Select the THREE steps you should take if your clothes catch on fire.

stop

drop

roll

run

yell

Answers

Answer 1
Easy 5 points. Stop, Drop, and Roll. In that order.
Answer 2
Stop drop roll is the correct answer

Related Questions

What is the difference between mid-ocean ridges and trenches?

Answers

Answer:
Ridges = crust formation
Trenches = crust destruction

Explanation:
Mid-ocean ridges are areas of rifting where two tectonic plates are diverging from one another. Magma rises up through the rifts and forms mountain ranges. The largest is located in the middle of the Atlantic. Rifting creates new crust.
Deep-ocean trenches are formed at convergent plate boundaries where the more dense plate (usually the oceanic) subducts under the less dense (usually continental). Subduction destroys old crust and is often accompanied by volcanoes. They are common along the pacific rim.

Answer:

Mid-ocean ridges occur at divergent plate boundaries. Trenches occur at convergent plate boundaries.

(just took the test and this is the correct possible answer it gave me)

Many older individuals develop presbyopia, a condition in which ________. the lens loses elasticity and can no longer focus for distant vision the near point of accommodation becomes further away visual acuity declines the lens loses elasticity and can no longer focus for distant vision, and visual acuity declines

Answers

Many  order   individual   develop  Presbyopia  a  condition  in  which  the  near  point  of  accommodation    become  further  away
 
 Presbyopia  is  an   eye -related  condition  that  causes  blurred near  vision.  Typically it  starts  at  around  the   age  of  $0   years.  It  may  affect   even   those   who  have  never  had  vision  problem   before.  When  presbyopia  begins  one   hold  reading  material   at   arm  length  to  help  their  eyes  focus.

The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth.
a. True
b. False

Answers

The answer will be False! Because it does not have hydrogen as an alternative source of energy it is not exists on the surface of the earth.

Hope it helped

Answer will be bolded

the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence?

Answers

it have low diversities 

Answer:

The most likely explanation is that the mixed race has a low diversity in genes.

Explanation:

Elbow dysplasia is a condition that causes a bad development in the elbows of dogs, causing a bad formation of cartilage in that region of the paw, or a bad structure of the surrounding bones.

This condition is common in mixed breeds, because these breeds have little diversity of genes, allowing this disease to be passed to the offspring during crossbreeding between dogs that already have the disease.



Which of the following might be an observation related to global temperature increases?

Glaciers in many areas of the world are shrinking.

The number of predatory birds in an area is decreasing over time.

There is an increase in skin cancer deaths in the United States.

CFC concentrations in the atmosphere are high.

Answers

Final answer:

Glaciers shrinking in various regions is a strong indicator of global temperature increases. This is part of the broader effects of global warming, which include ecosystem disruption and rising sea levels linked to human-induced greenhouse gas emissions.

Explanation:

An observation that might be related to global temperature increases is that glaciers in many areas of the world are shrinking. This phenomenon, often referred to as glacier recession, has been well-documented in various parts of the world, including Glacier National Park in Montana. The retreat of glaciers is a direct consequence of rising mean annual temperatures, which has been recorded at an increase of 1.33°C since 1900 in the park. As glaciers shrink, they contribute to rising sea levels and affect local ecosystems by reducing seasonal water supplies.

The impact of global warming is not limited to glacier retreat; it also encompasses the loss of polar ice fields, increases in extreme weather events, shifts in habitats and biodiversity, and a range of other ecological disturbances. These changes are indicative of the broader shifts occurring due to increases in greenhouse gas emissions, which have been linked to human activities such as the burning of fossil fuels.

Centers for disease control and prevention have determined that ___________ is the single largest factor affecting longevity of life.

Answers

Lifestyle is considered as the single largest factor affecting the longevity of life. Maintaining a healthy lifestyle such as having a proper diet and adequate exercise increase the longevity of life while bad lifestyle habits such as smoking, alcohol use, and drug use, decrease the longevity of life and increase morbidity.

sweating an panting are examples of which characteristics of life

Answers

a. responding to the environment

Answer: Responding to the outer environment.

Explanation:

There are many characteristics of human beings that is required to survive. Out of all those one of them is responding to the outer environment.

The response of the outer environment can be any response by the body. Suppose the environment outside is cold then the body starts shivering and when the environment outside is hot then the body starts sweating or panting.

This is how the body responds to the outer environment.

How the planes could be used to help a patient describe a patient concern?

Answers

how the planes could be used to help a patient

The three planes namely, sagittal (median) plane, coronal plane and transverse plane. Through these planes, the position and orientation of the body parts can be described. Median plane cuts body into left and right symmetrical halves, coronal plane cuts into front and rear halves and transverse plane cuts into upper and lower portions.

Which of the joints will eventually develop into a synostosis?

Answers

Endochondral ossification leads to the eventual fusion of the epiphysis and diaphysis to form a synostosis.

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?

Answers

A gene instructs for the making of protein molecules.
Please make brainliest!☺

Are a category of sugars that contain either one or two molecules.

Answers

These are simple carbohydrates. This are molecules that can be broken down easily by the body to be used as source of energy. This is usually found in foods such as fruits, milk and milk products. This can also be categorized as single sugars or monosccharides, double sugars or disaccharides which includes sucrose, lactose and maltose. This must be differentiated from complex sugars which are normally polysaccharides. These are starches that form longer saccharide chains.

The ancient bacteria are members of the domain A) Archaea. B) Bacteria. C) Eukarya. Eliminate D) Monera.

Answers

archaea

.........................................................

The severity of a burn depends on several factors. the most important of these is: question 9 options:
a.location of burn
b.amount of burned area
c.age of victim
d.depth to which burn penetrates

Answers

D. Because the severity of it determines how easy or how difficult of a fix it is.

What neuronal action occurs at the pyramids of the medulla oblongata? what neuronal action occurs at the pyramids of the medulla oblongata? there is a slight drying of brain tissue due to lack of cerebral spinal fluid in this region. the axons of upper motor neurons cross to the opposite side of the brain. cranial nerves attach at this region and cross to the opposite side of the brain. the axons of general sensory neurons relay proprioceptive impulses from the spinal cord to the cerebellum at the pyramids?

Answers

The axons of upper motor neuron cross to the opposite site of the brain.

Multipolar neurons are found in the cerebral cortex, amygdala. Pyramidal neurons are usually primary excitation unit of mammalian prefrontal cortex and corticospinal tract. Pyramidal tracts such as the corticospinal tracts and corticobulbar tract motor fibers are contained in the pyramids. The lower limit of pyramids is marked when the fiber crossed or decussate. Most of the fibers of the pyramidal tracts  leave the pyramid in bundles and decussate in the anterior medial fissure of the medulla. 
Final answer:

At the pyramids of the medulla oblongata, upper motor neurons cross over to the opposite side of the brain. This results in contralateral control of the body for voluntary movements. Sensory information from the periphery is relayed to the cerebellum for feedback.

Explanation:

The neuronal action that occurs at the pyramids of the medulla oblongata involves the upper motor neurons in activities pertaining to voluntary movements. The axons of upper motor neurons cross to the opposite side of the brain in this area. This crossing over, also known as pyramidal decussation, allows for the contralateral control of the body, meaning that the right side of the brain controls the left side of the body and vice versa.

This process is part of the corticospinal tract which is responsible for conscious or voluntary movements of skeletal muscles. The corticospinal tract descends from the cortex, passing through the deep areas of the brain and reaching the pyramids of the medulla oblongata. Here, it does its characteristic crossing over.

Motor commands from the primary motor cortex are sent down the axons to activate lower motor neurons in the ventral horn of the spinal cord. Sensory information from the periphery also enters this area, providing feedback about movements and balance to the cerebellum through the inferior olive.

Learn more about Pyramids of Medulla Oblongata here:

https://brainly.com/question/32398580

#SPJ12

The image shows a magnified view of a leaf's surface with the stomata visible. What’s the significance of these structures in the process of photosynthesis? a micrograph of a green leaf with the stomata visible They’re the sites of maximum photosynthesizing activity because of the concentration of chloroplasts. They’re the storage sites of glucose, which is produced during the process of photosynthesis. They absorb water vapor from the atmosphere, providing water to the plant for photosynthesis. They allow the exchange of gases between cells in the leaf and the external environment. They allow light energy to enter the leaf, which is vital for the process of photosynthesis.

Answers

The correct answers is : They allow the exchange of gases between cells in the leaf and the external environment

The stomata are small openings that can be found on both the upper and the down part of the leaf and they are connected to the plant's vascular system.
These openings enable the plant to get rid of excess water in the form of vapor and to take CO2 from the atmosphere that is essential for the process of photosynthesis. 

Eukaryotic cells have developed more specialized functions than prokaryotic cells. What is this referring to?

Prokaryotic cells do not have a means for movement like eukaryotic cells do.

Prokaryotic cells exist in multicellular organisms and differentiate, but eukaryotic cells do not.

Eukaryotic cells are larger and have smaller surface area to volume ratios than prokaryotic cells.

Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not.

Answers

Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not.

Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not, this makes eukaryotic cells more specialized, hence option D is correct.

Why are eukaryotic cells considered more specialized?

Eukaryotic cells also contain additional membrane-bound components known as organelles in addition to a nucleus. Eukaryotic cells can be more specialized than prokaryotic ones because to organelles.

Eukaryotes frequently have several cells, but prokaryotes are invariably unicellular. Eukaryotic cells are also between 100 to 10,000 times bigger and more complicated than prokaryotic cells. Prokaryotic DNA is kept in the cytoplasm, whereas DNA in eukaryotes is kept in the nucleus.

Therefore, they are able to perform complicated metabolic reactions that prokaryotic cells are unable to due to their ability to maintain many habitats within a single cell.

Learn more about eukaryotes, here:

https://brainly.com/question/14823352

#SPJ2

odd one between carrot,beetroot,potato,radish

Answers

The odd one out in the given case is Potato All other things mentioned here that is Carrot, Beetroot and Radish are stem tubers while Potato is root tuber. In case of Stem tuber, there is no roots bore intact within it while in case of Root tuber, the roots can come out from any place within the tube..

the chance that a certain event will occur is known as its ______.

Answers

The chance that a certain event will occur is known as its probability.

Hope this helps!

-Payshence xoxo

A medical researcher hypothesizes that a new drug can reduce cholesterol. Which of these would most likely be the dependent variable in a study involving this medication?

A. The number of participants in the study.
B. The ages of the people treated for cholesterol with other medications.
C. The cholesterol level of the participants in the study.
D. The number of people treated for high cholesterol with other medications.
which is it?

Answers

The answer is "C. The cholesterol level of the participants in the study".

In a test or any experiment, the independent variable is controlled and the impacts watched. These watched impacts or observed factors are known as dependent variables. They are frequently the conjectured result of controlling the independent variables.  
A change in the dependent variable relies upon the independent variable and it's this relationship that scientists endeavor to measure when directing tests.

Answer:

C. The cholesterol level of the participants in the study.

Explanation:

The dependent variable is the one that is being studied in the experiment. In the given experiment, the effect of the drug on cholesterol levels is being studied.

Hence, the cholesterol levels of the experimental group would serve as a dependent variable here. According to the hypothesis, the cholesterol level is supposed to be reduced in the experimental group that is being treated with the drug.

Look carefully at the model. Plants take in the increased ground water and use the water for photosynthesis. Plants also release water into the atmosphere as a by-product of cellular respiration. What process returns the water to the water cycle (#5 in diagram)?
A) condensation
B) perspiration
C) synthesis
D) transpiration

Answers

Water returns to the water cycle through the process of transpiration. Hence, option D is correct.

What is transpiration?

Water moves through a plant during transpiration, where it evaporates from aerial parts like leaves, stems, and flowers. Although water is essential to plants, only a small portion of the water absorbed by the roots is utilized for growth and metabolism. Transpiration and guttation account for the remaining 97–99.5% of the loss.

Additionally, the movement of water and nutrients from the roots to the shoots is accelerated by transpiration. As a result, transpiration mechanisms have an impact on the global carbon and hydrological cycles as well as the yield and survival of agricultural species.

Water releases into the atmosphere by plants through transpiration. Hence, option D is correct.

Learn more about transpiration, here:

https://brainly.com/question/13891305

#SPJ6

In facilitated diffusion, the carrier protein has equal affinity for the molecule being transported on both sides of the membrane. in facilitated diffusion, the carrier protein has equal affinity for the molecule being transported on both sides of the membrane.
a. True
b. False

Answers

This is false

In facilitated diffusion a molecule is moved with its concentration gradient with the assistance of a protein carrier molecule, and no energy is required.

__________ is the cpt code and modifier for postoperative care only for a radical mastectomy including pectoral muscles, axillary, and internal mammary lymph nodes.

Answers

The answer would be 19306 

Current Procedural Terminology codes are used to specify the medical procedure. Mastectomy has many different codes ranging from 19300 up to 19307. Two of them (19305 and 19306) would be radical mastectomy. 
The code that used for radical mastectomy including pectoral muscles, axillary, and internal mammary lymph node would be 19306

Explain the process of mitosis in a tissue culture for normal cells

Answers

Mitosis is when a cell decays but also forms 2 or more cells to live in your body
Cell tissue is taken from a living organism.

Cells divide and reproduce in the culture.

Cells continue mitosis until they are touching, then they stop reproducing until a cell dies.

Cells reproduce one layer thick and then stop reproducing.

Cells undergo 20 to 50 mitotic divisions in a tissue culture.

Why would a lack of neurotransmitters cause a problem in the nervous system??

Answers

A lack of neurotransmitters can disrupt communication between neurons, leading to impaired transmission of signals and causing problems in the nervous system, such as cognitive, motor, or sensory dysfunction.

A lack of neurotransmitters can disrupt signal transmission, impair functions, and affect the balance of neural activity in the nervous system.Neurotransmitters are chemical messengers that facilitate communication between neurons in the nervous system. They play a crucial role in transmitting signals and information across synapses, allowing for proper functioning of the nervous system. When there is a lack of neurotransmitters, it can lead to significant problems.Firstly, neurotransmitters are involved in the transmission of signals related to movement, cognition, mood, and various physiological processes. Without sufficient neurotransmitters, the transmission of signals between neurons may be impaired, resulting in disruptions in motor function, cognitive processes, emotional regulation, and other essential functions.Furthermore, neurotransmitters also regulate the balance between excitation and inhibition in the brain. They help maintain proper neural circuitry and control the firing of neurons. Insufficient neurotransmitters can disrupt this balance, leading to abnormal neuronal activity, altered communication patterns, and potential neurological disorders.In summary, a lack of neurotransmitters can cause problems in the nervous system by disrupting signal transmission, impairing various functions, and affecting the delicate balance of neural activity and communication.

For more questions on Neurotransmitters:

https://brainly.com/question/27888471

#SPJ8

Based upon the specific health effects described above, mercury would be best classified as a ________.

Answers

Mercury  is  classified  as  a  neurotoxin.
   
Neurotoxin  are   extensive  class  of exogenous  chemical   neurological  insults  that  can  adversely  affect  function  on   both  developing  and  mature  nervous  tissue.in  other  words  neurotoxins  are  toxins that  are  poisonous  or  destructive  to  nerve  tissue.  the  nerve impulse  is  blocked  and  symptom  include  low  heart  rate  and  muscle  paralyses 

Which precaution is most important for the nurse to teach the 32-year-old female client prescribed topical tazarotene (tazorac) cream for psoriasis?
a. apply a dressing over?

Answers

D. Adhere to strict contraceptive measures while using the drug.Rationale: Tazarotene is highly teratogenic (can cause birth defects) even when used topically. Teach sexually active women of childbearing age using this drug to adhere to strict contraceptive measures. Lesions should not be dressed, and the drug should not be stopped without consulting the prescriber. Tazarotene does not alter the immune response and thus does not increase infection risk.

Anywhere the skin is touched in that area stimulates that ____________ neuron.

Answers

Anywhere the skin is touched in that area stimulates that sensation neuron.

Which head glands secrete sucrase, lipase, amylase, and invertase?

Answers

The answer would be labial glands.

The labial gland is a small gland that located near the orifice of the mouth. It can secrete several kinds of enzymes like sucrase and amylase that degrades the carbohydrate(sugar and starch), or lipase that degrades fat. These enzymes can help protect the mouth and teeth from bacteria.

What are the constituents of the vascular and lymphatic systems? consider structural similarities and differences between blood and lymph vessels, differences in the cell and molecular content of the blood and lymph, differences in the mechanism of fluid propulsion within blood and lymph vessels?

Answers

Lymph vessels travel one-way, back to the heart, venous route; has similar structure to veins including tunics and valves structural difference includes the lymph vessel's need to diffuse bigger molecules; lymph transport slower and has lower pressure and speed than veins

What should you do if the person does not give consent?
a. do not give care but instead call 9-1-1 or the local emergency number.
b. give care and call 9-1-1 or the local emergency number.
c. give care but do not call 9-1-1 or the local emergency number.
d. none of the above?

Answers

The answer is A. do not give care but instead call 9-1-1 or the local emergency number.
I hope this helps!!!
Other Questions
if x > 2, then (x-x-6)/(x-4) = ?please don't just answer, explain HOW to solve Why were some states reluctant to include equality language in their bill of rights and constitutions? discuss how the lack of an education can affect the future choose the picture that best illustrates "quitar el polvo" What term is used to describe the effort to ease tensions between the United States and the Soviet Union in the 1970s? a) Helsinki Accords b) cop d'etat c) Warsaw Pact d) detente from a point on the ground 47 feet from the foot of a tree, the angle of evelation of the top of the tree is 35 degrees. find the height of the tree to the nearest foot You arrive at the scene of a major motor vehicle crash. the patient, a 50-year-old female, was removed from her vehicle prior to your arrival. bystanders who removed her state that she was not wearing a seatbelt. the patient is unresponsive, tachycardic, and diaphoretic. your assessment reveals bilaterally clear and equal breath sounds, a midline trachea, and collapsed jugular veins. you should be most suspicious that this patient has experienced a: ANTIGONE:Ive not yet had my bridal chant,nor has any wedding song been sungfor my marriage is to Acheron.Which tone does this allusion reveal?maliciouscriticalsarcasticsolemn List 3 values that would make this inequality true 43 < y -30 What is a tragic flaw?A. a weakness of a minor character of high rank and personal qualityB. a strength of a central character, despite tragic circumstancesC. a weakness in a central character of high rank and personal qualityD. a strength of a minor character, despite tragic circumstances Match the following items. In the figure below, several reflections are illustrated. Note one line of symmetry is m and one is l. Pay close attention to the line of reflection being indicated by R l and R m. Una empresa minera realiza actualmente el mantenimiento de la maquinaria pesada con recursos internos. en el proceso, utiliza tres activos ms una serie de insumos variables y fijos. en este momento, una de las mquinas debe ser necesariamente reemplazada por no tener la posibilidad de una reparacin mayor y porque tecnolgica y econmicamente es ineficiente. mientras se evala la conveniencia de reemplazar una de las mquinas de mantenimiento, el gerente de la divisin le pide a usted que evale la conveniencia de externalizar todo el mantenimiento What is the term for the relative order of metals arranged by their ability to undergo reaction? . In The Story of an Hour by Kate Chopin, what is the most likely reason that Chopin refers to the main character as Mrs. Mallard rather than using her first name? to keep a distance between the reader and the character to show Mrs. Mallards loss of an independent identity in marriage to remind the reader of Mrs. Mallards elevated social class to reinforce the ideals of nineteenth-century America Which word shows the best meaning of the underlined word in this paragraph? Charlies family was not very prosperous, but that didnt stop Charlie. He worked hard in school and decided to start his own business. It took a lot of hard work and many years for him to succeed. Now Charlie is a flourishing businessman. A. smart B. active C. kind D. wealthy What positive perception do employers typically have of older employees? Counselors apply multidimensional models most explicitly in their work with clients when they: A container at a deli has exactly 5 pounds of cheese slices. Each cheese slice weighs exactly 2 ounces. How many total cheese slices are in the container? Which transformations will produce similar, but not congruent, figures?Triangle PQR is reflected across the x-axis and then rotated 90 clockwise to form triangle P"Q"R" . Triangle PQR is rotated 90 clockwise and then reflected across the y-axis to form triangle P"Q"R" . Triangle PQR is rotated 180 counterclockwise and then translated 11 units left to form triangle P"Q"R" . Triangle PQR is reflected across the y-axis and then dilated by a scale factor of 6 to form triangle P"Q"R" . Water enters a living organism from the physical environment when