The angle measures in a triangle are 25°, 135°, and 20°. What type of triangle is it?
acute triangle
right triangle
obtuse triangle
isosceles triangle this is very confusing to me lol

Answers

Answer 1
Obtuse scalene triangle
Answer 2

The type of triangle is,

⇒ A scalene triangle

What is mean by Triangle?

A triangle is a three sided polygon, which has three vertices and three angles which has the sum 180 degrees.

Given that;

The angle measures in a triangle are 25°, 135°, and 20°.

Now, We have alL angles are different to each other.

Hence, By definition of a scalene triangle,

The type of triangle is,

⇒ A scalene triangle

Learn more about the triangle visit;

brainly.com/question/1058720

#SPJ3


Related Questions

A cupcake shop produces 5 types of cupcakes, one of which is chocolate. Assume there is a large amount available of each type of cupcake.

1/ How many different selections of 8 cupcakes are there?

2/ How many different selections of 8 cupcakes have at least 3 chocolate cupcakes?

3/ How many different selections of 8 cupcakes have at most 2 chocolate cupcakes?

Answers

Answer: 1) 390625, 2) 1365, 3) 411105.

Step-by-step explanation:

Since we have given that

Number of types of cupcakes = 5

Number of chocolate type = 1

1/ How many different selections of 8 cupcakes are there?

Number of cupcakes we need to select = 8

Since we have 5 options for each 8 cupcakes.

So, the number of ways to select 8 cupcakes would be :

[tex]5^8=390625[/tex]

2/ How many different selections of 8 cupcakes have at least 3 chocolate cupcakes?

Number of different selection would be :

=[tex]4^5+4^4+4^3+4^2+4+1=1365[/tex]

3/ How many different selections of 8 cupcakes have at most 2 chocolate cupcakes?

Number of ways to select no chocolate + Number of ways to select 1 chocolate + Number of ways to select 2 chocolate

[tex]5^8+4^7+4^6=411105[/tex]

Hence, 1) 390625, 2) 1365, 3) 411105.

What is the approximate value of the expression below?
-3,033 ÷ (-56)

Answers

Answer:

54.1607142857

Step-by-step explanation:

just simplify it

The approximate value of -3,033 divided by -56 is -54 when rounded to two significant figures.

To approximate the value of -3,033 ÷ (-56), you can perform the division by changing both numbers into their absolute values and divide normally as the negative signs will cancel each other out. This results in the division of 3,033 by 56. Using a calculator, you would get 54.1607142857. However, since we need an approximate value with two significant figures, the result would be rounded to -54.

Find all of the eigenvalues λ of the matrix A. (Hint: Use the method of Example 4.5 of finding the solutions to the equation 0 = det(A − λI). Enter your answers as a comma-separated list.) A = 3 5 8 0

Answers

Answer:

[tex]\lambda=8,\ \lambda=-5[/tex]

Step-by-step explanation:

Eigenvalues of a Matrix

Given a matrix A, the eigenvalues of A, called [tex]\lambda[/tex] are scalars who comply with the relation:

[tex]det(A-\lambda I)=0[/tex]

Where I is the identity matrix

[tex]I=\left[\begin{array}{cc}1&0\\0&1\end{array}\right][/tex]

The matrix is given as

[tex]A=\left[\begin{array}{cc}3&5\\8&0\end{array}\right][/tex]

Set up the equation to solve

[tex]det\left(\left[\begin{array}{cc}3&5\\8&0\end{array}\right]-\left[\begin{array}{cc}\lambda&0\\0&\lambda \end{array}\right]\right)=0[/tex]

Expanding the determinant

[tex]det\left(\left[\begin{array}{cc}3-\lambda&5\\8&-\lambda\end{array}\right]\right)=0[/tex]

[tex](3-\lambda)(-\lambda)-40=0[/tex]

Operating Rearranging

[tex]\lambda^2-3\lambda-40=0[/tex]

Factoring

[tex](\lambda-8)(\lambda+5)=0[/tex]

Solving, we have the eigenvalues

[tex]\boxed{\lambda=8,\ \lambda=-5}[/tex]

Create 3 fraction whose product is -5/24

Answers

Step-by-step explanation:

1.)

[tex] - \frac{5}{3} \times \frac{1}{8} = - \frac{5}{24} \\ \\ [/tex]

2.)

[tex] - \frac{5}{2} \times \frac{1}{12} = - \frac{5}{24} \\ [/tex]

3.)

[tex] - \frac{1}{6} \times \frac{5}{4} = - \frac{5}{24} \\ [/tex]

Use determinants to find out if the matrix is invertible.[Start 3 By 3 Matrix 1st Row 1st Column 20 2nd Column 5 3rd Column 3 2nd Row 1st Column 4 2nd Column negative 15 3rd Column 6 3rd Row 1st Column 0 2nd Column 25 3rd Column negative 9 EndMatrix ]The determinant of the matrix is180180. ​(Simplify your​ answer.)Is the matrix​ invertible? Choose the correct answer below.A.The matrix is not invertible because the determinant is defined.B.The matrix is invertible because the determinant is defined.C.The matrix is not invertible because the determinant is not zero.

Answers

Answer:

B.The matrix is invertible because the determinant is defined.

Step-by-step explanation:

Definition: A matrix is invertible if the determinant is not equal to zero.

Given the matrix:

[tex]A=\left(\begin{array}{ccc}20&5&3\\4&-15&6\\0&25&-9\end{array}\right)[/tex]

The determinant of the matrix:

[tex]|A|=20\left|\begin{array}{ccc}-15&6\\25&-9\end{array}\right|-5\left|\begin{array}{ccc}4&6\\0&-9\end{array}\right|+3\left|\begin{array}{ccc}4&-15\\0&25\end{array}\right|[/tex]

[tex]|A|=20(-15*-9-25*6)-5(-9*4-6*0)+3(4*25-0*-15)\\=20(135-150)-5(-36-0)+3(100+0)\\=20(-15)-5(-36)+3(100)\\=-300+180+300\\|A|=180[/tex]

Since the determinant, [tex]|A|\neq 0[/tex], the matrix is invertible because the determinant is defined.

Final answer:

The matrix in question is invertible because its determinant is not zero. This is an essential rule in linear algebra, where a non-zero determinant implies an invertible matrix.

Explanation:

In linear algebra, a square matrix is invertible if and only if its determinant is not zero. The determinant being different from zero implies that the matrix has full rank and hence is invertible. In your case, the determinant of the matrix is 180180, which is not zero. Thus, the matrix is invertible.

The option: B. The matrix is invertible because the determinant is defined is not entirely correct because a matrix could have a defined determinant that equals zero which would make it non-invertible. The correct answer should be: C. The matrix is invertible because the determinant is not zero.

Learn more about Matrix Invertibility here:

https://brainly.com/question/33947957

#SPJ6

1. Whitney Gourmet Cat Food has determined the weight of their cat food can is normally distributed with a mean of 3 ounces and a standard deviation of 0.05 ounces. To meet legal and customer satisfaction goals each can must weigh between 2.95 and 3.1 ounces. a. If a single can is chosen, what is the probability it will weigh less between 2.95 and 3.1 ounces

Answers

Answer:

The probability it will weigh between 2.95 and 3.1 ounces is 0.8186.

Step-by-step explanation:

We are given that Whitney Gourmet Cat Food has determined the weight of their cat food can is normally distributed with a mean of 3 ounces and a standard deviation of 0.05 ounces.

Let X = weight of their cat food can

So, X ~ Normal([tex]\mu=3,\sigma^{2} =0.05^{2}[/tex])

The z score probability distribution for normal distribution is given by;

                                Z =  [tex]\frac{X-\mu}{\sigma}[/tex] ~ N(0,1)

where, [tex]\mu[/tex] = population mean = 3 ounces

            [tex]\sigma[/tex] = standard deviation = 0.05 ounces

Now, the probability it will weigh between 2.95 and 3.1 ounces is given by = P(2.95 ounces < X < 3.1 ounces)

P(2.95 ounces < X < 3.1 ounces) = P(X < 3.1 ounces) - P(X [tex]\leq[/tex] 2.95 ounces)

   P(X < 3.1 ounces) = P( [tex]\frac{X-\mu}{\sigma}[/tex] < [tex]\frac{3.1-3}{0.05}[/tex] ) = P(Z < 2) = 0.97725

    P(X [tex]\leq[/tex] 2.95 ounces) = P( [tex]\frac{X-\mu}{\sigma}[/tex] [tex]\leq[/tex] [tex]\frac{2.95-3}{0.05}[/tex] ) = P(Z [tex]\leq[/tex] -1) = 1 - P(Z < 1)

                                                              = 1 - 0.84134 = 0.15866

The above probabilities is calculated by looking at the value of x = 2 and x = 1 in the z table which has an area of 0.97725 and 0.84134 respectively.

Therefore, P(2.95 ounces < X < 3.1 ounces) = 0.97725 - 0.15866 = 0.8186

Hence, the probability it will weigh between 2.95 and 3.1 ounces is 0.8186.

the regular price of a book is 36$ the book is sold at a discount of 10% what is the price of the book after the discount?

Answers

Answer:

32.40

Step-by-step explanation:

:
In Ms. Perron’s class, 75% of the students are boys. There are 18 boys in the class. What is the total number of students in Ms. Perron’s class?

Answers

Given:

In Ms. Perron’s class, 75% of the students are boys. There are 18 boys in the class.

We need to determine the total number of students in Ms. Perron's class.

Total number of students:

Let n denote the total number of students in Ms. Perron's class.

Thus, we have;

[tex]\frac{75}{100}n=18[/tex]

Multiplying both sides of the equation by [tex]\frac{100}{75}[/tex], we get;

[tex]n=18\times \frac{100}{75}[/tex]

Simplifying, we get;

[tex]n=\frac{1800}{75}[/tex]

[tex]n=24[/tex]

Therefore, the total number of students in Ms. Perron's class are 24.

absolute magnitude of a star that has a period of 50 days

Answers

Answer: 6.07 I believe

Step-by-step explanation:

Answer:

-6.07

Step-by-step explanation:

What is the absolute magnitude of a star that has a period of 50 days?

From the list of numbers below, write one number in each box. You may use each number exactly once. 3, 4, 7, 8, 9, 14.

Three Numbers with a mean=8 and MAD=4

Answers

Answer: 3, 7 and 14

Step-by-step explanation:

We want 3 numbers with a mean of 8, and a MAD of 4.

if we have the numbers a, b and c.

The mean is:

M = (a + b + c)/3

MAD = ( Ia - MI + Ib - MI + Ic - MI)/3

now, we know that M = 8 and MAD = 4, so we can replace those values:

8 = (a + b + c)*/3

3*8 = 24 = a + b + c

and

4 = ( Ia - 8I + Ib - 8I + Ic - 8I)/3

4*3 = 12 = Ia - 8I + Ib - 8I + Ic - 8I

So now we have the two equations:

24 = a + b + c

12 = Ia - 8I + Ib - 8I + Ic - 8I

Let's took the numbers 3, 7 and 14

I selected those because are the numbers where the distance between them is the biggest, and they add up to 24, and you can see that the MAD is a big number, which implies that our 3 numbers are not close between them.

3 + 7 + 14 = 10 + 14 = 24

and for the MAD

I3 -8I + I7 - 8I + I14 - 8I = 5 + 1 + 6 = 12

So the correct options are 3, 7 and 14

4.37 is what% of 460

Answers

Its goin to be 0.95

Answer:

0.95%

Step-by-step explanation:

Simply divide 100 with 460 then multiply 4.37

100/460 = 0.2173913043

Multiply by 4.37 and you get 0.95

Which of the following is a required deduction? O A. Medicare B. Health insurance C. Disability insurance D. Medicaid

Answers

Answer:

Medicare!

Step-by-step explanation:

What is the value of (Negative 14 Superscript 0 Baseline) Superscript negative 2?

Answers

Answer:

1

Step-by-step explanation:

We are given that an expression

[tex]{(-14)^0)^{-2}[/tex]

We have to find the value of given expression.

We know that

[tex]a^0=1[/tex]

Using the property

[tex](-14)^0=1[/tex]

We know that

[tex]a^{-b}=\frac{1}{a^b}[/tex]

Using the property

[tex](1)^{-2}=\frac{1}{1^2}[/tex]

[tex](1)^{-2}=1[/tex]

[tex]((-14)^0)^{-2}=1[/tex]

A freight train rumbles by as bob watches. Each freight container on the train is shaped like a rectangular prism 17 meters long,3 meters wide, and 3 meters tall. What is the volume of a freight container on that train

Answers

Answer:

The answer is 153

Step-by-step explanation:

You multiply 17 by 3 by 3.

Final answer:

The volume of a rectangular prism-shaped freight container is calculated by multiplying its length, width, and height. For a container that is 17 meters long, 3 meters wide, and 3 meters high, the volume is 153 cubic meters.

Explanation:

The question is asking for the volume of the rectangular prism-shaped freight container.  In mathematics, the volume of a rectangular prism is found by multiplying its length, width, and height. For the freight container with dimensions of 17 meters long, 3 meters wide, and 3 meters high, we can find the volume by multiplying all these values together.

So, the volume V = length x width x height = 17m x 3m x 3m = 153 cubic meters. Therefore, each freight container on the train has a volume of 153 cubic meters.

Learn more about Volume Calculation here:

https://brainly.com/question/33318354

#SPJ12

Dana has 12 action figures that she wants to give to 3 friends she wants 3 each friend to have the same number if action figures

Answers

Answer:

4 action figures per friend

Step-by-step explanation:

To split the 12 action figures between 3 friends, divide 12 by 3.

12/3 = 4

Therefore, each friend gets 4 action figures.

Answer:

each friend gets 12 divided by 3 action figures. Each friend gets 12/3 action figures. Each friend gets 4 of the 12 action figures.

Step-by-step explanation:

i put this and i got it right.

The U.S. Bureau of Labor Statistics reports that 11.3% of U.S. workers belong to unions (BLS website, January 2014). Suppose a sample of 400 U.S. workers is collected in 2014 to determine whether union efforts to organize have increased union membership.


Formulate the hypothesis that can be used to determine whether union membership increased in 2014.

Answers

Answer:

Null Hypothesis, [tex]H_0[/tex] : p [tex]\leq[/tex] 11.3%  

Alternate Hypothesis, [tex]H_A[/tex] : p > 11.3%

Step-by-step explanation:

We are given that U.S. Bureau of Labor Statistics reports that 11.3% of U.S. workers belong to unions.

Suppose a sample of 400 U.S. workers is collected in 2014 to determine whether union efforts to organize have increased union membership.

Let p = % of U.S. workers belonging to union membership

So, Null Hypothesis, [tex]H_0[/tex] : p [tex]\leq[/tex] 11.3%  

Alternate Hypothesis, [tex]H_A[/tex] : p > 11.3%

Here, null hypothesis states that the union membership has decreased or remained same in 2014.

On the other hand, alternate hypothesis states that the union membership has increased in 2014.

Also, The test statistics that will be used here is One-sample z proportion statistics;

                               T.S.  = [tex]\frac{\hat p-p}{\sqrt{\frac{\hat p(1-\hat p)}{n} } }[/tex]  ~ N(0,1)

Hence, the above hypothesis is appropriate that can be used to determine whether union membership increased in 2014.

Kevin installed a certain brand of automatic garage door opener that utilizes a transmitter control with four independent​ switches, each one set on or off. The receiver​ (wired to the​ door) must be set with the same pattern as the transmitter. If six neighbors with the same type of opener set their switches​ independently, what is the probability of at least one pair of neighbors using the same​ settings?

Answers

Kevin installed a certain brand of automatic garage door opener that utilizes a transmitter control with four independent​ switches, each one set on or off. The receiver​ (wired to the​ door) must be set with the same pattern as the transmitter. If six neighbors with the same type of opener set their switches​ independently.The probability of at least one pair of neighbors using the same​ settings is 0.65633

Step-by-step explanation:

Step 1

In the question it is given that

Automatic garage door opener utilizes a transmitter control with four independent​ switches

So .the number of Combinations possible with the Transmitters =

2*2*2*2= 16

Step 2

Probability of at least one pair of neighbors using the same settings = 1- Probability of All Neighbors using different settings.

= 1- 16*15*14*13*12*11/(16^6)

Step 3

Probability of at least one pair of neighbors using the same settings=

= 1- 0.343666

Step 4

So the probability of at least one pair of neighbors using the same settings

is  0.65633

Amir stands on a balcony and throws a ball to his dog who is at ground level. The ball's height, in meters above the ground, after t seconds that Amir has thrown the ball is given by:


H (t) = -(t-2)^2+9

Answers

Answer:

Time t = 2 seconds

It will reach the maximum height after 2 seconds

Completed question;

Amir stands on a balcony and throws a ball to his dog who is at ground level. The ball's height, in meters above the ground, after t seconds that Amir has thrown the ball is given by:

H (t) = -(t-2)^2+9

many seconds after being thrown will the ball reach its maximum height?

Step-by-step explanation:

The equation of the height!

h(t) = -(t-2)^2 + 9 = -(t^2 -4t +4) + 9

h(t) = -t^2 +4t -4+9

h(t) = -t^2 + 4t +5

The maximum height is at dh/dt = 0

dh/dt = -2t +4 = 0

2t = 4

t = 4/2 = 2

Time t = 2 seconds

It will reach the maximum height after 2 seconds

The ball hits the ground at [tex]\( t = 5 \)[/tex] seconds.

Let's analyze the given height function of the ball:

[tex]\[ H(t) = -(t-2)^2 + 9 \][/tex]

This function describes the height of the ball [tex]\( H \)[/tex] in meters at any time [tex]\( t \)[/tex] in seconds.

The function is in the vertex form of a quadratic equation, which is generally written as:

[tex]\[ H(t) = a(t - h)^2 + k \][/tex]

Here, [tex]\( a = -1 \), \( h = 2 \), and \( k = 9 \).[/tex]

Time When the Ball Hits the Ground

- The ball hits the ground when [tex]\( H(t) = 0 \):[/tex]

[tex]\[ 0 = -(t-2)^2 + 9 \] \\\ (t-2)^2 = 9 \][/tex]

 Taking the square root of both sides:

[tex]\[ t-2 = \pm 3 \\\ t = 2 + 3 \quad \text{or} \quad t = 2 - 3 \\\ t = 5 \quad \text{or} \quad t = -1 \][/tex]

 Since negative time doesn't make sense in this context, we discard [tex]\( t = -1 \):[/tex]

[tex]\[ t = 5 \, \text{seconds} \][/tex]

 Therefore, the ball hits the ground at [tex]\( t = 5 \)[/tex] seconds.

The complete question is:

Amir stands on a balcony and throws a ball to his dog, who is at ground level. The ball's height (in meters above the ground), x seconds after Amir threw it, is modeled by: h(x)=-(x-2)^2+16 How many seconds after being thrown will the ball hit the ground?

On a cross country bicycle trip participants ride about 75 maybe les per a day. Approximately how many days d mist they ride to travel at least 4,325 miles

Answers

Final answer:

To calculate the number of days needed to travel at least 4,325 miles at a rate of about 75 miles per day, divide 4,325 by 75, which gives approximately 57.67. Therefore, participants must ride for at least 58 days to cover the distance.

Explanation:

To find out the number of days participants must ride to travel at least 4,325 miles on a bicycle, assuming they cover about 75 miles per day, we need to divide the total distance by the daily distance covered.

Total distance to travel: 4,325 miles
Average distance per day: 75 miles

Number of days (d) = Total distance / Average distance per day

d = 4,325 miles / 75 miles per day
d ≈ 57.67 days

Since participants cannot travel for a fraction of a day, they must ride for at least 58 days to cover 4,325 miles, assuming they ride about 75 miles each day.

A company is interested in estimating , the mean number of days of sick leave taken by its employees. The firm's statistician randomly selects 100 personnel files and notes the number of sick days taken by each employee. The sample mean is 12.2 days and the sample standard deviation is 10 days. Calculate a 93% confidence interval for , the mean number of days of sick leave. Assume the population standard deviation is 10.

Answers

Answer:

93% confidence interval for the mean number of days of sick leave is [10.39 days , 14.01 days].

Step-by-step explanation:

We are given that the firm's statistician randomly selects 100 personnel files and notes the number of sick days taken by each employee. The sample mean is 12.2 days and the sample standard deviation is 10 days.

Assume the population standard deviation is 10.

Firstly, the pivotal quantity for 93% confidence interval for the population mean is given by;

                          P.Q. = [tex]\frac{\bar X -\mu}{\frac{\sigma}{\sqrt{n} } }[/tex]  ~ N(0,1)

where, [tex]\bar X[/tex] = sample mean = 12.2 days

            [tex]\sigma[/tex] = population standard deviation = 10 days

            n = sample of files = 100

            [tex]\mu[/tex] = population mean

Here for constructing 93% confidence interval we have used One-sample z  test statistics because we know about population standard deviation.

So, 93% confidence interval for the population mean, [tex]\mu[/tex] is ;

P(-1.8121 < N(0,1) < 1.8121) = 0.93  {As the critical value of z at 3.5%

                                           level of significance are -1.8121 & 1.8121}  

P(-1.8121 < [tex]\frac{\bar X -\mu}{\frac{\sigma}{\sqrt{n} } }[/tex] < 1.8121) = 0.93

P( [tex]-1.8121 \times {\frac{\sigma}{\sqrt{n} } }[/tex] < [tex]{\bar X -\mu}[/tex] < [tex]1.8121 \times {\frac{\sigma}{\sqrt{n} } }[/tex] ) = 0.93

P( [tex]\bar X-1.8121 \times {\frac{\sigma}{\sqrt{n} } }[/tex] < [tex]\mu[/tex] < [tex]\bar X+1.8121 \times {\frac{\sigma}{\sqrt{n} } }[/tex] ) = 0.93

93% confidence interval for [tex]\mu[/tex] = [ [tex]\bar X-1.8121 \times {\frac{\sigma}{\sqrt{n} } }[/tex] , [tex]\bar X +1.8121 \times {\frac{\sigma}{\sqrt{n} } }[/tex] ]

                                       = [ [tex]12.2-1.8121 \times {\frac{10}{\sqrt{100} } }[/tex] , [tex]12.2+1.8121 \times {\frac{10}{\sqrt{100} } }[/tex] ]

                                       = [10.39 days , 14.01 days]

Therefore, 93% confidence interval for the mean number of days of sick leave is [10.39 days , 14.01 days].


Una escalera de 6 pies esta apoyada a
una pared. La distancia entre la pared y la base
de la escalera es 4 pies. A qué altura se
encuentra la parte superior de la escalera
del piso?​

Answers

A=bh/2 6*3+1 2 la parte superior sera 12

( Will mark brainiest ) What triangle is not possible to construct?

A. a right isosceles triangle
B. an acute equilateral triangle
C. an obtuse scalene triangle
D. a right equilateral triangle

Answers

Answer:

The answer is D

Step-by-step explanation:

An equilateral triangle can not be a right triangle. Here is why: In an equilateral triangle, all angles are congruent, since all 3 of the sides are congruent.This is because in a right triangle, one angle equals 90 degrees. Therefore, you can't have 3 angles equal 90 degrees.

A credit card company wants to test the hypothesis that its account holders spend an average of $100 per month at gasoline stations. They take a sample of 1000 accounts and find an average spend of $115 with a standard deviation of $41. Conduct this hypothesis test with a .01 level of significance. What is the test statistic?

Answers

Answer:

test statistics = 11.57

Step-by-step explanation:

test statics = [tex]\frac{average spend from the sample - average spend from theory}{Standard deviation / \sqrt{no of samples} }[/tex]

= [tex]\frac{115-100}{41/\sqrt{1000} }[/tex]  = 11.57

Kesha threw her baton up in the air from the marching band platform during practice. The equation h(t) = −16t² + 54t + 40 gives the height of the baton, in feet, t seconds after it is thrown from the platform. What is the height of the platform? At what speed was the baton thrown? If she doesn't catch it, when will it hit the ground?

Answers

Answer:

a) 40 feet

b) 54 ft/min

c) 4 mins

Step-by-step explanation:

Solution:-

- Kesha models the height ( h ) of the baton from the ground level but thrown from a platform of height hi.

- The function h ( t ) is modeled to follow a quadratic - parabolic path mathematically expressed as:

                           h ( t ) = −16t² + 54t + 40

Which gives the height of the baton from ground at time t mins.

- The initial point is of the height of the platform which is at a height of ( hi ) from the ground level.

- So the initial condition is expressed by time = 0 mins, the height of the baton h ( t ) would be:

                         h ( 0 ) = hi = -16*(0)^2 + 54*0 + 40

                         h ( 0 ) = hi = 0 + 0 + 40 = 40 feet

Answer: The height of the platform hi is 40 feet.

- The speed ( v ) during the parabolic path of the baton also varies with time t.

- The function of speed ( v ) with respect to time ( t ) can be determined by taking the derivative of displacement of baton from ground with respect to time t mins.

                        v ( t ) = dh / dt

                        v ( t )= d ( −16t² + 54t + 40 ) / dt

                        v ( t )= -2*(16)*t + 54

                        v ( t )= -32t + 54

- The velocity with which Kesha threw the baton is represented by tim t = 0 mins.

Hence,

                        v ( 0 ) = vi = -32*( 0 ) + 54

                        v ( 0 ) = vi = 54 ft / min

Answer: Kesha threw te baton with an initial speed of vo = 54 ft/min

- The baton reaches is maximum height h_max and comes down when all the kinetic energy is converted to potential energy. The baton starts to come down and cross the platform height hi = 40 feet and hits the ground.

- The height of the ball at ground is zero. Hence,

                     h ( t ) = 0

                     0 = −16t² + 54t + 40

                     0 = -8t^2 + 27t + 20

- Use the quadratic formula to solve the quadratic equation:

                     

                    [tex]t = \frac{27+/-\sqrt{27^2 - 4*8*(-20)} }{2*8}\\\\t = \frac{27+/-\sqrt{1369} }{16}\\\\t = \frac{27+/-37 }{16}\\\\t = \frac{27 + 37}{16} \\\\t = 4[/tex]

Answer: The time taken for the baton to hit the ground is t = 4 mins

Try it
Explore the properties of angles formed by
two intersecting chords.
mZ DE
1. The intersecting chords form vertical
angles. If m DEB = 105°,
then m AEC =

Answers

Answer:105°

Step-by-step explanation:

The intersecting chords form a pair of vertical angles.

Given is a circle, with chords AB and CD intersecting at E and m∠DEB = 105°, we need to find, m∠AEC

By vertical angle theorem:

Vertically opposite angles are congruent.

⇒ m∠AEC = m∠DEB

⇒ m∠AEC = 105°

The measure of angle AEC is 105°.

Therefore, the intersecting chords form a pair of vertical angles.

Learn more about vertical angles click;

https://brainly.com/question/24460838

#SPJ7

i need help bad!!!
1+5 times 56 divided by 5

Answers

Answer:

57

Step-by-step explanation:

Alright, 1+5(56)/5= 57

Is this an example of a horizontal asymptote?

Answers

Answer:

Step-by-step explanation:

Hi there,

The graph indicated is showing a horizontal asymptote. In fact, it is showing both a horizontal and a vertical asymptote.

To tell which type it is, notice where the graph "shoots off" and almost forms an imaginary straight line in one direction. Using this logic, the horizontal asymptote will be exactly horizontal, parallel to x-axis, and vertical asymptote will be exactly vertical, parallel to y-axis.

With this graph, we notice the horizontal asymptote is at y=0, where the x-axis is. The vertical asymptote is bit more difficult to determine graphically, but can definitely say it is past x=-10. We could determine it if we had the function, but that is not necessary for this question.

Study well, and persevere. If you liked this solution, leave a Thanks or give a rating!

thanks,

Final answer:

A horizontal asymptote is a horizontal line that a curve approaches but never touches as the x-values (or y-values) go to positive or negative infinity. In the case of the function y = 1/x, the graph has a horizontal asymptote at y = 0.

Explanation:

A horizontal asymptote is a horizontal line that a curve approaches but never touches as the x-values (or y-values) go to positive or negative infinity. To determine if a function has a horizontal asymptote, we need to analyze the behavior of the function as x approaches positive or negative infinity.

In the case of the function y = 1/x, as x approaches positive or negative infinity, the value of y approaches 0. Therefore, the graph of the function has a horizontal asymptote at y = 0.

Other functions may have different horizontal asymptotes, depending on their behavior as x approaches positive or negative infinity.

If the volume of a cube is 64 in3, how long is each side?

asap 14 pts
more coming soon!

Answers

Hello!

Answer:

[tex]\boxed{ \bf Each~side~is~4~in~long.}[/tex]

Explanation:

We know that the formula for volume of a cube is:

V = a³

64 = a³

To find the side length, all we have to do is find the cube root of both sides.

[tex]\sqrt{64} = \sqrt{a^3}[/tex]

  4  =  a

Throughout the US presidential election of 2012, polls gave regular updates on the sample proportion supporting each candidate and the margin of error for the estimates. This attempt to predict the outcome of an election is a common use of polls. In each case below, the proportion of voters who intend to vote for each candidate is given as well as a margin of error for the estimates. Indicate whether we can be relatively confident that candidate A would win if the election were held at the time of the poll. (Assume the candidate who gets more than of the vote wins.)

Answers

Answer:

1.) We cannot say for certain which candidate will win. But A has a statistical edge.

2.) We can say certainly that candidate A will win the election; albeit with a not so big margin.

3.) Candidate A will win this election based on the results of the final poll's before the election.

4.) We cannot say for certain which candidate will win. But A has a statistical edge.

The reasons are explained below.

Step-by-step explanation:

Confidence interval expresses a range of values in the distribution where the true proportion or mean can be found with some level of confidence.

Confidence Interval = (Sample Mean or Proportion) ± (Margin of error)

1. Candidate A: 54% & Candidate B:46% with Margin of error: + 5%

The confidence interval for candidate A

(54%) ± (5%) = (49%, 59%)

The confidence interval for candidate B

(46%) ± (5%) = (41%, 51%)

Since values greater than 50% occur in both intervals, we cannot say for certain that either of the two candidates will outrightly win the election. It just slightly favours candidate A who has A bigger range of confidence interval over 50% for the true sample proportion to exist in.

2. Candidate A: 52% & Candidate B:48% with Margin of error: + 1%

The confidence interval for candidate A

(52%) ± (1%) = (51%, 53%)

The confidence interval for candidate B

(48%) ± (1%) = (47%, 49%)

Here, it is outrightly evident that candidate A will win the elections based on the result of the final polls. The overall range of the confidence interval that contains the true sample proportion of voters that support candidate A is totally contained in a region that is above 50%. So, candidate A wins this one, easily; albeit with a close margin though.

3. Candidate A: 53% & Candidate B:47% with Margin of error: + 2%

The confidence interval for candidate A

(53%) ± (2%) = (51%, 55%)

The confidence interval for candidate B

(47%) ± (2%) = (45%, 49%)

Here too, it is outrightly evident that candidate A will win the elections based on the result of the final polls. The overall range of the confidence interval that contains the true sample proportion of voters that support candidate A is totally contained in a region that is above 50%. Hence, statistics predicts that candidate A wins this one.

4. Candidate A: 58% & Candidate B:42% with Margin of error: + 10%

The confidence interval for candidate A

(58%) ± (10%) = (48%, 68%)

The confidence interval for candidate B

(42%) ± (10%) = (32%, 52%)

Since values greater than 50% occur in both intervals, we cannot say for certain that either of the two candidates will outrightly win the election. It just slightly favours candidate A who has A bigger range of confidence interval over 50% for the true sample proportion to exist in.

Hope this Helps!!!

A Ferris wheel is 40 meters in diameter and boarded from a platform that is 2 meters above the ground. The six o'clock position on the Ferris wheel is level with the loading platform. The wheel completes 1 full revolution in 10 minutes. How many minutes of the ride are spent higher than 34 meters above the ground?

Answers

Answer:

t = 2.9517 min

Step-by-step explanation:

Given

D = 40 m ⇒ R = D/2 = 40 m/2 = 20 m

ybottom = 2 m

ytop =  ybottom + D = 40 m + 2 m = 42 m

yref = 34 m

t = 10 min

The height above the ground (y) is a sinusoidal function.

The minimum height is ybottom = 2 m

The maximum height is ytop = 42 m;

The midline is (ybottom + ytop)/2 = (2 m + 42 m)/2 = 22 m

If we model the wheel as follows

x² + y² = R²

where

y = yref - (R + ybottom) = 34 m - (20 m + 2 m) = 12 m

R = 20 m

we have

x² + (12 m)² = (20)²

⇒ x = 16 m

then

tan (θ/2) = x/y

⇒ tan (θ/2) = 16 m/12 m

⇒ θ = 106.26°

Knowing the angle of the circular sector, we apply the relation

t = (106.26°)*(10 min/360°)

⇒ t = 2.9517 min

Since the period of revolution is 10 minutes, the ride is above 34 meters for 2.9517 minutes each revolution.

Final answer:

To determine how many minutes of the ride are spent higher than 34 meters, trigonometry can be used to find the proportion of the ride above this height. This results in a total time of 3.136 minutes spent higher than 34 meters.

Explanation:

This problem involves trigonometric calculations to solve real-world scenarios. A Ferris wheel is a circle, and when you boarded at the six o'clock position you are 2 meters above the ground. The diameter of this Ferris wheel is 40 meters, so the radius is 20 meters. The highest point you can get to on the Ferris wheel is the diameter plus the height of the platform, or 42 meters. We want to know how much time is spent higher than 34 meters.

When you are 34 meters in the air, you are 16 meters above the centre of the wheel (because the center is 20 + 2 = 22 meters off the ground). The angle θ that satisfies this condition is the arcsin of 16/20, which is 56.44 degrees (or 0.986 radians). Since the Ferris wheel turns around completely, we should consider the same angle on the other side of the wheel, meaning you spend 2*56.44 = 112.88 degrees or (112.88/360) = 31.36% of the time above 34 meters. Since one full revolution takes 10 minutes, this corresponds to 31.36% * 10 = 3.136 minutes above 34 meters.

Learn more about Ferris wheel problem here:

https://brainly.com/question/32857193

#SPJ3

Other Questions
Solve for r 12-1/5r=2r+1 What are two causes of soil loss? Jana made a table to help her review the types of mutations for an exam. She started with the sequence THE MAN SAT TALL. Which statement best describes Janas error in the table? The insertion sequence should be the deletion sequence. The substitution sequence should be the insertion sequence. The insertion and deletion sequences should be switched. The substitution and deletion sequences should be switched. This group was formed in the Georgia General Assembly in 1960 for the purpose of gathering public reaction to Federal orders to integrate public schools within the state. From the Khan Academy Video on Impact of Media Evolution on Politics (Slide #2), what example of early newspapers influenced the ratification (passing) of our US Constitution? (Hint: we learned this earlier in the yearwhat group believed in a Strong Central Government?) What are the three domains of life?Plantae, Animalia, and Fungiclass, kingdom, and phylumEubacteria, family, and EukaryaBacteria, Archaea, and Eukarya 5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand