The angle θ=π3 is in standard position and has a terminal side that coincides with the graph of a proportional relationship represented by y=kx.

a. Find the constant of proportionality, k.

b. Write an ordered pair that lies on the graph of y=kx.

Answers

Answer 1

Part a

theta = pi/3

sin(pi/3) = sqrt(3)/2

cos(pi/3) = 1/3

tan(angle) = opposite/adjacent = rise/run = slope

tan(pi/3) = sin(pi/3)/cos(pi/3) = (sqrt(3)/2)/(1/2) = sqrt(3)

The value of k is k = sqrt(3)

This is also the slope the line y = kx because it is in the form y = mx+b with m = sqrt(3) and b = 0.

===============================================

Part b

Pick any value you want for x, and plug it in to find the paired value of y

if x = 0, then y = 0 because

y = sqrt(3)*x = sqrt(3)*0 = 0

So (0,0) is one ordered pair on the line

---------

If x = 1, then y = sqrt(3), since,

y = sqrt(3)*x = sqrt(3)*1 = sqrt(3)

We can say ( 1, sqrt(3) ) is another ordered pair

---------

If x = sqrt(3), then,

y = sqrt(3)*x = sqrt(3)*sqrt(3) = sqrt(3*3) = sqrt(9) = 3

Therefore, ( sqrt(3), 3 ) is another ordered pairThere are infinitely many ordered pairs on this line.

Related Questions

Please help fast!!!!

Answers

Answer:

C

Step-by-step explanation:

The exponent is negative so you put the number under 1 with the exponent positive

Answer:

I think the correct answer should be C

Step-by-step explanation:

2-4= -2

If x = 1/2, then x − 1/2 = 0. This is the same as (?) = 0.
In completely factored form, f(x) = (?).

Answers

Answer:

2x-1 =0      F(x)=(x+1)(x-2)(2x-1)^2

Step-by-step explanation:

Answer:

2x-1

(x+1)(x-2)(2x-1)^2

Step-by-step explanation:

x2 + 4x + xy + 4y
Whats the answer for this?

Answers

Assuming you want to factor, then you would use the factor by grouping method

x^2+4x + xy+4y

(x^2+4x) + (xy+4y)

x(x+4) + y(x+4)

(x+y)(x+4)

Therefore, x^2+4x + xy+4y factors to (x+y)(x+4)

A fitness club charges $100 to join and $33 for each month.
Part A
Choose an expression for the word problem above.
Part B
Find the cost for 6 months of membership.

Answers

Answer:

100 + 33m, $298

Step-by-step explanation:

33 times 6 plus 100

Answer:

298

Step-by-step explanation:

How to find the perimeter of a triangle

Answers

Answer:

Analyze then add

Step-by-step explanation:

Basically, just analyze the lengths of the sides, and then add them together for the perimeter

Thank me later :)

Answer:

s+s+s=p

Step-by-step explanation:

Just add the three side measurements. Answer will contain a unit most of the time. Remember to convert units if its asking for different units.

Question 9 (5 points)
Moe has been offered two different summer jobs. Job A would pay him an hourly rate of $12. Job B would pay him $510 for a 40-hour work week. Which job has a higher rate of pay? There isn't enough information to determine which job has a higher rate of pay.
Job B
Job A and Job B have equal rates of pay.
Job A

Answers

Job B, because you divide the total pay (510) and the hours (40), so 510/40= 12.75

Answer:

$12.75

Step-by-step explanation:

Moe has been offered two different summer jobs. Job A would pay him an hourly rate of $12. Job B would pay him $510 for a 40-hour work week. First, you have to set up the problem like this:

$510/40 hr = ?/1 hr

The next step is to either cross multiply or you can divide the numerator and denominator by the denominator number because 40/1 is still going to be 40. That means, $510/40= what number?

Answer: $12.75 per 1 hour

6 cm
4 cm
7 cm
It’s a rectangular pyramid.

Answers

HOPE THIS WILL HELP U...

The answer will be 168cm.

Name the quadrant in which the angle lies.
859°

Answers

Answer:

2

Step-by-step explanation:

Find the area of a polygon using the given apothem
Plz anwser, will mark brainest!! Tell me what u did, plz anwser nobody else will

Answers

Answer: 7) 162.15 yd^2 8) 439.7 yd^2 9) 151.42 yd^2

Step-by-step explanation:

ellie buys a mobile phone in spain €352.50 her brother jack buys an identical phone in japan for ¥39856 work out how much it is in £

Answers

Answer:

a) The best deal was in Japan

b) The difference is £38

Step-by-step explanation:

First, find out the cost in pounds for both of the purchases.

Japan:

          39856 / 188 = 212.

          the Japanese phone cost £212.

Spain:

          352.50 / 1.41 = 250.

          the Spanish phone cost £250.

Then, subtract the costs to find the difference:

          250 - 212 = 38

The Identical phone in Japan is €28163.

What is an expression?

An expression is a way of writing a statement with more than two variables or numbers with operations such as addition, subtraction, multiplication, and division.

Example: 2 + 3x + 4y = 7 is an expression.

We have,

Price of the phone in Spain = €352.50

Price of the phone in Japan = ¥39856

Now,

€1 = ¥141.52

Multiply 39856/141.52 on both sides.

39856/141.52 x 1€ = 39856/141.52 x ¥141.52

€28163 = ¥141.52

Thus,

The cost of a phone in Japan is €28163.

Learn more about expressions here:

https://brainly.com/question/3118662

#SPJ2

Right now there are 600 everlasting roses in my garden. I want at
least 200 roses in the garden at all times. If the gardener is cutting
25 roses a week to decorate my throne room, how many more
weeks will be able to have AT LEAST 200 roses in my garden?

Answers

Answer:

16 weeks

Step-by-step explanation:

400/25 =16

John runs 5 miles in 3/4 of an hour.
At the same pace, how many hours will
it take him to run only 1 mile?

Answers

Final answer:

John's speed is 6.67 miles per hour. Therefore, it would take him approximately 0.15 hours or 9 minutes to run 1 mile at the same pace.

Explanation:

The subject of this problem is rate. We can calculate John's speed by dividing the distance he covers by the time it takes. In this case, John ran 5 miles in 3/4 of an hour. So, his speed is 5 miles divided by 3/4 hour, which equates to 6.67 miles per hour. This means he runs 6.67 miles in 1 hour.

Given that speed is constant, if John wants to run only 1 mile, we simply divide this distance by his speed. So, 1 mile divided by 6.67 miles per hour gives 0.15 hours, or approximately 9 minutes. So, it would take John about 0.15 hours or 9 minutes to run 1 mile at the same pace.

Learn more about Rate calculation here:

https://brainly.com/question/30984881

#SPJ12

A television screen with a 12 inch diagonal has a height of 9 inches what is the diagonal of a similar television screen with a height of 24 inches?

Answers

I believe it is 32
Explanation:
24/9=2.67
24x2.67=32

Answer:

5 and 12

Step-by-step explanation:

The circumference of a circle is 28 pi inches. What is the length of the radius of this circle?
14 in.
21 in.
28 in.
56 in.

Answers

Answer:

The radius is 14 with a circumference of 28

The radius of the circle with circumference 28π is given by r = 14 inches

What is a Circle?

A circle is a closed two-dimensional figure in which the set of all the points in the plane is equidistant from a given point called “center”. Every line that passes through the circle forms the line of reflection symmetry. Also, the circle has rotational symmetry around the center for every angle

The circumference of circle = 2πr

The area of the circle = πr²

where r is the radius of the circle

The standard form of a circle is

( x - h )² + ( y - k )² = r²,

where r is the radius of the circle and (h,k) is the center of the circle.

The equation of circle is ( x - h )² + ( y - k )² = r²

For a unit circle , the radius r = 1

x² + y² = r² be equation (1)

Now , for a unit circle , the terminal side of angle θ is ( cos θ , sin θ )

Given data ,

Let the radius of the circle be represented as r

Now , the equation will be

The circumference of the circle C = 28π inches

And , circumference of circle = 2πr

On simplifying , we get

2πr = 28π

Divide by π on both sides , we get

2r = 28

Divide by 2 on both sides , we get

r = 14 inches

Hence , the radius of the circle is 14 inches

To learn more about circle click :

https://brainly.com/question/28391204

#SPJ6



What are the primary ways to finance your business?​

Answers

Answer:

Step-by-step explanation:

finding financing in any economic climate can be challenging, whether you're looking for start-up funds, capital to expand or money to hold on through the tough times. ...

Step-by-step explanation: the primary ways to finance your business are through savings, credit cards, friends and family, loans from lending networks or programs, angel investors, business loans and lines of credit, factoring, and purchase order funding.

Which of the following scenarios describes the surface area of a figure? Select all that apply:
Putting a seed and dirt into a hole when planting
Painting the walls of a wooden toy chest
Filling a box with spaghetti noodles
Frosting a cake for a birthday

Answers

The following scenarios that describes the surface area of a figure would be Painting the walls of a wooden toy chest and Frosting a cake for a birthday because they both talk about the surface of something!

I hope this helped! Mark me Brainliest! :) -Raven❤️

Find the lengths of the triangle.

Answers

Answer:

AB= 10 BC= 17 AC= 10 x=10

Step-by-step explanation:

trust me

PU 15 cm
0
162
1. Find the arc length of PQR.

Answers

It isn’t really clear to me it’s confusing

The radius of a circle is 40ft. Which is true statement ability the circumference(c)?
A. 40ft. B. 160ft. C.80ft. D. 240ft.

Answers

Answer:

C =251.2 ft

Step-by-step explanation:

To find the circumference we use

C = 2 * pi *r

C = 2 *pi * 40

C = 80 pi

C = 80 *3.14

C =251.2

What is the equation of the line?

Answers

Answer:

y = 1/4x - 3.

Step-by-step explanation:

We see that the line passes through the points (4, -2) and (0, -3) so the slope is (-3 - (-2) / (0-4)

= -1 / -4

= 1/4 = the slope of the line.

The slope-intercept form of a straight line is y = mx + b where m = slope and b = y-intercept. Here the y-intercept is at (0, -3) so b = -3.

So the equation of the line is y = 1/4x - 3.

Triangle ABC was translated according to the rule (x, y) = (x + 1.5, y-3.5) to create the image AA'B'C' shown on the
coordinate plane
Which graph shows the pre-image, ABC?

Answers

Answer:

Option D

Step-by-step explanation:

Hope this helps! :)

The coordinates of the preimage will be at A(-2.5, 5.5), B(-2.5, 2.5) and C (-6.5, 2.5)

What is translation?

Translation is a transformation technique for changing the size and position of an object on the x-y plane.

From the given diagram, the coordinate A'B'C' is given as:

A' = (-1, 2)

B' = (-1, -1)

C' = (-5, -1)

If the triangle ABC was translated according to the rule (x, y) = (x + 1.5, y-3.5) to create the image A'B'C'

A (x + 1.5, y-3.5) = (-1, 2)

x + 1.5 = -1

x = -2.5

y - 3.5 = 2

y = 5.5

Hence A = (-2.5, 5.5)

B = (x + 1.5, y-3.5) = (-1, -1)

x + 1.5 = -1

x = -2.5

y - 3.5 = -1

y = 2.5

Hence B = (-2.5, 2.5)

C (x + 1.5, y-3.5) = (-5, -1)

x + 1.5 = -5

x = -6.5

y - 3.5 = -1

y = 2.5

Hence C = (-6.5, 2.5)

Hence the graph that shows the pre image ABC is attached below

Learn more on translation here: https://brainly.com/question/12861087

#SPJ5

Help rhis is geometry

Answers

Answer:

They are not congruent

Step-by-step explanation:

what is the factored form of x^2 - 6x + 8

Answers

Answer: (x-2) (x-4)

Can you please help me I will reward brainliest plz hurry

Answers

Answer:

172 m^2.

So you already have it on the correct answer.

Step-by-step explanation:

For you to find the surface area, you need to find out the areas of all the different colored sections.

There are 6 sections.

2 green, 2 purple, and 2 red.

Green section: (length x width) 7 x 8 = 56

Purple section: (length x width) 2 x 8 = 16

Red section: ( length x width) 7 x 2 = 14

Total: 56 + 16 +56 + 16 + 14 + 14 = 172 cm².

Feel free to let me know if you need more help. :)

It’s 172m^2
Because the rectangular middle piece is 18 by 8 which equals 144 then you had the smaller pieces with are both 14 and when you had all three you get 172

The diameter of a cylindrical construction pipe is 4 ft. If the pipe is 16 ft long, what is its volume?

Use the value 3.14 for , and round your answer to the nearest whole number.

Be sure to include the correct unit in your answer.

Answers

Answer: 201 square feet

Step-by-step explanation:

Hi, to answer this question we have to apply the next formula:

Volume of a cylinder: π x radius² x height (in our case the length of the pipe)

Since:

Diameter = radius x 2

In our case D =4

4 = 2radius

Radius= 4/2 = 2 ft

Now that we have the radius, we can use the volume formula replacing with the values given:

V = 3.14x 2² x 16 = 3.14 x 4 x16 =200.96 = 201 square feet

Sort data from least to greatest


0, 0, 1/2, 1, 1, 5/4, 1/4, 2, 1, 2, 1/2

Answers

0, 0, 1/4, 1/2, 1/2, 1, 1, 1, 5/4, 2, 2

Answer:

0, 0, 1/4, 1/2, 1/2, 1, 1, 1, 5/4, 2, 2

Step-by-step explanation:

The triangle on the grid will be translated two units left. On a coordinate plane, triangle A B C has points (negative 1, negative 1), (negative 1, negative 5), (0.5, negative 5). Which shows the triangle when it is translated two units left? On a coordinate plane, triangle A prime B prime C prime has points (1, negative 1), (1, negative 5), (2.5, negative 5). On a coordinate plane, triangle A prime B prime C prime has points (negative 3, negative 1), (negative 3, negative 5), (negative 1.5, negative 5). On a coordinate plane, triangle A prime B prime C prime has points (negative 1, 1), (negative 1, negative 3), (0.5, negative 3). On a coordinate plane, triangle A prime B prime C prime has points (negative 1, negative 3), (negative 1, negative 7), (0.5, negative 7) hurry please its timed ;-;

Answers

Answer:

Option B.

Step-by-step explanation:

The given vertices of triangle ABC are (-1, -1), (-1, -5) and (0.5, -5).

We need to find the coordinates of triangle when it is translated two units left.

So, the rule of translation is

[tex](x,y)\rightarrow (x-2,y)[/tex]

Using this rule, we get

[tex]A(-1,-1)\rightarrow A'(-1-2,-1)=A'(-3,-1)[/tex]

[tex]B(-1,-5)\rightarrow B'(-1-2,-5)=B'(-3,-5)[/tex]

[tex]C(0.5,-5)\rightarrow C'(0.5-2,-5)=C'(-1.5,-5)[/tex]

The vertices of triangle A'B'C' are A'(-3,-1), B'(-3,-5) and C'(-1.5,-5).

Therefore, the correct option is B.

Answer:

the answer is B

Step-by-step explanation:

I don't give explanations all you want is the answer

The radius of a circle is 1 inch. What is its circumference?
sorry

Answers

the answer would be 6 inches!
To find the circumference of a circle you would use do pi x diameter of circle

So pi x 2=6

The circumference of the circle is 6 inches.

Two rectangular prisms have the same volume. The area of the base of the blue prism
is 4 1/8 square units. The area of the base of the red prism is one-half that of the blue
prism. Which statement is true?
CLEAR
CHECK
A.The height of the red prism is four times the height of the
blue prism.
B.The height of the red prism is two times the height of the
blue prism.
C.The height of the red prism is one-half the height of the
blue prism.
D.The height of the red prism is the same as the height of
the blue prism.​

Answers

The height of the red prism must be twice the height of the blue prism.

Volume of a prism can be calculated as the area of the base multiplied by the height.  Since the height of the blue prism is twice that of the red prism, the height of the red prism must be twice as much as that of the blue prism to make the volumes equal.

What is the length of PQ?

Answers

Answer:

It is 6 (six)

Step-by-step explanation:

The length of PQ of the triangle PQJ is [tex]5\frac{1}{3}[/tex] units.

What is a triangle?

A triangle is a two-dimensional geometrical figure that has three sides, three vertices and three interior angles.

Given, m∠B = m∠P, m∠T = m∠J.

Therefore, ΔBLT and ΔPQJ are similar triangles.

Let, the length of PQ is 'x'.

Therefore, [tex]\frac{BL}{PQ} = \frac{BT}{PJ}[/tex]

⇒ [tex]\frac{4}{x} = \frac{6}{8}[/tex]

⇒ [tex]x = \frac{(4)(8)}{6}[/tex]

⇒ [tex]x = \frac{32}{6} = 5\frac{1}{3}[/tex]

Learn more about a triangle here: https://brainly.com/question/4381051

#SPJ3

Other Questions
What are two causes of soil loss? Jana made a table to help her review the types of mutations for an exam. She started with the sequence THE MAN SAT TALL. Which statement best describes Janas error in the table? The insertion sequence should be the deletion sequence. The substitution sequence should be the insertion sequence. The insertion and deletion sequences should be switched. The substitution and deletion sequences should be switched. This group was formed in the Georgia General Assembly in 1960 for the purpose of gathering public reaction to Federal orders to integrate public schools within the state. From the Khan Academy Video on Impact of Media Evolution on Politics (Slide #2), what example of early newspapers influenced the ratification (passing) of our US Constitution? (Hint: we learned this earlier in the yearwhat group believed in a Strong Central Government?) What are the three domains of life?Plantae, Animalia, and Fungiclass, kingdom, and phylumEubacteria, family, and EukaryaBacteria, Archaea, and Eukarya 5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in