Taxicabs downtown charge a flat fee of $3.25, plus a state tax of $0.50, plus $0.50 for each 1/ 5 mile they travel with a passenger. Travis took a taxicab from his office to a meeting on the other side of town. The cab ride cost $14.75, which includes a $3.00 tip. In decimal form, how far is it from his office to the meeting?

Answers

Answer 1

Answer:

3.2 miles

Step-by-step explanation:

Initial fee plus state tax first because they are static:

3.25 + 0.5 = 3.75

Remove the initial charge plus tip from total cost:

14.75 - 3 - 3.75 = 8

Divide by 0.5 to get how many 1/5 of a mile he went:

8 / 0.5 = 16

Divide 16 by 5 to get miles:

16 / 5 = 3.2 miles

Answer 2

Answer:

3.2 miles

Step-by-step explanation:

Initial fee plus state tax first because they are static:

3.25 + 0.5 = 3.75

Remove the initial charge plus tip from total cost:

14.75 - 3 - 3.75 = 8

Divide by 0.5 to get how many 1/5 of a mile he went:

8 / 0.5 = 16

Divide 16 by 5 to get miles:

16 / 5 = 3.2 miles


Related Questions

If g(4) = 16, g(5) = 18, g(6) = 20, then g(3) =
?

Answers

Answer:

14

Step-by-step explanation:

it's going up by 2 everytime so you just take away 2

X2 + y2 = 1 x = 1 Hina's work: substitute: (1)2 + y2 = 1 simplify: 12 + y2 = 1 isolate the variable: y2 = 0 solve for y: y = 0 Complete Hina's work to determine which statements are true for the system of equations. Check all that apply. The system of equations has no solutions. The system of equations has one solution. The system of equations has two real-number solutions. A solution to the system is (0, 0). A solution to the system is (1, 0).

Answers

Answer:

the correct answer is B.

Step-by-step explanation:

The system of equations has one solution. Option B is correct.

What is simplification?

The process in mathematics to operate and interpret the function to make the function or expression simple or more understandable is called simplifying and the process is called simplification.

Here,
Given expression,
x² + y² = 1

Now,
Put x = 1
1 + y² = 1
y² = 0
y = 0

Since for the given expression more than one solution can be possible but for the given condition a x = 1 only one solution is possible.

Thus, the system of equations has one solution. Option B is correct.

Learn more about simplification here:

https://brainly.com/question/12501526

#SPJ5

I'VE TRIED EVERY METHOD POSSIBLE TO ANSWER THESE QUESTIONS AND KEEP HITTING DEAD ENDS SO PLS IF YOU CAN HELP PLS DO BECAUSE I'M STUCK


A cone-shaped kitchen funnel has a diameter of 6 inches and a height of 7 inches. About how many times would you need to fill the funnel to fill a cylindrical can that has a radius of 4 inches and a height of 13 inches?

A. 3

B. 4

C. 9

D. 10

The circumference of an orange is approximately 37.68 centimeters. What is the approximate volume of the orange? Use 3.14 for π.

A. 226.08 cubic meters

B. 678.24 cubic meters

C. 904.32 cubic meters

D. 7234.56 cubic meters


Which of the following statements about the volume of a sphere and the volume of a cone are true? Select two answers.

A. You can find the volume of a sphere with only the diameter.

B. You can find the volume of a sphere with only the radius.

C. You can find the volume of a cone with only the height.

D. You can find the volume of a cone with only the diameter.

Answers

Answer:

D.

C.

A,B

Step-by-step explanation:

Given:

Diameter of a cone-shaped kitchen funnel = 6 inches

Height of a cone-shaped kitchen funnel = 7 inches

Radius of a cylindrical funnel = 4 inches

Height of a cylindrical funnel = 13 inches

To find: Number of cylindrical funnels required to fill a cone-shaped kitchen funnel

Solution:

Radius of a cone-shaped kitchen funnel (R) = 6/2 = 3 inches

Height of a cone-shaped kitchen funnel (H) = 7 inches

Volume of a cone-shaped kitchen funnel = [tex]\frac{1}{3}\pi R^2H=\frac{1}{3}\pi(3)^2(7)=21\pi[/tex] cubic inches

Radius of a cylindrical funnel (r) = 4 inches

Height of a cylindrical funnel (h) = 13 inches

Volume of a cylindrical kitchen funnel = [tex]\pi r^2h=\pi(4)^2(13)=208\pi[/tex] cubic inches

Number of cylindrical funnels required to fill a cone-shaped kitchen funnel =  9.9≈ 10

Option D. is correct

Given:

Circumference of an orange = 37.68 centimeters

To find: volume of the orange

Solution:

Let r be the radius of the orange

Circumference of an orange = 37.68 centimeters

[tex]2\pi r=37.68\\r=\frac{37.68}{2\pi}[/tex]

Volume of the sphere = [tex]\frac{4}{3}\pi r^3[/tex]

[tex]=\frac{4}{3}\pi \left ( \frac{37.68}{2\pi} \right )^3[/tex]

[tex]=\frac{4}{3}\frac{\left ( 37.68 \right )^3}{8(3.14)^2}=904.32[/tex] cubic metres

Volume of sphere can be computed using only the radius or using only the diameter.

Option A and B are correct.

For volume of cone, both radius and height are required

For similar light intensity, compact fluorescent bulbs use about 25% of the energy of incandescent bulbs. Let's say you replaced a bulb of 100 W with a fluorescent bulb and that your utility charges $0.15/kW-hour. How many dollars would you save in electricity in the 10,000−hour lifetime of the bulb?

Answers

Answer:

$112.50¢

Step-by-step explanation:

please kindly check the attached file for explanation

$112500 would be saved in electricity in the 10,000−hour lifetime of the Fluorescent bulb.

Given that compact fluorescent bulbs use about 25% of the energy of incandescent bulbs.

Hence, For a 100W bulb, the corresponding energy is:

Fluorescent bulb = 25% of 100W = 0.25 * 100 = 25W

Since the charges is $0.15/kW-hour, hence, for 10000 hour lifetime:

Total charges for  Incandescent = 100W * 10000 hour * $0.15/kW-hour = $37500

Total charges for Fluorescent = 25W * 10000 hour * $0.15/kW-hour = $150000

Therefore the money saved in electricity = $150000 - $37500 = $112500

Hence $112500 would be saved in electricity in the 10,000−hour lifetime of the Fluorescent bulb.

Find out more at: https://brainly.com/question/19970022

The diameter of a circle is 20 kilometers. What is the angle measure of an arc bounding a sector with an area 10 pi square kilometers. (Simplify fractions)

PLEASE ANSWER

Answers

Answer: I’m not sure

Step-by-step explanation: Good luck some one will answer soon i hope

Answer: The answer is 9.

Step-by-step explanation:

I didn't get a fraction. I plugged in the information. I got 10pi/400pi =x/360. After doing the calculations I then got 9 and it was correct when I plugged it into my assignment. Hope this helped.

If the triangle shown in the diagram is translated 3 units right and 4 units down, what will be the coordinates of S’?

Answers

Answer:-5

Step-by-step explanation:

It’s just how it is -5

The coordinate of S' is (1, -5) if the triangle in the diagram is translated 3 units right and 4 units down.

What is geometric transformation?

It is defined as the change in coordinates and the shape of the geometrical body. It is also referred to as a two-dimensional transformation. In the geometric transformation, changes in the geometry can be possible by rotation, translation, reflection, and glide translation.

The question is incomplete.

The complete question is in the picture, please refer to the attached picture.

Let point is (-2, -1)

Now,

Translated 3 units right, the x-coordinate of the point = -2 + 3 = 1

Translated 4 units down, the y-coordinate of the point = -1 - 4 = -5

The coordinate of S' is (1, -5)

Thus, the coordinate of S' is (1, -5) if the triangle in the diagram is translated 3 units right and 4 units down.

Learn more about the geometric transformation here:

brainly.com/question/16156895

#SPJ2

HELP ME WITH THIS FAST

Answers

Answer:

About 374 people.

Step-by-step explanation:

[tex] \frac{11}{50} \times 1700 = 374[/tex]

I WILL MARK BRAINLIEST IF U SHOW WORK !!
TESSA saves $25 in 5 weeks. how long will it take her to save $55 ?

Answers

Answer:

11 weeks

Step-by-step explanation:

25 divided by 5 = 5

So she saves 5 dollars a week meaning 5 x 11 = 55

Answer:

10 weeks and 5 days

Step-by-step explanation:

5 weeks is 25 ->

10 weeks is 50->

she gets 1.4 a day ->

1.4 times 3 days is4.2 so you would use 5 days ->

so it would be 10 weeks and 5 days

B -17 =-2 is what I cant

Answers

Answer:

Please make your question more clear

Step-by-step explanation:

We can not read your question.

please explain your question better

Answer:

15

Step-by-step explanation:

Given ABC = DEF and the perimeter of DEF =38, find BC

Answers

Answer: BC = 15

Step-by-step explanation:

Since the triangles are congruent, that means they are the same. So side AB = side EF. Since we know side FD is 15, that means side BC= 15

Final answer:

To find BC when given triangles ABC and DEF are congruent and the perimeter of DEF is 38, subtract the summed lengths of DE and EF from 38 to get the length of DF, which will be equal to BC.

Explanation:

If you are given that triangle ABC is congruent to triangle DEF and the perimeter of DEF is 38 units, to find the length of side BC, we need to first establish that corresponding sides of congruent triangles are equal in length. This means that each side of triangle ABC corresponds and is equal to a side of triangle DEF. Therefore, if you are given the lengths of sides DE and EF, you subtract their sum from the total perimeter of triangle DEF to find the length of side DF. Since triangle ABC is congruent to triangle DEF, BC is equal to DF. Thus, the length of side BC in triangle ABC can be calculated.

For example, if DE is 10 units and EF is 12 units, then:

Sum the lengths of DE and EF: 10 + 12 = 22 units.Subtract this sum from the perimeter of DEF to find DF: 38 - 22 = 16 units.Since BC corresponds to DF, the length of BC is also 16 units.

London inherited $823,000. If she wants to donate a tenth of her inheritance to charities, how much should she donate?
$

Answers

Answer:

She donated 82,300

Step-by-step explanation:

She donated a tenth of 823,000. A tenth is 10% or .10. A tenth of 832,000 is just 832,000 * .10. Or if it's a tenth, you can take off a zero

Answer:

$82,300

Step-by-step explanation:

823,000 times 0.10

= 82,300

Which functions have a horizontal asymptote? Y = f(x) y = h(x) y = g(x) y = k(x) On a coordinate plane, 4 exponential functions are shown. Y = f (x) approaches the x-axis in quadrant 1 and increases exponentially in quadrant 2. It goes through (0, 1) and (negative 4, 5). Y = g (x) approaches the x-axis in quadrant 1 and increases exponentially in quadrant 2. It goes through (0, 1) and (negative 1, 3). Y = h (x) approaches the x-axis in quadrant 2 and increases exponentially in quadrant 1. It goes through (0, 1) and (1, 3). Y = k (x) approaches the x-axis in quadrant 2 and increases exponentially in quadrant 1. It goes through (0, 1) and (4, 5).

Answers

Answer:

Is all of them !!

Step-by-step explanation:

Because they all have asymptote

Answer:

all of them

Step-by-step explanation:

all have asymptote

Aisha wants to make a dog bed for her new puppy. She buys 2.5 yards of fabric. If the fabric costs $4.90 per yard, how much does Aisha pay?

Answers

Answer:

$12.25

Step-by-step explanation:

2.5 yards of fabric * $4.90 per yard of fabric = $12.25. Hope this helps!

Final answer:

Aisha pays $12.25 for the 2.5 yards of fabric she buys.

Explanation:

The total amount of fabric Aisha buys is 2.5 yards.

To find the total cost, multiply the number of yards by the cost per yard. For Aisha, this would be 2.5 yards x $4.90/yard = $12.25.

A certain medication comes in the form of a capsule, as shown below. The fluid inside the capsule contains several ingredients, including the active medication.


What is the volume of the capsule? Round to the nearest tenth.


V =

mm3


If the density of the active medication in the liquid is

0.7 mg/mm3, how many milligrams of the active medication are in one capsule? Round to the nearest tenth.

mg

Answers

Answer:

volume: 103.9 mm³medication: 72.7 mg

Step-by-step explanation:

You want the volume of a medicine capsule and the mass of active ingredient if the capsule is a cylinder 4 mm in diameter and 5.6 mm long, capped on either end by a hemisphere, and the active ingredient has a density of 0.7 mg/mm³.

(a) Volume

The volume of a cylinder is given by ...

  V = πr²h

and the volume of a sphere is given by ...

  V = 4/3πr³

The two hemispheres have a total volume equal to that of a sphere, and the radii of the cylinder and sphere are the same. This means the volume of the capsule can be found as ...

  V = πr²h +4/3πr³

  V = πr²(h +4/3r)

The radius is half the diameter, so we have ...

  V = π(2 mm)²(5.6 mm +4/3(2 mm)) ≈ 103.882 mm³

The volume of the capsule is about 103.9 mm³.

(b) Milligrams

Multiplying the volume by the density gives the mass of active ingredient:

  m = ρV

  m = (0.7 mg/mm³)·(103.882 mm³) ≈ 72.72 mg

There are about 72.7 mg of active medication in one capsule.

Usually LeRoy practices the bass for 2 4/5 hours a day. Today he practiced half his
usual time. For how long did he practice?

Answers

Answer:

[tex]1 \frac{2}{5} hours[/tex]

Step-by-step explanation:

Final answer:

LeRoy practiced for 1 2/5 hours today.

Explanation:

To find how long LeRoy practiced today, we need to determine half of his usual practice time of 2 4/5 hours. To do this, we divide 2 4/5 by 2. If we simplify the fraction, we get 14/5. Dividing 14/5 by 2, we get 7/5 or 1 2/5 hours. Therefore, LeRoy practiced for 1 2/5 hours today.

Learn more about Practice time duration here:

https://brainly.com/question/32171354

#SPJ2

$83 giraffe; 17% markup

Answers

Answer:

$97.11

Step-by-step explanation:

17% of $83 = $14.11

$83 + $14.11 = $97.11

How do you know that 361 + 283 is greater than 500 without finding
the sum?​

Answers

You would estimate first look at the 100's place 3+2=5 so we already have 500 so we know that the sumis greater than 500 because is you at 61+83 with 500 its a larger number than just 500

Final answer:

To see if 361 + 283 is greater than 500, round each number to the nearest hundred and add them. The rounded sum of 400 + 300 = 700 is clearly greater than 500, thus the actual sum must also be greater than 500.

Explanation:

To determine if the sum of 361 + 283 is greater than 500 without actually adding the numbers together, you can use estimation. You can round each number to its nearest hundred to make the math easier. 361 can be rounded to 400 and 283 can be rounded to 300. When you add these rounded numbers together, 400 + 300 = 700, which is clearly greater than 500. Since rounding each number up only increases the sum, the actual sum of 361 + 283 must also be greater than 500.

This concept is based on the understanding that the rules of mathematics are universally valid, as addition is commutative (A+B=B+A).

What is the length of a diagonal of a rectangular picture whose sides are 15 inches by 17 inches? Round to the nearest tenth of a inch.

Answers

Answer:

First, 32 rounded to the nearest ten is:

30

Step-by-step explanation:

When rounding to the nearest ten, like we did with 32 above, we use the following rules:

A) We round the number up to the nearest ten if the last digit in the number is 5, 6, 7, 8, or 9.

B) We round the number down to the nearest ten if the last digit in the number is 1, 2, 3, or 4.

C) If the last digit is 0, then we do not have to do any rounding, because it is already to the ten.

Which equation is written in slope-intercept form?
y = 3 x minus 2
x = one-half y + 8
2 x + 5 y = 12
3 y = 8 x minus 5

Answers

Answer:

A) y = 3x - 2

Step-by-step explanation:

slope-intercept form is represented by y=mx+b

your answer choices look like this

A) y = 3x -2

B) x = 1/2y + 8

C) 2x + 5y = 12

D) 3y = 8x - 5

right away, you can eliminate B & C, since they just don't represent the formula correctly.

D is your trick answer choice. at first glance, it looks right, however, the 'y' is not isolated, which is a key interpretation of the formula.

therefore, from process of elimination, A is right because is correctly represents the formula of slope-intercept form.

i hope this helps!

stay safe!

:)

The equation written in slope-intercept form is y = 3x - 2. The correct option is A.

What is an equation?

The equation in mathematics is the relationship between the variables and the number and establishes the relationship between the two or more variables.

Slope or the gradient is the number or the ratio which determines the direction or the steepness of the line.

The equation of a line is given as:_

y = mx + c

The slope-intercept form is represented by y=mx+b. Right away, you can eliminate B & C, since they just don't represent the formula correctly.

D is your trick answer choice. at first glance, it looks right, however, the 'y' is not isolated, which is a key interpretation of the formula.

Therefore, from the process of elimination, A is right because is correctly represents the formula of slope-intercept form.

To know more about equations follow

https://brainly.com/question/2972832

#SPJ5

If 2+2=44 and 3+3= 96 and 4+4=168 and 5+5=2510 then what is 6+6=?

Answers

Answer:

3612

Step-by-step explanation:

boom

The table shows the last holiday destination of 60 people

Answers

Do you need help and what with?

The angles are 150°, 108°, 90°, and 12°.

What are corresponding angles?

In a literal sense, corresponding means pairwise angles. Like the right corner angles of two triangles etc. But usually, we take them as:

For two similar figures, the pair by pair similar angles of those two similar figures are called corresponding angles. They are of the same measurement.

Suppose for example, that 10 people choose city A as a destination.

To calculate its corresponding angle, we have to use the following proportion, 60 people represent the whole circle, is 360°, then 10 people are represented by:

France:

25/60 × 360 = 150°

Spain:

18/60 × 360 = 108°

Greece:

15/60 × 360 = 90°

Other:

2/60 × 360 = 12°

Learn more about angles here:

https://brainly.com/question/2882938

#SPJ2

derek wants to determine the height of the top of the backboard on the basketball goal at the playground. he places a standard 12 inch ruler next to the goal post and measures the shadow of the ruler and the background. if the ruler had a shadow of 10 inches and the backboard has a shadow of 7.25 feet, then how high is the top of the backboard

Answers

Answer:

7.91

Step-by-step explanaton:

  Derek wants to determine the height of the top of the backboard on the basketball goal at the playground. He places a standard 12-inch ruler next to the goal post and measures the shadow of the ruler and the backboard. If the ruler has a shadow of 11 inches and the backboard has a shadow of 7.25 feet, then about how high is the top of the backboard?

A.  

6.14 feet

 B.  

8.92 feet

 C.  

7.91 feet

D.  

9.17 feet

i was looking for the answer and jess couldn't find it and so i answered it and it told me the answer was 7.91.

it also told me that the reason for this was:

Since the backboard and the ruler are both vertical and the sun is at the same position in the sky, the triangle made by the backboard and its shadow is similar to the triangle made by the ruler and its shadow.

The ratio of the corresponding sides of the triangles are equal and the height of the backboard can be determined by solving the following proportion.

Therefore, the top of the backboard is 7.91 feet high.

what is 1+1 times 1,000,000,000,000,000,000,000,000

Answers

Answer: 2e +24 which equals 130.477527766

:)

Answer:

1e+24

Step-by-step explanation:

Which circle has a radius that measures 10 units?


A) Circle D is shown. A line segment goes from one point to another point on the circle and has a length of 10.

B) Circle F is shown. A line segment goes from one point to another point on the circle and goes through point F. It has a length of 20.

C) Circle G is shown. A line segment goes from one point to another point on the circle and goes through point G. It has a length of 10.

D) Circle H is shown. A line segment goes from one point to another point on the circle and has a length of 20.

Answers

Answer:

  B) Circle F is shown. A line segment goes from one point to another point on the circle and goes through point F. It has a length of 20.

Step-by-step explanation:

A segment that goes through the center of the circle and that has its ends on the circle is a diameter. The radius is half the length of the diameter.

A chord through the center of circle F with a length of 20 units means circle F has a radius of 10 units.

Final answer:

Option B is the correct answer because it describes a line segment that passes through the center and is 20 units long, indicating it's a diameter; hence the radius is half of that, which is 10 units.

Explanation:

To determine which circle has a radius of 10 units, we need to recall that the radius is a straight line from the center of the circle to a point on its boundary. Two radii lined up end-to-end across a circle form a diameter. Therefore, a diameter is twice the length of the radius.

Option A describes a line segment of length 10, but we cannot confirm if it's a radius or a diameter without additional information.

Option B describes a line segment that goes through the center point F and is 20 units long, indicating it's a diameter. Since the diameter is twice the radius, a circle with a diameter of 20 units has a radius of 10 units.

Option C, like option A, cannot be confirmed without additional information about the line segment's relation to the center of the circle.

Option D also describes a line segment of 20 units, but again, without confirmation that it's a diameter, we cannot be sure.

Therefore, the correct answer is Option B, where the circle's diameter is explicitly mentioned to be 20 units, meaning the radius is 10 units.

A random sample of monarch butterflies and a random sample of swallowtail butterflies were selected, and the difference in the average flying speed for each sample was calculated. A two-sample t-test for the difference in means was conducted to investigate whether the speed at which monarchs fly, on average, is faster than the speed at which swallowtails fly. All conditions for inference were met, and the p-value was given as 0.072.

Which of the following is a correct interpretation of the p-value?a. The probability that monarchs fly faster than swallowtails is 0.072.b. The probability that monarchs and swallowtails fly at the same speed is 0.072.c. Assuming that monarchs and swallowtails fly at the same speed on average, the probability of observing a difference equal to or greater than the sample difference is 0.072.d. Assuming that monarchs fly faster than swallowtails on average, the probability of observing a difference equal to or greater than the sample difference is 0.072.e. Assuming that monarchs fly faster than swallowtails on average, the probability of the monarchs and swallowtails flying at the same speed is 0.072.

Answers

Answer:

Option C is the correct answer

Step-by-step explanation:

Let μ1 be the average flying speed of monarch butterflies and let μ2 be the average flying speed of swallowtail butterflies.

Also, let n1 be the sample size of monarch butterflies and let n2 be the sample size of swallowtail butterflies.

Thus, defining the hypothesis, we have;

Null hypothesis;H0: μ1 = μ2

Alternative hypothesis; H1: μ1 > μ2

In this case, the p-value = P_H0[t_(n1 + n2 - 2) ≥ t] where t is the test statistic based on tbe differences of sample mean,that follows t distribution with degrees of freedom (n1 + n2 - 2)

With respect to the question, the probability of the monarchs and swallowtails flying at the same speed is 0.072.

Thus,

P_H0[t_(n1 + n2 - 2) ≥ t] = 0.072

We can therefore conclude that in this case, the p-value is the probability of observing a difference equal to or greater than the sample difference under the null hypothesis which states that μ1 = μ2, which is 0.072

Thus, option C is the correct answer

Answer:

The correct option is;

b. The probability that monarchs and swallowtails fly at the same speed is 0.072

Step-by-step explanation:

The p- value indicates the probability of which the hypothesis tested, the null hypothesis is true and it is compared against a given confidence level. Whereby the p-value is more than the given confidence level then it indicates that the null hypothesis assumption is correct.

Therefore, whereby the null hypothesis tests proposes the equality of the two means, then at  a 5% confidence level or α = 0.05, whereby p-value = 0.072 > α = 0.05 we accept the null hypothesis and state that the probability that monarchs and swallowtails fly at the same speed is 0.072.

Please help due today

Answers

Answer:

523.3

Step-by-step explanation:

[tex]Volume = \frac{4}{3} * 3.14 * 5^{3} \\Volume = 523.3[/tex]

Please give me brainliest

Is 29.99 the same as 30

Answers

Answer:

No

Step-by-step explanation:

Suppose that $2000 is loaned at a rate of 18%, compounded semiannually. Assuming that no payments are made, find the amount owed after 9 years.
Do not round any intermediate computations, and round your answer to the nearest cent.

Answers

The answer to this problem is A=P(1+r/n)^(nt)

The amount owed after 9 years on a $2000 loan compounded semiannually at an 18% interest rate is approximately $8599.63.

When we need to find the amount owed after 9 years on a $2000 loan compounded semiannually at an 18% interest rate, we use the formula for compound interest:

A = P (1 + r/n)^(nt)

Where:

A is the amount of money accumulated after n years, including interest.

P is the principal amount ($2000).

r is the annual interest rate (18% or 0.18).

n is the number of times the interest is compounded per year (2 for semiannual).

t is the time the money is invested for, in years (9 years).

Substituting the values into the formula, we have:

A = 2000 (1 + 0.18/2)^(2*9)

A = 2000 (1 + 0.09)^(18)

A = 2000 (1.09)^18

Calculating this expression gives us the amount owed after 9 years. Do not round any intermediate computations, and round your answer to the nearest cent.

The calculation is as follows:

A = $2000 * (1.09)^18

A ≈ $2000 * 4.299816955

A ≈ $8599.63

Therefore, the amount owed after 9 years would be approximately $8599.63.

Find the midpoint of the line segment joining the points A=(-6,-4) and B=(-2,6)

Answers

Answer:

The midpoint is (-4,1)

Step-by-step explanation:

To find the x coordinate of the midpoint, add the x coordinates and divide by 2

(-6+-2)/2 = -8/2 = -4

To find the y coordinate of the midpoint, add the y coordinates and divide by 2

(-4+6)/2 = 2/2 =1

The midpoint is (-4,1)

Answer:

The midpoint of the segment is at (-4,1)

Step-by-step explanation:

Since the midpoint of an line segment is the middle of the two x and y coordinates:

x-coords:

-6+-2 = -8

-8/2 = -4

y-coords

-4+6 = 2

2/2 = 1

The midpoint of the segment is at (-4,1)

Sussex County received 43 inches of
rainfall this year. The percent error in the
local meteorologist's rainfall prediction
was about 18.02%. What are two
possible values for the meteorologist's
prediction?​

Answers

Answer: 774.86 or 775

Step-by-step explanation:

Answer:

755

Step-by-step explanation:

Other Questions
PLS PLS HELP 30 PTS AND BRAINLIEST IF CORRECTBanksy Art Self-Destructs After Selling for $1.4MBy Rowena SalazarAnonymous artist Banksy stunned the art world on October 6, 2018 with a prank that caused one of his paintings to self-destruct. Moments after "Girl With Balloon" sold for $1.4M via phone auction at Sotheby's auction house, an alarm sounded. Then, a remote-controlled mechanism slid the canvas down its frame where a shredder was hidden. Several videos and photos show the painting hanging halfway shredded outside of its frame."Girl With Balloon" was a spray paint on canvas work completed in 2006 and shows a small child reaching up toward a heart-shaped red balloon. The original work was stenciled on a wall in east London and is one of Bansky's most recognizable images.Banksy, an England-based graffiti artist, is also considered a political activist and vandal. He has remained anonymous since gaining fame for his stenciled graffiti art, usually spray-painting his murals in the middle of the night. Banksy often incorporates dark humor, political messaging, and social commentary into his art. He openly criticizes commercialism, once even selling works of his art at a New York Central Park pop-up shop for $60 a piece, far below their value. In 2007, he graffitied "ONE NATION UNDER CCTV" on the side of a British postal service building."Graffiti art has a hard enough life as it is, before you add hedge-fund managers wanting to chop it out and hang it over the fireplace," the New York Times quoted Banksy in 2013. "For the sake of keeping all street art where it belongs, I'd encourage people not to buy anything by anybody, unless it was created for sale in the first place." (Ryzick, M. "Another Banksy Mural to Go from Wall to Auction." The New York Times, 12 August 2013).Soon after shredding his own painting, which sold for a record-high price, Banksy posted a photo on his Instagram account of the half-shredded painting with a caption reading "Going, going, gone " He also posted a video describing how "a few years ago I secretly built a shredder into a painting in case it was ever put up for auction " He captioned the video with a quote from Pablo Picasso"The urge to destroy is also a creative urge."From the Financial District Times"'Girl With Balloon' already broke an important auctions record for Bansky, selling for $1.4M. After its recent shredding, we certainly expect this important work to raise the bar even further. While casual art observers consider the work to be destroyed, collectors are drawn to its one-of-a-kind circumstance. We wouldn't be surprised if it's already doubled in value."In a paragraph of at least five sentences, address Banksy's advice "not to buy anything by anybody, unless it was created for sale in the first place." Include at least one specific reference to each excerpt in your response. QUESTION 2 Objectives: I . identify potential and kinetic energy in a situation and draw corresponding energy bar charts, II . calculate gravitational and elastic potential energy, III . draw & analyze potential energy functions, and (d) use conservation of energy to relate the total energy at one time to total energy at another time. ------------------------------------------- Bungee Jump: you will step off with zero initial vertical velocity from a platform a height h above the ground. The bungee cord will act like a giant extensional spring that will, you hope, provide an upward force on becoming taut. After weighing you (you have a mass M), the operator has selected a bungee cordwith an un-stretched length of d and a spring constant of k. Consider yourself to be a single point i.e., use the particle model. Choosing the ground as your origin (and the z-axis directed upwards), answer the following questions about your bungee jumping adventure in terms of M, h, d, k, z, and the gravitational field strength, g. Answer with variables. ------------------------------------------- a) Write an expression for the stretching ?L of the cord in terms of d and z and for the total potential energy U of the jumper-bungee-Earth system for each situation (consider the latter two situations together). b) Which type of potential energy ( UG or US ) is largest for large z (early in the fall)? For small z (late in the fall)? c) Sketch a graph of your gravitational potential energy, UG(z) vs your height, z, from z = 0 to z = h, on the left plot. Then sketch a graph of your elastic potential energy, US(z) on the center plot. Finally on the rightmost plot, sketch a graph of your total potential energy1 U(z) = UG(z) + US(z). Do these plots on your own without the help of a computer or calculator. 1.) 2x9y=14 2.) x=6y+7 please help!! 40% of OatyPop cereal boxes contain a prize. Hannahplans to keep buying cereal until she gets a prize. What isthe probability that Hannah only has to buy 3 or lessboxes before getting a prize?We need to design a simulation. Which random device can we use to BESTrepresent this situation?Use a double-sided coin andassign heads as the prize andtails as no prize.Use a number cube with thenumbers 1 through 6 and assign1 through 2 as the prize and 3through 6 as no prize.Use a random number generatorranging from 1 to 10 and assign1 through 4 as the prize and 5through 10 as no prize.Use a deck of cards and assignspades as the prize and allother suits as no prize. There are three groups that contain carbon but are not organic compounds:carbon chlorides carbon oxides carbon iodides carbides carbonates When should you use the median and interquartile range as your measure of center and measure of variability tocompare populations shown on a box plot? Check all that applywhen there are outliers in the data setswhen there are no big gaps in the middle of the data setswhen the plots representing the data are symmetricalwhen the plots representing the data are nonsymmetricalwhen there are no outliers in the data setIntroDone To assist with a class demonstration, a student (whose mass is 60 kg) filled a water balloon with 2 kg of water. He then climbed to the second floor (10 metres) of the school and held the balloon out of a window. How much work did the student do? What is it called when plants give off water vapor as a waste product? Jason is entering a weight lifting contest. Gurrently, his maximum bench press weight is 105 pounds. If he increases the weight by 7 pounds each week, What is the maximum weight he be able to bench press after 13 weeks? Which statement best summarizes the central idea of thisexcerpt?DOUO One must know the process of hiring servants.0 It is important to always honor one's servants.O It is necessary to choose trustworthy servants.O The intelligence of servants must be considered.herofich 1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes. if tan 0= -3/8 which expression is equivalent to cot0? A fairground ride spins its occupants inside a flying saucer-shaped container. If the horizontal circular path the riders follow has a 6.75 m radius, at how many revolutions per minute are the riders subjected to a centripetal acceleration equal to that of gravity