Simplify the expression. (x1/8 y1/4)2

Answers

Answer 1

Answer:

Step-by-step explanation:

C) x1/4y1/2


Related Questions

what is a verbal expression?

Answers


A mathematical verbal expression is a translation into words of an algebraic expression that can consist of different operations, numbers and varibles ur welcome.

For example, the following is a verbal phrase: "John went to the store and bought five apples. Each apple cost $1.25. How much did John spend before tax?" To translate it to a verbal model, the problem solver represents the problem in simplified words that represent the cost of the apple times the number of apples bought. To translate it further to a mathematical phrase, the problem solver puts numbers in the problem: "$1.25 times 5."


which expression is in simplified form for the given expression and states the correct variable restriction u+3/u^2-9

Answers

Simplifying the expression given we shall have:
(u+3)/(u²-9)
factorizing (u²-9)=(u-3)(u+3)
thus plugging the substitute in the expression we shall have:
=(u+3)[(u-3)(u+3])
=1/(u-3)
Hence the answer is 1/(u-3)
u can take any values except 3.

Find an equation of the line passing through the pair of points. Write the equation in the form Ax+ By=C. (3,2) and (5,8)

Answers

The equation of the line passing through points (3,2) and (5,8) in the form of Ax+By=C will be written as follows:
equation of the line is given by the formula:
a(x-x1)=y-y1
where a is the slope
a=(y-y1)/(x-x1)
thus using our values:
a=(8-2)/(5-3)=6/2=3
thus the equation of the line will be:
3(x-3)=y-2
simplifying the above and writing in the form of Ax+By=C we shall have:
3x-9=y-2
3x-y=-2+9
3x-y=7
thus 3x-y=7 is in the form of Ax+By=C where A=3, B=-1 and C=7

after lily's graduation party, 1/2 of of the cake was left. she shared the remaining cake equally with her sister Kayla and her brother Logan. what fraction of the original cake did each of them get?

show all your work please

Answers

they each got 1/4

1/2 = 50%

50% / 2 = 25%

25%= 1/4

Someone please help I only have enough points for one use.

Answers

a-- i) 4/25 ii) 2/15
b . i)6/25 ii) 4/15

I would apprectiate a 5 star review and a Brainliest

Given that tan^2 e= 3/8 what is the value of sec e? A. +√8/3 B.+ √11/8 C. 11/8 D. 8/3

Answers

ANSWER

[tex]{ \sec}(e) = \pm \: \sqrt{\frac{11}{8} } [/tex]

EXPLANATION

We use the Pythagorean Identity,

[tex] { \sec}^{2} (e) = 1 + { \tan}^{2} (e)[/tex]

It was given that,

[tex] { \tan}^{2} (e) = \frac{3}{8} [/tex]

We substitute the values into the identity to obtain,

[tex] { \sec}^{2} (e) = 1 + \frac{3}{8} [/tex]

[tex]{ \sec}^{2} (e) = \frac{11}{8} [/tex]

We take square root of both sides to get,

[tex]{ \sec}(e) = \pm \: \sqrt{\frac{11}{8} } [/tex]

Answer:

sec e = √(11/8) ⇒ answer B

Step-by-step explanation:

* Lets revise some identities in trigonometry

# sin²x + cos²x = 1

- Divide both sides by cos²x

∴ sin²x/cos²x + cos²x/cos²x = 1/cos²x

∵ sinx/cosx = tanx

∴ sin²x/cos²x = tan²x

∵ cos²x/cos²x = 1

∵ 1/cosx = secx

∴ 1/cos²x = sec²x

* Now lets write the new identity

# tan²x + 1 = sec²x

- Let x = e

∴ tan²e + 1 = sec²e

- Substitute the value of tan²e in the identity

∵ tan²e = 3/8

∴ 3/8 + 1 = sec²e

- Change the 1 to the fraction 8/8

∴ 3/8 + 8/8 = sec²e ⇒ add the fractions

∴ 11/8 = sec²e

- Take square root for the two sides to find sec e

∴ sec e = √(11/8)

∴ The answer is B

What form of a quadratic function would be graphed having the vertex at the same point as the y-intercept

Answers

9514 1404 393

Answer:

  a form with no horizontal translation of the parent function

Step-by-step explanation:

If the vertex is the y-intercept, then it has not moved horizontally from its position in the parent function. The form of the quadratic is one without any horizontal translation.

A quadratic function with its vertex and y-intercept at the same point would be in the form f(x) = ax². The coefficients b and c must be zero for the vertex to be at the origin (0,0), and by varying a, we can achieve a vertical stretch or shrink without altering the y-intercept.

The student's question pertains to the graph of a quadratic function with specific conditions on its vertex. If a quadratic function has its vertex at the same point as its y-intercept, then the vertex is located at the origin (0,0), because the y-intercept is the point where the graph crosses the y-axis, and at the vertex, the value of y is at its maximum or minimum depending on the direction of the parabola.

The standard form of a quadratic function is f(x) = ax² + bx + c. For the function to have its vertex at the origin, both b and c would need to be zero, making the function f(x) = ax². This represents a parabola that opens upwards if a is positive, or downwards if a is negative.

To maintain the y-intercept, we must ensure that the transformation applied to the graph, such as a vertical or horizontal shrink, does not alter the location of the vertex. A horizontal shrink is achieved by making a larger absolute value while ensuring that it remains positive or negative in accordance with the original direction of the parabola.

Henry cut a piece of yarn that was 11/6 into two pieces. List to different pairs of fractions that could show the lengths , in feet , of the two pieces.

Answers

you could have 11/12 or 22/24

will give braniliest....... Mom put plums and apples onto a plate. The ratio of the number of plums to the number of apples was 3:2. How many fruit did mom put on the plate, if after Ed took 6 there number of plums on the plate became the same as the number of apples?

Answers

There would be 18 plums and 12 apples. Or, 18:12. If Ed ate 6 plums, then the ratio is 12:12
So she would have put 30 fruits (18 plums and 12 apples) on the plate
Hope this helps!

Question 21 [t-interval] a random sample of size 18 is drawn from a population that is normally distributed. the sample mean is 58.5, and the sample standard deviation is found to be 11.5. determine a 95% confidence interval about population mean.
a. [52.78,64.22]
b. [53.78,63.22]
c. [53.18,63.81]
d. [54.04,62.96]

Answers

Answer:

Option a. [52.78,64.22]

Step-by-step explanation:

We are given that a random sample of size 18 is drawn from a population that is normally distributed.

Sample mean is 58.5, and the sample standard deviation is found to be 11.5 i.e., X bar = 58.5  and  s = 11.5

The pivotal quantity for calculating 95% confidence interval is;

               [tex]\frac{Xbar - \mu}{\frac{s}{\sqrt{n} } }[/tex] ~ [tex]t_n_-_1[/tex]

So, 95% confidence interval about population mean is given by;

P(-2.110 < [tex]t_1_7[/tex] < 2.110) = 0.95

P(-2.110 < [tex]\frac{Xbar - \mu}{\frac{s}{\sqrt{n} } }[/tex] < 2.110) = 0.95

P(-2.110 * [tex]\frac{s}{\sqrt{n} }[/tex] < [tex]{Xbar - \mu}[/tex] < 2.110 * [tex]\frac{s}{\sqrt{n} }[/tex] ) = 0.95

P(X bar - 2.110 * [tex]\frac{s}{\sqrt{n} }[/tex] < [tex]\mu[/tex] < X bar + 2.110 * [tex]\frac{s}{\sqrt{n} }[/tex] ) = 0.95

95% confidence interval about [tex]\mu[/tex] = [ X bar - 2.110 * [tex]\frac{s}{\sqrt{n} }[/tex] , X bar + 2.110 * [tex]\frac{s}{\sqrt{n} }[/tex] ]

                                                   = [ 58.5 - 2.110 * [tex]\frac{11.5}{\sqrt{18} }[/tex] , 58.5 + 2.110 * [tex]\frac{11.5}{\sqrt{18} }[/tex] ]

                                                   = [ 52.78 , 64.22 ]

Therefore, 95% confidence interval about population mean is [52.78 , 64.22].

What is the area of the rhombus shown below? A. 110.5 square units B. 129.2 square units C. 221 square units D. 15 square units

Answers

the answer is A. 110.5

The area of the rhombus is 110.5 square units if the lengths of the diagonal of a rhombus are 13 and 17 units option (A) 110.5 square units is correct.

What is a rhombus?

A rhombus is a two-dimensional shape having four parallel opposite pairs of straight, equal sides. This shape resembles a diamond and is what you'd find on a deck of cards to represent the diamond suit. Rhombuses can be encountered in a variety of common situations.

We have a rhombus shown in the picture with dimensions:

As we know,

The area of the rhombus is given by:

A =pq/2

p and q are the lengths of the diagonal of a rhombus.

p = MK = 13 units

q = JL = 17 units

Plug the values in the formula:

A = (13×17)/2

A = 221/2

A = 110.5 square units

Thus, the area of the rhombus is 110.5 square units if the lengths of the diagonal of a rhombus are 13 and 17 units option (A) 110.5 square units is correct.

Learn more about the rhombus here:

brainly.com/question/22825947

#SPJ5

6.
Valdez Construction signed a note with a payment of $5,200 per quarter for 5 years.
Find the amount they must set aside today to satisfy this capital requirement in an account earning 8% compounded quarterly.


$30,506.32

$126,346.32

$51,054.38

$85,027.44

Answers

If P = Periodic payments done quarterly (that is, four time in a year) = $5,200, n = number of years (5), R = Annual interest rate = 8% = 0.08, and A = Amount to be set aside today, then

A = P [1-(1+R/4)^4n]/(R/4) = 5200 [1-(1+0.08/4)^4*5]/(0.08/4) = $85,027.45

Therefore, Valdez construction should set aside $85,027.44 now to satisfy the capital requirement.

The penguin exhibit at a zoo has a raised circular island that is surrounded by water. The diameter of the island is 20 meters. One penguin swims half way around the island before hopping out.

How far did the penguin swim?

Answers

The penguin swam 10 meters

Answer:

10pi

Step-by-step explanation:

The answer is 10pi

Find the lengths of the sides of the right triangle?

Answers

You can guess from your knowledge of Pythagorean triples that the triangle is a 5-12-13 right triangle. Since one side is 7 less than the other, this guess is confirmed.

The lengths of the sides are:
  2x = 12
  2x -7 = 5

_____
You can use the Pythagorean theorem to write the relationship between the sides.
  (2x)² +(2x -7)² = 13²
  4x² +4x² -28x +49 = 169 . . . . . eliminate parentheses
  8x² -28x -120 = 0 . . . . . . . . . . . put in standard form
  4(2x² -7x -30) = 0 . . . . . . . . . . . factor out 4
  (x -6)(2x +5) = 0 . . . . . . . . . . . .. divide by 4 and factor further
  x = 6, -5/2 . . . . . . . . . . . . . . . . .. only the positive solution (x=6) is useful
Then 2x = 12; 2x-7 = 5.

8.
Howmet Corporation needs $200,000 in 5 years.
Find the required quarterly payment into a sinking fund if funds are invested in an account earning 10% per year compounded quarterly.


$38,050.00

$6,716.00

$32,760.00

$7,830.00

Answers

Fv=pmt [(1+r/k)^(kn)-1)÷(r/n)]

Fv = 200,000
r = 0.1
n = 5
k = 4 (quarterly)
Pmt=200,000÷(((1+0.10÷4)^(4×5)−1)÷(0.10÷4))=7,829.43

At 0°C, the volume of a gas is 22 liters. For each degree the temperature T (in degrees Celsius) increases, the volume V (in liters) of the gas increases by 225. Write an equation that represents the volume of the gas in terms of the temperature.

Answers

At [tex]T=0^{\circ}C[/tex], the volume of the gas is V=22 L.

At temperature [tex]T=1C[/tex], the volume of the gas is (22+225) L.

This means that if we increase the temperature by [tex]k[/tex] degrees:
[tex]T=k^{\circ}C[/tex]
the volume of the gas is 
[tex]V=22 + 225 k [L][/tex] (1)

Since T=k, we can rewrite eq.(1) as
[tex]V= 22 + 225 T [L][/tex]
which gives the expression for the volume of the gas in liters, as a function of the temperature T in Celsius.

Answer:

V=2/25T+22

Step-by-step explanation:

Based on the family the graph below belongs to, which equation could represent the graph

Answers

Answer: Second option y=log(2x)+3


Solution:

Based on the family of graphs shown in the attached file, the equation could represent the graph is y=log(2x)+3

This graph is the graph of the funtion y=log(x) stretched horizontally by a factor of 2 and translated 3 units upward.

Logarithmic Functions Question, Many Points
I got the first part of this question correct, I believe.
I was supposed to find the graph with a base of 3 (attached), but now I need to justify my answers, which I don't understand. Here are the choices:

The graph of f(x)= log_3 x+c must intersect with the line y= c+1 when x= 3.

The graph of f(x)= log_3 x+c must intersect with the line y= c when x= 3.

The graph of f(x)= log_3 x+c must intersect with the line x= c when y= 3.

The graph of f(x)= log_3 x+c must intersect with the line x= c+1 when y= 3.

Answers

The best choice appears to be the first one.
   The graph of [tex]f(x)=\log_{3}(x)+c[/tex] must intersect with the line y= c+1 when x= 3.

_____
See the attachment for plots of base-3 logarithms. Note that when [tex]c=1.4[/tex], the value of f(3) is 1 more than the value of [tex]c[/tex].

3. Jared has two ropes. Each rope is 9 inches long. How many inches of rope does he have in all?

Answers

the answer is super easy all you have todo is to add nine plus nine and then you will get your answer to save time the answer is 19.

The length of one rope = 9 in

Number of ropes Jared have = 2.

The total inches of rope does Jared have will be calculated as under -

We can add the length of two ropes as = 9 in + 9 in = 18 in

Or we can do it by other method as well.

The other method is by multiplying -

The total inches of rope does Jared have = The length of one rope × Number of ropes Jared have

The total inches of rope does Jared have = 9 in × 2 ropes = 18 in

Julia had 2/3 quart of cleaning liquid. She used 1/4 of it to clean the sink. How much cleaning liquid did Julia use?

Answers

She had 2/3 quart. She used 1/4 of it.

That means you have to find 1/4 of 2/3

1/4 × 2/3 = 2/12

2/12 simplified 
= 1/6

Your answer is 1/6

Hope this helped!

She had 2/3 quart. She used 1/4 of it.

That means you have to find 1/4 of 2/3

1/4 × 2/3 = 2/12

2/12 simplified = 1/6

Your answer is 1/6

Hope this helped!

hey can you please help me posted picture of question

Answers

The correct answer is: 12 (Option A)

Explanation:
Total outcomes of rolling a die = 6 (as there are six sides)Total outcomes of  tossing a coin = 2 (there are two sides)
Total number of possible outcomes of both = 6*2=12 (Option A).

It represents the number of leaves required on the tree diagram.

In qam with 2 possible amplitudes, how many possible states

Answers

With two possible amplitudes the infinite successing possibilities only 4 will outcome.

Greg has 8/9 of a small box of cereal. He also has 5/6 of a pint of milk . He needs to pour 2/3 of each into a bowl.

Answers

Missing questions:
How much cereal was poured? How much milk was poured?

Solution:
Cereal poured = 2/3 of 8/9 of a small box of cereal = 8/9*2/3 = 16/27 of a small box of cereal.

Milk poured = 2/3 of 5/6 pint of milk = 5/6*2/3 = 5/9 pint of milk

Suppose you want to transform the graph of the function y=tan(x+pi/4)-1 into the graph of the function y=-tan(x+pi/2)+1

Answers

If you want to get y=-tan(x+π/2) +1 then;
In the given equation 
+1 will shift the function upward by 1 unit
minus(-) sign will reflect the graph across x_axis

see the attached diagram of -tan(x+π/2) +1

Answer:

A) Reflect the graph of the first function across the x-axis, translate it pi/4 units to the left, and translate it 2 units up

The fraction 7/8 is a multiple of what unit fraction?

Answers

7 = 7×1

[tex]\dfrac{7}{8}=7\times\dfrac{1}{8}[/tex]

The unit fraction is 1/8.

Which pair of triangles can be proven congruent by using the HL theorem?

Answers

Answer: figure C.

Explanation:

The HL theorem is the hypotenuse leg theorem.

The HL theorem is referred to the congruency of right triangles.

This theorem states that two right triangles that have a congruent hypotenuse and a corresponding, congruent leg are congruent triangles.

Figure A shows the congruency of two pairs of legs. So, this is not the answer.

Figure B shows the congruency of one pair of legs and one pair of angles. So, this is not the answer.

Figure C. shows the congruency of the two hypotenuses and one pair of legs. So, this is the righ answer.

Which description best describes the three-dimensional object that is formed when the segment is rotated about the axis as shown?

an oblique cylinder
a cone with an open base
a triangular prism
a hollow pyramid

Answers

Second option is correct. A cone with open base is formed when the segment is rotated about the axis as shown in figure.

What is solid revolution?

A solid revolution is a three dimensional figure obtained by rotating a two-dimensional figure or (curve) around a straight line(called the axis) that lies in the same plane.

According to the question

If we see in the given figure, there is a triangle about a vertical line. As the triangle is revolved about a line, the vertices A and C remain stationary. While the vertex B  which follows the path of circle. As the triangle rotates, AB creates the outline of cone.

Hence, Option second is correct i.e. a cone with an open base.

Learn more about the solid revolution here:

https://brainly.com/question/24201856

#SPJ2

Answer: A cone with an open base.

Step-by-step explanation:

      The correct answer is a cone with an open base. When this segment is rotated around the axis as shown, the three-dimensional object formed will be a cone with no base. If you imagine mirroring the segment shown, you will create a triangle with no base. Next, if you imagine spinning this triangle around, you will be left with a cone. Since the segment does not connect to the axis at the bottom, the resulting cone will have an open base.

      A visual example of a cone is attached below.

You earn $56 for washing 8 cars. How much do you earn for washing 5 cars?

Answers

You earn $56 for washing 8 cars.

First find out how much you earn washing one car. Divide 56 with 8

56/8 = 7

You earn $7 for washing 1 car.

Now find out how much you earn washing 5 cars.

7/1 (being $7 per 1 car)
5/5 (amount of cars washed)

7/1 x 5/5 = 35/5

For 5 cars, you earn $35.

$35 is your answer

hope this helps
Hello there!

$56 = 8 cars
$x   = 5 cars

Now we can do cross multiply

8 * x = 5 * 56

8x = 280

Now we can divide both sides by 8

8x/8 = 280/8

x = 35

Thus,

You earned $35 for washing 5 cars!


(2x3z2)3
------------------
x3y4z2 * (x-4z3)

Answers

The rules of exponents tell you to add exponents in the numerator and subtract those in the denominator. A power of a power causes the exponent to be multiplied.

[tex]\dfrac{(2x^{3}z^{2})^{3}}{x^{3}y^{4}z^2x^{-4}z^{3}}=2^{3}x^{(3\cdot3-3-(-4))}y^{-4}z^{(2\cdot3-2-3)}\\\\=\dfrac{8x^{10}z}{y^{4}}[/tex]

A jacket has a regular price of $80. It is on sale for 10% off. The sales tax is 7%. What is the total cost of the jacket including tax?

Answers

STEP 1:
Sale Price= Cost - (Cost * Discount %)

Sale Price= $80 - (80 * 10%)
=80 - 8
=$72 sale price


STEP 2:
use sale price from step 1 in this equation

Final Price= Cost + (Cost * Tax %)

Final Price= $72 + (72 * 7%)
= 72 + 5.04
= $77.04


ANSWER: The final price after a 10% discount and 7% sale tax is $77.04.

Hope this helps! :)

Answer:

77.04

Step-by-step explanation:

Other Questions
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure Summarize the narrative Churchill present Read this timeline:1975: federal election commission (fec) is established2002: bipartisan campaign reform act (bcra) is passed2010: citizens united v. fec is decidedwhat process do the events in the timeline reflect? Read this newspaper headline: Congressman Pushes Immigration Agenda Which change to the wording of this headline would make it more neutral without changing the overall meaning? A.Congressman Opposes Immigration Agenda B.Congressman Forces Immigration Agenda C.Congressman Advances Immigration Agenda D.Congressman Retracts Immigration Agenda Simon, come and clean up this mess at once for you(be)in trouble How did thomas jefferson purchase expand the president's power? The rectangle shown has a perimeter of 62 cm and the given area. its length is 4 more than twice its width. write and solve a system of equations to find the dimensions of the rectangle. What is the most effective way to reduce body fat? Why isn't a scale the best judge of body fat versus lean mass? Seawater has a ph of 8.1. what is the concentration of oh?