:

ok, logic

all of them are parabolas

1st and 3rd are opening up, so they defenitely increase, so no

decraseing

the vertex hs to be be at x=-4

y=a(x-h)^2+k

h has to be -4

y=a(x+4)^2+k

the answer is 2nd one or f(x)=-(x+4)^2+4

Answer:

B

Step-by-step explanation:


Describe the difference between an angle with a positive measure and an angle with a negative measure.

Answers

Answer:

negative is rotating counter clockwise and positive is straight

Step-by-step explanation:

positive 180 degresse rotation

Positive angles result from counterclockwise rotation, and negative angles result from clockwise rotation.

What are angles?

In Plane Geometry, a figure which is formed by two rays or lines that shares a common endpoint is called an angle.

The difference between the positive and negative angles :-

Angles are sometimes classified based on whether their values are more than or less than 0° into positive and negative angles. The measure of a positive or a negative angle depends on the amount of rotation between the two sides forming the angle. The rotation is measured from the initial side to the terminal side of the angle.

What is a Positive Angle :-

An angle formed by an anti-clock wise or counterclockwise rotation from its initial side is called a positive angle.

12°, 33°, 90°, 180°, 360° are all example of positive angles.

What is a Negative Angle :-

An angle formed by a clockwise rotation from its initial side is called a negative angle.

-9°, -45°, -110°, -280°, -310° are all example of negative angles.

Learn more about angles, click;

https://brainly.com/question/13954458

#SPJ6

Which number is not in scientific notation?

Answers

Answer:

There are no answer choices

Step-by-step explanation:

I am sorry!

Answer:

What number?

Step-by-step explanation:

A right triangular pyramid has a height of 10 inches and a base area of 41.57 square inches. What is the volume, in cubic inches, of the pyramid?

Answers

Volume of a pyramid is (base^2) times (height/3). (41.57^2) times (10/3) Answer is approximately 5760.22 inches cubed.

The volume of the rectangular pyramid with the given values of height and base area is 138.5 cubic inches.

What is a right triangular pyramid?

A right triangular pyramid is simply a triangular pyramid which has an equilateral base, and whose top is directly above the base's centroid.

The volume of right triangular pyramid is expressed as;

V = 1/3 × b² × h

where b is the length of the base and h is the perpendicular height.

Given the data in the question;

Height of the pyramid h = 10in Base area A = 41.57in²

First we find the dimension of the base length.

Since area square is A = b².

Hence;

41.57in² = b²

b = √41.57in²

b = 6.447in

Now, we substitute our values into the expression above.

V = 1/3 × b² × h

V = 1/3 × (6.447in)² × 10in

V = 1/3 × 41.563809in² × 10in

V = 138.5in³

Therefore, the volume of the rectangular pyramid with the given values of height and base area is 138.5 cubic inches.

Learn more about volume of pyramids here: https://brainly.com/question/21308574

#SPJ2

This is the first year Janis is playing softball. She has been practicing her batting. On her last swing the bat made an arc with a radius of 48 inches and swept through 255° of rotation. Assuming the arc is circular, what is the distance the tip of the bat travels in inches in terms of pi? How many feet is this in terms of pi?

Answers

Final answer:

Using the relation between arc length and the radius, the arc length covered by the bat tip for a swing of 255 degrees with a 48-inch radius bat is (85/6)π inches or (85/72)π feet.

Explanation:

The subject of the question is based in mathematics, specifically geometry. To solve the question, first, we have to know that the circumference (C) of a given circle is calculated as

2πr

, where 'r' is the radius. Since 255° is a portion of the total circumference (which is considered as 360°), we calculate the fraction of the total circumference covered by 255°, which is 255/360. The arc covered by Janis's bat swing is, therefore,

(255/360)*2πr

. Substituting 'r' with 48 inches, the arc length (As) comes to

(85/6)π inches

. To convert this to feet, divide the result by 12 (since there are 12 inches in one foot), which gives

(85/72)π feet

.

Learn more about Arc Length Calculation here:

https://brainly.com/question/32092892

#SPJ3

Which linear equation represents the data given in the table?

Answers

Answer : D

We can find this answer through process of elimination.

From the table of values, we can see that the y-intercept is -3 from the point (0,-3)

We know that the equation for a line is

y = mx+b where b= the y-intercept

and D is the only equation where b = -3

The  linear equation represents the data given in the table is option D.

calculation:

Here we used the elimination process. From the table of values, we can see that the y-intercept is -3 from the point (0,-3)Now y = mx+b where b= the y-interceptAnd option D represent the only equation where b = -3.

Find out more information about the equation here: https://brainly.com/question/2263981?referrer=searchResults

Sasha made cups of lemonade to sell at her stand. She sold 9 cups of lemonade in the first hour. For each hour after that, she sold five cups. She was outside for a total of 4 hours. How many cups of lemonade did she sell?

Answers

Answer:

24 cups

Step-by-step explanation:

1st hours = 9 cups

2nd hour = 5 cups

3rd hour = 5 cups

4th hour = 5 cups

9 + 5 + 5 + 5 = 24 cups

Which is the angle of rotational symmetry for the isosceles trapezoid?

Answers

Angle of rotational symmetry for the isosceles trapezoid is 180 degrees .

Given, rotational symmetry for isosceles trapezoid .

The trapezium, also known as the trapezoid is a plane figure with four sides, two of which are of equal length.

If the other two sides are also of same length then the figure is said to be isosceles trapezoid .

There is no symmetry in a trapezoid unless it is an isosceles trapezoid. In that case it has one axis of symmetry that cuts the two bases in half. An 180 degree rotation about this axis produces the same figure. There are no other lines of symmetry.

Know more about isosceles trapezoid,

https://brainly.com/question/29626678

#SPJ6

Sophia wanted to knit a scarf 1 meters long. On Monday, she knit
of the length. On Tuesday, she knit another 45 centimeters.
What fraction of the scarf did she knit altogether?​

Answers

She knit 1/4 of the total length of the scarf on monday

Answer:

She knit 7/10 of the scarf altogether

Step-by-step explanation:

Please see the attached file for explanation

Tickets to a spring concert are $5.00 for students and $8.00 for adults. 250 tickets to the concert were sold for a total of $1550. How many tickets adult tickets and how many student tickets were sold?

Answers

Answer:

100 adult tickets

150 students tickets

Step-by-step explanation:

First, construct an equation that relates the tickets.  

For the first equation, 5x represents $5 per ticket for students and 8y represents $8 per ticket for adult, showing the money earned.  

For the second equation, x represents student tickets and y represents adult tickets, showing the tickets sold.

[tex]5x+8y=1550\\x+y=250\\[/tex]

Then, you have to cancel out similar factors.  I will multiply the second equation by -5 because that is the easiest option for this specific case.

[tex]-5(x+y=250)\\-5x-5y=-1250\\5x+8y=1550\\3y=300\\y=100[/tex]

We have solved for y, which is how many adult tickets were sold.  To solve for student tickets, we will solve the second equation.

[tex]x+y=250\\x+100=250\\x=150[/tex]

As a result we have 100 adult tickets and 150 student tickets.

Hope this helps!! <3

". Which of the following sentences does not represent a function?
A. Notebooks are sold in a four pack for $20
and a five pack for $25.
B. Shaunette charges $20 for one hour of
babysitting and $40 for two hours.
C. Marcy drove 50 miles in one hour today
and 100 miles in two hours yesterday.
D. Timon chewed six gumballs in two hours
today and six gumballs in three hours
yesterday

Answers

Final answer:

To be a function, each input must correspond to exactly one output. In all cases except for Timon's gumballs, each distinct input yields a distinct output. Therefore, the sentence about Timon's gumballs does not represent a function.

Explanation:

In mathematical terms, a function is a relation between a set of inputs and a set of permissible outputs with the property that each input is related to exactly one output. Let's go through these situations separately:

Notebooks are sold in a four pack for $20 and a five pack for $25. Here, the input, or the number of notebooks, determines the output, or price. No two outputs are the same for any given input. This is a function.Shaunette charges $20 for one hour of babysitting and $40 for two hours. The input (hours) determines the output (price). Similar to the first example, no two outputs are the same for any one input. This is a function.Marcy drove 50 miles in one hour today and 100 miles in two hours yesterday. The input (time) determines the output (distance traveled). There is a unique output for each input. This is a function.Timon chewed six gumballs in two hours today and six gumballs in three hours yesterday. This time, for different inputs (different hours), the output (number of gumballs chewed) is the same. This does not comply with the definition of a function because a function should have a unique output for each input. Therefore, this sentence does not represent a function.

Learn more about Functions here:

https://brainly.com/question/35114770

#SPJ2

What is a surface area?

Answers

Answer:

D

Step-by-step explanation:

in order to find the surface area, you have to add all of the surface area of the figure

Identify the type of function.
y = (x-5)(x-2)

Answers

X1 is 2, and X2 is 5.

Which number best represents the situation. "A plane descends 1, 500ft?
1,500
15
-1,500
-15

Answers

C. -1,500 bc the plane is decreasing in the air

Find all values of x in 17/x-12/x-12/(x-1)2

Answers

Answer:

Step-by-step explanation:

To solve

17/x-12/x-12/2(x-1)

5/x-12/2x-2

The LCM of x and 2x-2 is x and 2x-2

5(2x-2)-12x/x(2x-2)

10x-10-12x/x(2x-2)

To collect like in numerator

-2x-10/x(2x-2)

10–{12–[(−9)+(−1)]} answer ASAP please

Answers

Answer:

-12

Step-by-step explanation:

-9+(-1) is -10. 12-(-10) is 22. 10-22= -12

Find the range of each set of data.

Answers

Answer:

set 1 =11   set 2 =208  Set 2 has the wider spread since the range is bigger

Step-by-step explanation:

range- find the largest number and subtract the smallest number from it

Set 1: 12-1 =11

Set 2: 230-22 =208

-48 ÷ [-3 (2 - 4) ] = ?

Answers

Answer:

The answer is -8

Step-by-step explanation:

By the way, is that Lucy Heartfilia? :D

Free Brainiest Fellows
A triangle has 2 angles that each measure 81°.
What kind of triangle is it?
A.
isosceles triangle
B.
equiangular triangle
C.
obtuse triangle
D.
right triangle

Answers

Answer:

Explanation: An isosceles triangle is a triangle in which two of the three sides are the same length, or two of the three angles are the same degree.

Step-by-step explanation:

Answer:

A

Step-by-step explanation:

If 2 angles are congruent, then it is an isosceles triangle (ALWAYS)

How many triangles can you construct with two 4-inch sides and an 80 degree angle?

Answers

Answer:

  2

Step-by-step explanation:

The 80° angle can be between the two given sides, or opposite one of them. These are the only two possibilities.

What is the volume of the composite figure? Leave the
answer in terms of .
Tot mm
5 mm
3 mm

Answers

Answer:

It is 33 on edge 21.

Step-by-step explanation:

trust me :)

Juanita is booking a 4-night stay at a hotel. The rate is $79 per room plus tax.
If state tax is 6%, city tax is 2%, and municipal tax is 1%, what is her total
lodging cost?

Answers

answer: you don’t specify if it’s $79 per night or $79 for all 4 nights, so i’ll give you 2 answers.

if it’s $79 per night, then the answer is $344.44

if it’s $79 for all 4 nights, then the answer is $86.11

Final answer:

To determine the total lodging cost for Juanita's 4-night stay, multiply the nightly rate by the number of nights to get the pre-tax cost, calculate the total tax rate and apply it to the pre-tax cost to find the tax amount, and then add this tax to the pre-tax cost for the total cost. The total lodging cost, including taxes, will be $344.44.

Explanation:

Juanita is trying to calculate the total cost of a 4-night stay at a hotel with a nightly rate and additional taxes. To find Juanita's total lodging cost, a multi-step calculation is required. First, calculate the cost before tax by multiplying the nightly rate by the number of nights. Then, calculate the total tax by adding the state, city, and municipal tax rates and applying this sum to the pre-tax cost to get the total tax amount. Finally, add the tax amount to the pre-tax cost to find the total cost of the stay.

The nightly rate is $79 and she is staying for 4 nights, so the initial cost (before tax) is calculated as follows:

79 x 4 = $316

To calculate the total tax, convert the percentages to decimals and sum them up as follows:

State tax (6%) = 0.06
City tax (2%) = 0.02
Municipal tax (1%) = 0.01
Total tax rate = 0.06 + 0.02 + 0.01 = 0.09

Multiply the total tax rate by the pre-tax cost to find the total tax amount:

0.09 x 316 = $28.44

Finally, add the tax amount to the pre-tax cost to get the total lodging cost:

316 + 28.44 = $344.44

The total cost for Juanita's 4-night stay at the hotel, including all taxes, is $344.44.

Other Questions
Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings? What made Jake suspicious about the man with the camera?he was wearing dark glasseshe took a photo of themhe was the same man who sold Jake the maphe had followed them all dayIts C A researcher has developed a measure of a person's ability to detect colors. He finds the measure is not related to a person's spelling ability, which is a different type of measure. This finding is an example of _______ validity.a. convergentb. discriminantc. faced. concurrent Put in the counts under the notesPlease me help me The impact of the foot-in-the-door phenomenon is most clearly illustrated by