What is the difference between mid-ocean ridges and trenches?
Answer:
Mid-ocean ridges occur at divergent plate boundaries. Trenches occur at convergent plate boundaries.
(just took the test and this is the correct possible answer it gave me)
Many older individuals develop presbyopia, a condition in which ________. the lens loses elasticity and can no longer focus for distant vision the near point of accommodation becomes further away visual acuity declines the lens loses elasticity and can no longer focus for distant vision, and visual acuity declines
The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth.
a. True
b. False
the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence?
Answer:
The most likely explanation is that the mixed race has a low diversity in genes.
Explanation:
Elbow dysplasia is a condition that causes a bad development in the elbows of dogs, causing a bad formation of cartilage in that region of the paw, or a bad structure of the surrounding bones.
This condition is common in mixed breeds, because these breeds have little diversity of genes, allowing this disease to be passed to the offspring during crossbreeding between dogs that already have the disease.
Which of the following might be an observation related to global temperature increases?
Glaciers in many areas of the world are shrinking.
The number of predatory birds in an area is decreasing over time.
There is an increase in skin cancer deaths in the United States.
CFC concentrations in the atmosphere are high.
Final answer:
Glaciers shrinking in various regions is a strong indicator of global temperature increases. This is part of the broader effects of global warming, which include ecosystem disruption and rising sea levels linked to human-induced greenhouse gas emissions.
Explanation:
An observation that might be related to global temperature increases is that glaciers in many areas of the world are shrinking. This phenomenon, often referred to as glacier recession, has been well-documented in various parts of the world, including Glacier National Park in Montana. The retreat of glaciers is a direct consequence of rising mean annual temperatures, which has been recorded at an increase of 1.33°C since 1900 in the park. As glaciers shrink, they contribute to rising sea levels and affect local ecosystems by reducing seasonal water supplies.
The impact of global warming is not limited to glacier retreat; it also encompasses the loss of polar ice fields, increases in extreme weather events, shifts in habitats and biodiversity, and a range of other ecological disturbances. These changes are indicative of the broader shifts occurring due to increases in greenhouse gas emissions, which have been linked to human activities such as the burning of fossil fuels.
Centers for disease control and prevention have determined that ___________ is the single largest factor affecting longevity of life.
sweating an panting are examples of which characteristics of life
Answer: Responding to the outer environment.
Explanation:
There are many characteristics of human beings that is required to survive. Out of all those one of them is responding to the outer environment.
The response of the outer environment can be any response by the body. Suppose the environment outside is cold then the body starts shivering and when the environment outside is hot then the body starts sweating or panting.
This is how the body responds to the outer environment.
How the planes could be used to help a patient describe a patient concern?
The three planes namely, sagittal (median) plane, coronal plane and transverse plane. Through these planes, the position and orientation of the body parts can be described. Median plane cuts body into left and right symmetrical halves, coronal plane cuts into front and rear halves and transverse plane cuts into upper and lower portions.
Which of the joints will eventually develop into a synostosis?
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?
Are a category of sugars that contain either one or two molecules.
The ancient bacteria are members of the domain A) Archaea. B) Bacteria. C) Eukarya. Eliminate D) Monera.
archaea
.........................................................
The severity of a burn depends on several factors. the most important of these is: question 9 options:
a.location of burn
b.amount of burned area
c.age of victim
d.depth to which burn penetrates
What neuronal action occurs at the pyramids of the medulla oblongata? what neuronal action occurs at the pyramids of the medulla oblongata? there is a slight drying of brain tissue due to lack of cerebral spinal fluid in this region. the axons of upper motor neurons cross to the opposite side of the brain. cranial nerves attach at this region and cross to the opposite side of the brain. the axons of general sensory neurons relay proprioceptive impulses from the spinal cord to the cerebellum at the pyramids?
At the pyramids of the medulla oblongata, upper motor neurons cross over to the opposite side of the brain. This results in contralateral control of the body for voluntary movements. Sensory information from the periphery is relayed to the cerebellum for feedback.
Explanation:The neuronal action that occurs at the pyramids of the medulla oblongata involves the upper motor neurons in activities pertaining to voluntary movements. The axons of upper motor neurons cross to the opposite side of the brain in this area. This crossing over, also known as pyramidal decussation, allows for the contralateral control of the body, meaning that the right side of the brain controls the left side of the body and vice versa.
This process is part of the corticospinal tract which is responsible for conscious or voluntary movements of skeletal muscles. The corticospinal tract descends from the cortex, passing through the deep areas of the brain and reaching the pyramids of the medulla oblongata. Here, it does its characteristic crossing over.
Motor commands from the primary motor cortex are sent down the axons to activate lower motor neurons in the ventral horn of the spinal cord. Sensory information from the periphery also enters this area, providing feedback about movements and balance to the cerebellum through the inferior olive.
Learn more about Pyramids of Medulla Oblongata here:https://brainly.com/question/32398580
#SPJ12
The image shows a magnified view of a leaf's surface with the stomata visible. What’s the significance of these structures in the process of photosynthesis? a micrograph of a green leaf with the stomata visible They’re the sites of maximum photosynthesizing activity because of the concentration of chloroplasts. They’re the storage sites of glucose, which is produced during the process of photosynthesis. They absorb water vapor from the atmosphere, providing water to the plant for photosynthesis. They allow the exchange of gases between cells in the leaf and the external environment. They allow light energy to enter the leaf, which is vital for the process of photosynthesis.
Eukaryotic cells have developed more specialized functions than prokaryotic cells. What is this referring to?
Prokaryotic cells do not have a means for movement like eukaryotic cells do.
Prokaryotic cells exist in multicellular organisms and differentiate, but eukaryotic cells do not.
Eukaryotic cells are larger and have smaller surface area to volume ratios than prokaryotic cells.
Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not.
Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not.
Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not, this makes eukaryotic cells more specialized, hence option D is correct.
Why are eukaryotic cells considered more specialized?Eukaryotic cells also contain additional membrane-bound components known as organelles in addition to a nucleus. Eukaryotic cells can be more specialized than prokaryotic ones because to organelles.
Eukaryotes frequently have several cells, but prokaryotes are invariably unicellular. Eukaryotic cells are also between 100 to 10,000 times bigger and more complicated than prokaryotic cells. Prokaryotic DNA is kept in the cytoplasm, whereas DNA in eukaryotes is kept in the nucleus.
Therefore, they are able to perform complicated metabolic reactions that prokaryotic cells are unable to due to their ability to maintain many habitats within a single cell.
Learn more about eukaryotes, here:
https://brainly.com/question/14823352
#SPJ2
odd one between carrot,beetroot,potato,radish
the chance that a certain event will occur is known as its ______.
A medical researcher hypothesizes that a new drug can reduce cholesterol. Which of these would most likely be the dependent variable in a study involving this medication?
A. The number of participants in the study.
B. The ages of the people treated for cholesterol with other medications.
C. The cholesterol level of the participants in the study.
D. The number of people treated for high cholesterol with other medications.
which is it?
Answer:
C. The cholesterol level of the participants in the study.
Explanation:
The dependent variable is the one that is being studied in the experiment. In the given experiment, the effect of the drug on cholesterol levels is being studied.
Hence, the cholesterol levels of the experimental group would serve as a dependent variable here. According to the hypothesis, the cholesterol level is supposed to be reduced in the experimental group that is being treated with the drug.
Look carefully at the model. Plants take in the increased ground water and use the water for photosynthesis. Plants also release water into the atmosphere as a by-product of cellular respiration. What process returns the water to the water cycle (#5 in diagram)?
A) condensation
B) perspiration
C) synthesis
D) transpiration
Water returns to the water cycle through the process of transpiration. Hence, option D is correct.
What is transpiration?Water moves through a plant during transpiration, where it evaporates from aerial parts like leaves, stems, and flowers. Although water is essential to plants, only a small portion of the water absorbed by the roots is utilized for growth and metabolism. Transpiration and guttation account for the remaining 97–99.5% of the loss.
Additionally, the movement of water and nutrients from the roots to the shoots is accelerated by transpiration. As a result, transpiration mechanisms have an impact on the global carbon and hydrological cycles as well as the yield and survival of agricultural species.
Water releases into the atmosphere by plants through transpiration. Hence, option D is correct.
Learn more about transpiration, here:
https://brainly.com/question/13891305
#SPJ6
In facilitated diffusion, the carrier protein has equal affinity for the molecule being transported on both sides of the membrane. in facilitated diffusion, the carrier protein has equal affinity for the molecule being transported on both sides of the membrane.
a. True
b. False
__________ is the cpt code and modifier for postoperative care only for a radical mastectomy including pectoral muscles, axillary, and internal mammary lymph nodes.
Explain the process of mitosis in a tissue culture for normal cells
Why would a lack of neurotransmitters cause a problem in the nervous system??
A lack of neurotransmitters can disrupt communication between neurons, leading to impaired transmission of signals and causing problems in the nervous system, such as cognitive, motor, or sensory dysfunction.
A lack of neurotransmitters can disrupt signal transmission, impair functions, and affect the balance of neural activity in the nervous system.Neurotransmitters are chemical messengers that facilitate communication between neurons in the nervous system. They play a crucial role in transmitting signals and information across synapses, allowing for proper functioning of the nervous system. When there is a lack of neurotransmitters, it can lead to significant problems.Firstly, neurotransmitters are involved in the transmission of signals related to movement, cognition, mood, and various physiological processes. Without sufficient neurotransmitters, the transmission of signals between neurons may be impaired, resulting in disruptions in motor function, cognitive processes, emotional regulation, and other essential functions.Furthermore, neurotransmitters also regulate the balance between excitation and inhibition in the brain. They help maintain proper neural circuitry and control the firing of neurons. Insufficient neurotransmitters can disrupt this balance, leading to abnormal neuronal activity, altered communication patterns, and potential neurological disorders.In summary, a lack of neurotransmitters can cause problems in the nervous system by disrupting signal transmission, impairing various functions, and affecting the delicate balance of neural activity and communication.For more questions on Neurotransmitters:
https://brainly.com/question/27888471
#SPJ8
Based upon the specific health effects described above, mercury would be best classified as a ________.
Which precaution is most important for the nurse to teach the 32-year-old female client prescribed topical tazarotene (tazorac) cream for psoriasis?
a. apply a dressing over?
Anywhere the skin is touched in that area stimulates that ____________ neuron.
Which head glands secrete sucrase, lipase, amylase, and invertase?
What are the constituents of the vascular and lymphatic systems? consider structural similarities and differences between blood and lymph vessels, differences in the cell and molecular content of the blood and lymph, differences in the mechanism of fluid propulsion within blood and lymph vessels?
What should you do if the person does not give consent?
a. do not give care but instead call 9-1-1 or the local emergency number.
b. give care and call 9-1-1 or the local emergency number.
c. give care but do not call 9-1-1 or the local emergency number.
d. none of the above?