Simplify the following expression.

[tex]4a^{-2} b [/tex]

Answers

Answer 1
The first step for solving this expression is to express with a positive exponent using [tex] a^{-n} X \frac{1}{ a^{2}} X b[/tex].
4 × [tex] \frac{1}{ a^{2} } [/tex] × b
Now calculate the product.
[tex] \frac{4X1b}{ a^{2} }[/tex]
Before you get your final answer,, you must remember that any expression multiplied by 1 stays this same. This makes our final answer the following:
[tex] \frac{4b}{ a^{2}}[/tex]
Let me know if you have any further questions.
:)
Answer 2

Answer: C

Step-by-step explanation:

The grid shows a section of the beach in Coast City where each square has sides that are 100 yards long.

On a coordinate plane, the beach front is about 800 yards long. From the south pier to the north pier along harbor drive and park street, the distance is 1200 yards long.

Lisa walked from the South Pier to the North Pier along the beachfront. Deanna walked from the South Pier to the North Pier along Harbor Drive and Park Street. Which statement best describes the distances the two women walked?

a. Lisa walked about 400 yards farther than Deanna.

b. Lisa walked the same distance as Deanna.

c. Lisa walked about 400 yards less than Deanna.

d. Lisa walked about 400 yards.


Related Questions

determine the amount of an investment if $400 is invested at an annual interest rate of 7.25% for 7 years. round to the nearest penny.

Answers

Equation for one year:
0.0725(400)
But we have 7 years:
7(0.0725(400))
Multiply in the parentheses
7(29) = 203
400 + 203 = 603
You now have $603, and made $203

If 25 people play the game how many people do you expect to hit HHH?

Answers

.7 x.5 x.3= .105
25 x.105= 2.625
most likely either 2 or 3 

Answer:

Almost 3 persons are expected to hit HHH.

Step-by-step explanation:

To find the answer we must use the diagram, we see that among 8 possible results, there's one possible outcome to hit HHH.

So, to find the amount of people that are expected to hit HHH, we just have to  multiply each percentage assigned to the HHH outcome:

[tex](0.7)(0.5)(0.3)=0.105[/tex]

Now, we see that a 10.5% of the people will be expected to hit HHH.

The approximate number of people would be:

[tex]25(0.105) \approx 3[/tex]

Therefore, almost 3 persons are expected to hit HHH.

One angle of a triangle is three times as large as another. the measure of the third angle is 65 degrees more than that of the smallest angle. find the measure of each angle.

Answers

Let the smaller angle be x.

smaller =  x
larger = 3x
known angle = 65°

All angles add up t10 180:
x + 3x + 65 = 180
4x + 65 = 180
4x = 115
x = 28.75

Smaller angle = 28.75
Larger angle = 86.25

Answer: The angles are 28.75° and 86.25°

i need help with number 2 please p

Answers

This is what I got for number 2
b= 4.5
XY=8
YZ=8
XZ=16

Find the value of x and y

Answers

The answer is B. x= 62; y=30. 

Answer:

B. [tex]x=62[/tex]; [tex]y=30[/tex]

Step-by-step explanation:

We have been given two similar triangles. We are asked to find the value of x and y for the given triangles.

[tex]\Delta SWK\sim \Delta EBT[/tex]

We know that the measure of corresponding angles of two similar triangles are equal.

[tex]m\angle S=m\angle E[/tex]

[tex]m\angle W=m\angle B[/tex]

[tex]m\angle K=m\angle T[/tex]

[tex]110=2x-14[/tex]

[tex]2x-14=110[/tex]

[tex]2x-14+14=110+14[/tex]

[tex]2x=124[/tex]

[tex]\frac{2x}{2}=\frac{124}{2}[/tex]

[tex]x=62[/tex]

[tex]m\angle S=m\angle E[/tex]

[tex]40=m\angle E[/tex]

Using angle sum property, we will get:

[tex]m\angle E+m\angle B+m\angle T=180[/tex]

[tex]40+y+110=180[/tex]

[tex]y+150=180[/tex]

[tex]y+150-150=180-150[/tex]

[tex]y=30[/tex]

Therefore, option B is the correct choice.

On n − {1}, the relation r given by a r b iff the prime factorizations of a and b have the same number of 2's. for example, 48 r 80 because 48 = 24 · 3 and 80 = 24 · 5. name three elements in each of these classes: 7, 10, 72.

Answers

yes the answer to the question is 100rx

Find the slope of the line that passes through the pair of points. (4, 8), (8, 11)

Answers

Hey there! :) 

We're given the points : (4, 8) & (8, 11)

Plug these into the slope equation, which is : m = (y₂-y₁) / (x₂-x₁)

m = (11 - 8) / (8 - 4)

Simplify.

m = 3/4

So, our slope is 3/4! 

~Hope I helped!~

A class of 24 students was asked to identify a team spot in which they have participated. Their responses are shown in the line plot.

a. How many total responses are recorded in the line plot for the five sports?
b. What is the total number of students polled?
c. Give a possible explanation as to why the answers of part (a) and (b) are different.

Answers

a. How many total responses are recorded in the line plot for the five sports?
The total number of responses recorded for the five sports according to the line plot is 28

b.What is the total number of students polled?
Given that a class of 24 students was asked to identify the team spot in which they have participated, then the number of students who polled was 24.

c] The reason why the answers to part a and part b are different could be because some students participated in more than 1 sport.

Find the product of (5.2 · 10-6) and (8 · 103).

Answers

Final answer:

To find the product of (5.2 · [tex]10^-^6[/tex]) and (8 · 10³), multiply the base numbers and add the exponents. The result is 41.6 × [tex]10^-^3[/tex], which simplifies to 4.16 × 10^-2.

Explanation:

The student asked to find the product of two numbers expressed in scientific notation: (5.2 · [tex]10^-^6[/tex]) and (8 · 10³). When multiplying numbers in scientific notation, you multiply the base numbers and add the exponents.

Step-by-Step Solution:

Multiply the base numbers: 5.2 × 8, which equals 41.6.Add the exponents of 10: (-6) + 3, which equals -3.Combine the results to express the product in scientific notation: 41.6 × [tex]10^-^3[/tex].

Simplified Result:

This can further be simplified by writing 41.6 × [tex]10^-^3[/tex]as 4.16 × [tex]10^-^2[/tex], by moving one decimal place to the left in the base number and increasing the exponent by 1 to balance it.

WILL GIVE BRAINLIEST
Use a calculator to find the mean and standard deviation of the data. Round to the nearest tenth.

946, 726, 956, 519, 104, 415, 428, 457, 614, 201, 772, 801

A. mean = 566.5; standard deviation = 261.9
B. mean = 578.3; standard deviation = 261.9
C. mean = 578.3; standard deviation = 68572.4
D. mean = 566.5; standard deviation = 68572.4

Answers

The mean is the sum of all 12 numbers divided by 12, which is 578.25 ~ 578.3. The variance is calculated by subtracting each score from the mean, squaring, and adding all such squares. Then divide by the number of terms (12) to get 68572.35. Take the square root to get the standard deviation, which is 261.9. So the correct answer is B.


Answer:

mean is 578.3 deviation 261.9

Step-by-step explanation:


Please help me with this
thank u soo much:)

Answers

Point a is minimum
Point b is first quartile
Point c is the median
Point d is the maximum
If this is a whisker plot then the answers are:

A = Minimum Value
B = First Quartile
C = Median
D = Maximum Value

Hope this helps :)

What is the surface area of a cone with diameter 28 cm and height 22 cm in terms of pi?

a. 196 pi cm^2
b.365 pi cm^2
c.561.1 pi cm^2
d.2202.8 pi cm^2

Answers

The surface area of a cone equation is something really annoying to type out so look at the picture. radius=1/2diameter so r=14. h=22 Plug in the equation to get 561pi.
Just use ur calculator. 
Answer:

The surface area of a cone with diameter 28 cm and height 22 cm in terms of pi is:

        c.     561.1 pi cm²

Step-by-step explanation:

The diameter of cone= 28 cm

Radius of cone is half the diameter this means that:

Radius(r) of cone= 14 cm

Also, height(h) of cone= 22 cm

We know that the surface area of cone is given by:

[tex]Surface\ Area=\pi r(r+\sqrt{h^2+r^2})[/tex]

Now as we know the value of h and r hence we will substitute these values in the formula to get:

        [tex]Surface\ Area=\pi \times 14(14+\sqrt{(14)^2+(22)^2})\\\\\\Surface\ Area=14\pi (14+26.07681)\\\\\\surface\ Area=14\pi\times 40.07681\\\\\\Surface\ Area=561.07534\pi cm^2[/tex]

  Hence, the surface area of cone is:  561.1π cm²

TIMED, anyone know the answer?

Answers

The answer is C. Angle D is congruent to angle P.

This is true because the first concave hexagon is simply reflected across the vertical to create the second figure. We know this by examining the congruent side lengths.

Write an equation for a line
g(x)
perpendicular to
f(x) = 5x − 8
and passing through the point
(5, 10)

Answers

[tex]k: y = mx + b[/tex]
[tex]l: y = nx + c[/tex]
[tex]l\ \perp\ k\ \iff\ m\cdot n = -1[/tex]
We have:
[tex]k:\ f(x)=5x-8\\\\l:\ g(x)=mx+b\\\\l\ \perp\ k\iff 5m=-1\ \ \ |:5\to m=-\dfrac{1}{5}[/tex]

therefore
[tex]l:\ y=-\dfrac{1}{5}x+b[/tex]
The line passing through the point (5; 10).
Substitute the values of the coordinates of the point
[tex](5;\ 10)\to x=5;\ y=10\\\\10=-\dfrac{1}{5}\cdot5+b\\\\10=-1+b\ \ \ \ |+1\\\\b=11[/tex]
[tex]Answer:\ \boxed{y=-\dfrac{1}{5}x+11}[/tex]

A group of people are going on a 5 mil hike. They walked 2 1/10 miles in the morning and 1 1/4 mils during the first hr of the afternoon. How many miles do they have to walk?

Answers

Answer: 1 13/20 miles

Explanation:

[tex]5 - 2\cfrac{1}{10} - 1 \cfrac{1}{4} = 5 \cfrac{0}{20} - 2\cfrac{2}{20} - 1 \cfrac{5}{20} = 4 \cfrac{20}{20} - 2\cfrac{2}{20} - 1 \cfrac{5}{20} = 1 \cfrac{13}{20}[/tex]

Which linear expression is a factor of the polynomial function f(x) = x3 + 2x2 − x − 2? x − 2 x + 2 x + 3 x − 3

Answers

f(-2) = -2^3 + 2(-2)^2  - - 2 - 2 =  -8  + 8 + 2 - 2 =  0
So by the factor theorem:-
 x + 2 is a factor   

What is the value, after 7 years, of a 2014 mustang that was originally 25,000.00, if it depreciates at a rate of 8% per year??

Answers

25.000 x (0,92)^7  ≈  13.946,165

The estimated answer would be =14000

For a function p(x)= x^2-9, what is the inverse function for the domain [0, infinity\

Answers

An inverse function is a function that reverses another function, so we have a function called:

[tex]p(x)[/tex]

Then, the inverse function will be as follows:

[tex]p^{-1}(x) [/tex]

Given that [tex]y = p(x)[/tex], we need to isolate x in terms of y:

[tex]y = x^{2} -9[/tex]
∴ [tex]y+9 = x^{2}[/tex]

So:

[tex]x=+\sqrt{y+9}[/tex] and [tex]x=-\sqrt{y+9}[/tex]

therefore, exchanging variables x and y:

[tex]y=+\sqrt{x+9}[/tex] and [tex]y=-\sqrt{x+9}[/tex]
[tex]p^{-1}(x)=+\sqrt{x+9}[/tex] and [tex]p^{-1}(x)=-\sqrt{x+9}[/tex]

Which are the figures shown below.

Uppose a jar contains 12 red marbles and 18 blue marbles. if you reach in the jar and pull out 2 marbles at random without replacement, (a) find the probability of getting two red marbles:

Answers


[tex] \frac{12}{30} \times \frac{11}{29} = \frac{22}{145} [/tex]

[tex] \displaystyle
|\Omega|=\binom{30}{2}=\dfrac{30!}{2!28!}=\dfrac{29\cdot30}{2}=435\\
|A|=\binom{12}{2}=\dfrac{12!}{2!10!}=\dfrac{11\cdot12}{2}=66\\\\
P(A)=\dfrac{66}{435}=\dfrac{22}{145}\approx15\% [/tex]

Paul took out a 2-year loan for $1450 at a computer retailer to be paid back with monthly payments at an 18% APR, compounded monthly. If the loan offers no payments for the first 4 months, about how much in total will Paul pay in interest for the loan?

Answers

the answer is 342.80
342.80.....Apex                     hope this helps
                   

Sathish is going on a 200020002000-kilometer road trip with two friends. The car consumes 666 liters of gas for every 100100100 kilometers, and gas costs \$1.20$1.20dollar sign, 1, point, 20 per liter.If Sathish and his two friends want to split the cost evenly, how much should they each pay?\$

Answers

The amount of liters of gas is given by:
 L = (2000) * (6/100)
 L = 120
 The total cost of gas for the trip is given by:
 C = (1.20) * (120)
 C = 144 $
 Therefore, the amount that each one must pay is:
 (144) / (3) = 48 $
 Answer:
 
they should each pay about:
 
$ 48

Please help me on this ?!?!?!

Answers

show the picture of the problem not just the answers and might be able to help you.

what is 17.5 of 50???

Answers

17.5% of 50 = 0.175×50 = 8.75
 = 8 3/4
 = 35/4

How do find the measure of side a?

Answers

sin 34 =  a/25
a = 25 sin 34
a =  14 m   to nearest whole number

The measure of side a is 14.

We have,

We use the trigonometric identites:

Sin function

Now,

Sin A = Perpendicular / Hypotenuse

Sin 34 = a / 25

0.56 = a / 25

a = 0.56 x 25

a =  14

Thus,

The measure of side a is 14.

Learn more about trigonometric identities here:

https://brainly.com/question/14746686

#SPJ6

You want to draft a four ­player tennis team. There are eight players to choose from. How many different teams can you form?

Answers

We want to make a 4 players team, and there are total 8 players. As we know the order of selection does not matter in a team of players, only the combination of players matters.

So we would use concept of Combinations and It will be choose 4 out of 8 players.

The formula for Combination is given as follows :-

[tex]nCr = \frac{n!}{r!*(n-r)!} \\\\ Choose \;4 \;out \;of \;8 \;players \\\\ 8C4 = \frac{8!}{4!*(8-4)!} = \frac{8!}{4!*4!} \\\\ 8C4 = \frac{8*7*6*5*4*3*2*1}{(4*3*2*1)*(4*3*2*1)} = \frac{8*7*6*5}{4*3*2*1} =\frac{1,680}{24} = 70 \;combinations[/tex]

Hence, Total number of different teams = 70 combinations.

What is the area of a circle with a radius is of 6 inches?

Answers

The area is 113.04 units², because you can use the equation πr²
Area = 113.04 in.²Work is provided in the image attached.

Using radicals, write an equivalent expression for 2 1/3

Answers

2 1/3 does not involve radicals.  Did you perhaps mean 2^(1/3)?  If so, 

2^(1/3) = ∛2

The equivalent expression of [tex]2^{\frac{1}{3} }[/tex] in radical forms is ∛2

What are radicals?

Radical are expression that uses a root, such as square root, cube root . They are numbers represented in radical symbols.

Therefore,

[tex]2^{\frac{1}{3} }[/tex] in radical form can be represented as follows:

Using indices rule

[tex]a^{\frac{1}{b} } = \sqrt[b]{a}[/tex]

Therefore,

[tex]2^{\frac{1}{3} } = \sqrt[3]{2}[/tex]

learn more on radical here: https://brainly.com/question/3494698

#SPJ2

The scale factor of a figure and its enlargement is 6. What is the new length of the enlarged figure if the original length is 3 cm?
3 cm
6 cm
18 cm
36 cm

Answers

You multiply three times six.

3 x 6 = 18


Answer:

The new length of the enlarged figure will 18 cm.

Step-by-step explanation:

A scale factor is a number which scales, or multiplies the original figure by some quantity.

In the equation [tex]y = Cx[/tex], C is a scale factor for x. It is called the constant of proportionality or scale factor of y to x.

As the given length is 3 cm, so with a scale factor of 6, the length of the enlarged figure will be [tex]3\times 6=18[/tex] cm

Therefore, the new length of the enlarged figure will 18 cm.

if f(x) and it’s inverse function, f-1(x) are both plotted on the same coordinate plane, what is their point of intersection?

Answers

By using basic property of inverse function we got that if f(x) and it’s inverse function are both plotted on the same coordinate plane, then their point of intersection is (3,3)

What is function ?

Function is relation between a set to another set with a property that every element of first set has a unique image in second set.

Here graph of f(x) is given and we have to find the point of intersection of function and it's inverse function

We know that a function and it's inverse function are mirror image of each other with respect to line y=x hence they intersect only at y=x line

By drawing y=x line with the given graph we got that f(x) intersect y=x line at (3,3) hence inverse function will intersect at (3,3)

By using basic property of inverse function we got that if f(x) and it’s inverse function are both plotted on the same coordinate plane, then their point of intersection is (3,3)

To learn more about function visit :https://brainly.com/question/25749514

Final answer:

When the graph of a function and its inverse function are plotted on the same coordinate plane, the point of intersection is the point where the two graphs intersect. Therefore, the point of intersection is (x, y).

Explanation:

When the graph of a function and its inverse function are plotted on the same coordinate plane, the point of intersection is the point where the two graphs intersect.

Let's say the point of intersection is (x, y).

This means that both f(x) and f-1(x) have the same x-coordinate, which is x, and the same y-coordinate, which is y.

Therefore, the point of intersection is (x, y).

Learn more about inverse functions here:

https://brainly.com/question/17872426

#SPJ3

A culture started with 3,000 bacteria. After 7 hours, it grew to 3,300 bacteria. Predict how many bacteria will be present after 17 hours. Round your answer to the nearest whole number. P=Ae^kt


Answer:3,780

Answers

P=Ae^(kt)
3300=3000e^(7k)
11=e^(7k)
In(11)/7=k
P=Ae^(In(11)/7t)
P=3000e^(In(11)/7(17))= 3780 in population.

Other Questions
Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other Polands energy resources can be described as _____. a. based on large deposits of coal b. rich in petroleum c. large deposits of sulfur d. large deposits of copper If a circle has a radius of 18 feet what's the closest approximation for circumference Has complete control of the laws rules and affairs of a country Plz jphelp me answer this year 7 question and explain how u got the answer. If the most industrialized countries all signed a climate-change treaty with the goal of keeping the sea at its current level, which would be a free rider benefiting from a positive externality of the treaty America wanted to end japan's aggression by placing a(n) _______ to cut off the oil and scrap metal supply. Eva is jumping on a trampoline. Her height h at time t can be modeled by the equation h=-16t^2+20t+6. Would Eva reach a height of 14 feet? A traveler's budget and needs are considered by a _________ when arranging a trip. Which antibiotic was most effective in inhibiting the growth ofe. coli? Length of side AB??? your recipe calls for 1/2 a pound of potatoes. You use 1/6 of the bag of potatoes. whats the number of pounds per bag how many gallons of 20% alcohol solution and 50% alcohol solution must be mixed to get 9 gallons of 30% alcohol solution