The organizational unit that is responsible for the sale and distribution of goods and services is the

Answers

Answer 1
The organizational unit that is responsible for the sale and distribution of goods and services is the sales organization.

This is because they are selling the product or service.

Related Questions

The novelist can deal with social or religious beliefs through his characters.
a. True
b. False

Answers

a. - True. 

It all depends on how the characters act and think, which you might also call personality.

Hope it helped!

Answer:

True

Explanation:

Jessica eats at honchos often because, after buying five hamburgers, you get one free. jessica is on a _______________ schedule of reinforcement.

Answers

Jessica eats at honchos often because, after buying five hamburgers, you get one free. Jessica is on a fixed-ratio schedule of reinforcement. A fixed-ratio schedule of reinforcement is when a certain amount of something has to happen or be purchased to receive the reward. 

20 POINTS!!!! How would you describe your financial personality?

Answers

Uh I spend everything?
Financial Personality is how you spend or use financial assets in your life. My personal financial personality would be considered to be a saver. This means that I like to save money to afford major purchases, my income usually exceeds my expenditures, and finally I usually view money as a source of security. (I hope this helps).

You purchase 20 shares of common stock at $15.20 per share. a few months later, you sell the shares for $10.12. no dividends were paid. your stockbroker charges 2.5% commission on transactions of less than 100 shares. determine the gain (or loss) of the stock transaction. round your answer to the nearest cent.
a. a gain of $114.26
c. a gain of $197.34
b. a loss of $114.26
d. a loss of $197.34

Answers

Purchased common stocks: 1.025 x 20 shares x $15.20 = $311.60
Sold common stocks: (1 - 0.025) x 20 shares x $10.12 = $197.34

To get the gain or loss of the stock transaction:
$197.34 - $311.60 = ($114.26) 

Negative result signifies loss.

The answer is there is a loss of $114.26

The stock transaction resulted in a loss of $114.26. The purchase cost including commission was $311.60, and the net selling amount was $197.34. Therefore, the correct answer is option b. a loss of $114.26.

You purchase 20 shares of common stock at $15.20 per share. A few months later, you sell the shares for $10.12. No dividends were paid. Your stockbroker charges 2.5% commission on transactions of less than 100 shares. Determine the gain (or loss) of the stock transaction. Round your answer to the nearest cent.

Calculate the total cost of the stocks when purchased:

Purchase Cost = 20 shares * $15.20 per share = $304.00

Calculate the commission paid on the purchase:

Purchase Commission = 2.5% * $304.00 = $7.60

Calculate the total amount received from selling the stocks:

Selling Amount = 20 shares * $10.12 per share = $202.40

Calculate the commission paid on the sale:

Selling Commission = 2.5% * $202.40 = $5.06

Calculate the net amount received after selling:

Net Selling Amount = $202.40 - $5.06 = $197.34

Calculate the net loss from the transaction:

Net Loss = Purchase Cost + Purchase Commission - Net Selling Amount = $304.00 + $7.60 - $197.34 = $114.26

Therefore, the stock transaction resulted in a loss of $114.26. The correct answer is option b. a loss of $114.26.

A person that contracts out their services to (or work for) associations and corporations and plan meetings down to the last detail is a(n)_____.

Answers

A person that contracts out their services to (or work for) associations and corporations and plan meetings down to the last detail is a meeting plannerA meeting planner/scheduler is a job that someone can fill in an organization if they are looking for an employee to schedule, track and manage meetings. It is easy to get side tracked in meetings so having them planning and scheduled helps keep everyone on track.

Final answer:

A professional who provides detailed event planning services for corporations and associations is known as a meeting or event planner. They ensure successful meetings and can benefit the host organization with expanded outreach, diversity, and cost-effectiveness. An in-house lobbyist is someone who lobbies for their employer.

Explanation:

A person who contracts out their services to associations and corporations and plans meetings down to the last detail is often referred to as a meeting or event planner. This professional is skilled at organizing and coordinating all aspects of corporate meetings and events, ensuring a smooth and successful experience for both the host organization and the participants. Partnering with organizations for event planning can be highly beneficial, as it can lead to expanded outreach by tapping into multiple networks, promoting diversity among attendees, and realizing cost savings by combining resources.

When it comes to lobbying on behalf of their employer, a person who undertakes such activities as part of their job might be known as an in-house lobbyist. This differs from a volunteer lobbyist, who would perform such duties on a non-paid, voluntary basis.

Sandy, gale, and marylou are on the board of directors for an area non-profit organization. at a recent meeting, guest david delivered a rousing speech on how group leadership is often too complex and that non-profits could often be better served by a ceo and no board of directors. sandy emphatically disagreed with david stating that not having the board could open the organization up to massive levels of corruption. gale agreed with david and feels that maybe the organization might do better if only one of the ladies were in charge, mainly herself. marylou chose not to comment on the matter, thus leading sandy to assume that she agreed with her. it could be said that sandy and gale are suffering from ________.

Answers

It could be said that sandy and gale are suffering from group think and group shiftGroup think is defined as making decisions as a group which takes individuality away from an individuals thoughts and does what the group wants overall. Group shift is when there is an pull towards a position that a person is making the decision on that would be different if they weren't in a group setting. 

When it is reported that a nation is experiencing a "balance of payments deficit," this is best interpreted to mean that the nation is experiencing?

Answers

When it is reported that a nation is experiencing a "balance of payments deficit," this is best interpreted to mean that the nation is experiencing? If it is reported that the nation is experiencing a balance of payments deific, the country is importing more goods, services and capital than it is exporting. When this happens, the nation has to borrow funds and items from other countries to help pay for what they are importing until the have the cash funds to pay for them, themselves. When this starts the happen, the nation that this is hurting should try and balance their payments and monitor transactions better to eliminate this in the future. 

The nation is experiencing ‘balance of payment deficit’ means that a decrease in foreign exchange reserves.

Further Explanation:

Balance Of Payments(BOP): It refers to the country's statistical record of international transactions that have taken place over a period of time represented or prepared in the double-entry bookkeeping format. It is useful because:

It provides the information about the demand and supply of the currency.It is useful for the evaluation of the country's financial performance.

The balance of payment can either be surplus or deficit. If the balance of payment is surplus, then it means that the country export more services and goods than its import.The balance of payment deficit means that the country's imports are more than its export. It implies that the foreign exchange reserve is decreasing because the country is importing more than it is exporting.  

Therefore,the nation is experiencing a 'balance of payment deficit' means that its foreign exchange reserves are decreasing or depleting.

Learn more:

1. Learn more about the demand equalibirium

https://brainly.com/question/2656746

2. Learn more about the demand of the product

https://brainly.com/question/2488917

3. Learn more about the elasticity of demand

https://brainly.com/question/6255841

Answer details:

Grade: High School

Subject: Economics

Chapter: Balance of payment

Keywords: Balance of payment, surplus, deficit, decrease in foreign exchange reserves, foreign exchange reserves .

"during times of economic trouble, which are immigrants often accused of?" causing inflation and unemployment to increase planning terrorist attacks forcing their religion on native-born residents taking jobs away from native-born residents

Answers

During times of economic trouble, which are immigrants often accused of?
Taking jobs away from native-born residents. During economic trouble, immigrant are often accused on taking jobs away from native-born residents because they are typically cheaper to hirer for the same job. Immigrants often work harder as well by nature because they need to prove themselves (as they think) to keep their jobs and create a profitable life in America. This makes it hard for native-born residents to keep their jobs since the immigrants will do the same amount of work for less wage. 

The correct answer to the question is: Taking jobs away from native-born residents.

During times of economic trouble, immigrants are often accused of taking jobs away from native-born residents. This is because there is a common misconception that there is a fixed number of jobs in the economy, and if immigrants take some of these jobs, there will be fewer jobs available for the native-born population. The fear is that this could lead to higher unemployment rates among native-born workers.

However, the reality is more complex. Immigrants often take jobs that native-born residents may not want or may be underqualified for, and they also contribute to the economy by starting new businesses, paying taxes, and filling labor shortages in various industries. Additionally, immigrants can help to stimulate economic growth by increasing demand for goods and services, which can lead to job creation.

Writing in the new york times on the technology boom of the late​ 1990s, michael lewis​ argues, 'the sad​ truth, for​ investors, seems to be that most of the benefits of new technologies are passed right through to consumers free of​ charge.' what does lewis means by the benefits of new technology being​ "passed right through to consumers free of​ charge'?

Answers

He means that in the long-run, the price is equal to minimum average total cost. In this sense, people consumers receive the new technology "free of charge". 

The​ ________ is a budget based on multiple levels of projected sales or production.

Answers

Budgets help businesses track and manage their resources. They are used by businesses to measure their spending. They are also utilized to develop effective strategies for maximization of assets and revenues.

There are many types  of budgets,  commonly used are:

Master Budget

Operating Budget

Cash Flow Budget

Financial Budget

Financial Budget

Among the five mentioned, the type of budget based on multiple levels of projected sales or production is the operating or operation budget. To create an accurate picture of this, operating budgets must account for factors such as sales, production, labor and materials costs, overhead, manufacturing and administrative expenses.

____ set the stage for the requirements for any information systems and applications that need to be created or adapted. business process models business repositories business policies business reports

Answers

Answer:

business repositories

Explanation:

A business repository is a place where a large amount of a corporation's information is stored, typically for the long term. business repositories are not made public. Only users with specific roles and permissions granted may access documents in a typical business repository.

Business process models set the stage for the requirements for any information systems and applications that need to be created or adapted. The correct answer is option: business process models.

Business process models outline the various activities, workflows, and interactions within an organization, providing a clear understanding of how tasks are performed. These models help identify the specific needs and functionalities that information systems must support to improve efficiency and effectiveness.

By mapping out the current processes, business process models highlight areas for improvement and ensure that any new systems or applications are designed to align with organizational goals and workflows.They also facilitate communication between stakeholders, developers, and end-users, ensuring that the developed systems meet the actual needs of the business and support its operational objectives.

What is the smallest unit of data on the hard drive? folders sectors gigabytes clusters?

Answers

well everything else on google says a sector so sector im guessing...

The first step in managing it security is to develop a _____ based on confidentiality, integrity, and availability.​
a. ​risk policy
b. ​security policy
c. ​threat report
d. ​concealment report

Answers

The first step in managing IT security is to develop a security policy based on confidentiality, integrity, and availability.​ A security policy is what is secured for a system, organization or another entity. This keeps make sure that all important information is kept secure and only available to those tho should have access to it. 

Final answer:

To manage IT security effectively, the first step is to create a security policy that incorporates the CIA triad's principles, thereby laying down the procedures for protecting an organization's digital assets.

Explanation:

The initial step in managing IT security is to develop a security policy based on the principles of confidentiality, integrity, and availability, commonly referred to as the CIA triad. A security policy is a comprehensive plan that outlines an organization's implementation of security measures to protect its resources and data. This foundational document will guide the organization in handling and mitigating various cyber threats, ensuring that sensitive information remains confidential, is not altered improperly, and is available to authorized users when needed.  Option b is correct . Confidentiality ensures that information is accessible only to authorized individuals, integrity ensures that the information is accurate and reliable, and availability ensures that the information is accessible when needed. By developing a security policy based on these principles, organizations can effectively manage IT security risks and protect their assets.

Which group represents arguments for free trade group a group b?

Answers

Group A - Consumers have a larger variety of good and services to choose from
- U.S companies should be forced to keep prices low
- a better climate is created for investment and entrepreneurship

Answer:

Group A is correct option which best describes the free trade implications.

Explanation:

When the Free trade agreements are signed the consumers have variety of options available because now there are no tariffs or trade barrier imposed on the product coming from other countries. This means that the customer in US can consider products coming from Canada and Mexico as an alternative to native companies.

Now the revenue losses from the free trade agreements of the native companies will start increasing because now there are greater number of competitors in the US market. All they have to do is lower their cost to decrease their prices to compete foreign companies.

When the FTA is formed, the companies shift their manufacturing operations to a country where the infrastructure costs, labor costs lower and utility costs lower. Such circumstances creates favorable situations for the foreign investments.

The federal reserve system: was created by and is owned by the government. pursues independent fiscal policy at the behest of congress. never acts to control inflation. pursues an independent monetary policy which can conflict with the government's economic policy. only acts to lower taxes and increase spending when there are recessionary tendencies in the econo

Answers

The answer is
never acts to control inflation. pursues an independent monetary policy which can conflict with the government's economic policy

The Federal Reserve system: pursues an independent monetary policy which can conflict with the government's economic policy. Thus, option (c) is correct.

The Fed's governors are chosen by the President and subject to confirmation by Congress. The Fed was established as an independent central bank. The necessity to protect it from immediate political pressures serves as the main argument for an independent Federal Reserve.

The Fed is autonomous in the sense that it determines its own monetary policy and other related decisions without requiring input from the federal government.

As a result, the significance of the Federal Reserve system are the aforementioned. Therefore, option (c) is correct.

Learn more about on Federal Reserve system, here:

https://brainly.com/question/32374280

#SPJ4

Your question is incomplete, but most probably the full question was.

The Federal Reserve system:

A: pursues independent fiscal policy at the behest of Congress.

B: never acts to control inflation.

C: pursues an independent monetary policy which can conflict with the government’s economic policy.

D: was created by and is owned by the government.

E: only acts to lower taxes and increase spending when there are recessionary tendencies in the economy.

In a mixed market economy, what is a typical way the government can reduce unemployment? The government can pay for projects to create work. The government can control new factories to provide jobs. The government can create new farm fields to hire workers. The government can raise taxes to encourage employment.

Answers

Answer

In a mixed market economy, the typical way the government can reduce unemployment is : The government can pay for projects to create work

Explanation

In a mixed market economy, part of the economy is left to the free market and part of it is managed by the government. In a mixed economy, private enterprise run most businesses and the government later intervene in areas like provision of public services( education, health care and waste control), and in the regulation (legal right to private property). Most modern economies are mixed where the means of production are shared between the private and public sectors.


The right option is The government can pay for projects to create work is a typical way the government can reduce unemployment

In a mixed market economy, the government has various ways to reduce unemployment. Among the options given, the most typical way is where the government pays for projects to create work. This is an example of a demand side solution and involves the government funding public projects such as infrastructure construction, which directly increases employment opportunities by requiring more labor. These projects can stimulate economic activity and create jobs for unemployed individuals.Other options, such as controlling new factories or creating new farm fields, are not as common in a mixed market economy because they involve higher levels of government control and intervention in the economy, which is typically less accepted in such systems

WILL MAKE BRAINLIEST!!PLS HELP


Does the holland code use career clusters?

Answers

I believe this is true. 

Hope this helps!
Hello user


Answer: True

I hope this helps
-Chris

How many years do you have to go to college to be a computer technician?

Answers

Becoming a computer engineer requires an extensive college education that can take from 4 -7 years to complete.
In the first 2 years of a bachelor's degree program, you typically finish computer engineering prerequisites and general education courses.

Which factor does not affect the elasticity of demand for a good?

Answers

An increase in population

Answer:

an increase in population xxxxxxxxxxxx---- Answer

the importance of the good to the consumer

the consumer’s perception of the good as necessity or luxury

the availability of substitute goods

Explanation:

I just got 100% on this test

GRADPOINT

If no fixed duration of the partnership is specified, the partnership is a partnership in perpetuity, which means that the partnership cannot be dissolved.
a. True
b. False

Answers

The answer is b. false.

In the absence of a partnership agreement on fixed duration, the Partnership Act 1890 may apply.

Under the Act, a partnership will be automatically dissolved  if: a partner dies

·         a partner becomes bankrupt;

·         the court orders it to be dissolved;

·         it's illegal to carry on the business of the partnership;

·         the partnership was created meet a goal and this  specific objective or the project is complete; or

a partner gives notice to dissolve the partnership to the other partners. The 

_____ costs include expenses for items such as supplies, equipment rental, and software leases.

Answers

Answer:

The correct answer would be, Operational Costs or Operational Expenses.

Explanation:

Operational expenses or Operational Costs are the cost that are on going. These are not fixed costs. These are the costs which a company considers as the cost of operating the business. The costs which incurs while operating the business for example, Supplies, equipment rental, software leases, accounting expenditures, depreciation of fixed assets, property taxes, legal fee, Insurance costs, etc, are categorized under the Operating Expenses.

The Zero Tolerance Law Means

Answers

the zero tolerance law means that anyone under the age of 21 is not allowed to drive with even the smallest amount of alcohol in their system

The Zero Tolerance Law includes policies that require a harsh punishment for certain violations with no regard for context. In policing, it is believed to deter serious crime by cracking down on minor offenses, while in schools, it mandates strict punishments like suspension or expulsion without discretion. These policies are contentious and may not always be effective in decreasing violence or maintaining order.

The Zero Tolerance Law refers to policies that mandate a predetermined, typically harsh punishment for specific offenses. In law enforcement, this can result in Zero Tolerance Policing, where police target minor crimes to deter more serious crimes, under the assumption that disorder can lead to more significant criminal activities. In the educational sphere, zero tolerance can lead to strict consequences like suspension or expulsion for policy violations regarding weapons or hate speech, regardless of context or intent. However, research indicates that such stringent policies may not reduce violence and could potentially increase it, implying that they might not always be effective in fostering safer environments.

Examples of the negative effects include the suspension of a 6-year-old for bringing a camping utensil to school or a ninth-grader penalized for confiscating a weapon from a threatening peer. Despite their intentions to maintain order, zero tolerance policies are often criticized for their lack of discretion and potential for unintended consequences.

When applied to issues like hate speech on campuses, proponents argue that zero tolerance could potentially prevent violence and confrontations by setting clear, non-negotiable boundaries for behavior. However, critics highlight the potential impacts on individual freedoms and the complexity of enforcing such broad policies.

Janicex co. is growing quickly. dividends are expected to grow at a rate of 24 percent for the next three years, with the growth rate falling off to a constant 6 percent thereafter. if the required return is 11 percent and the company just paid a dividend of $1.90, what is the current share price

Answers

answer: $ 63.30 ± 1%

If Ted wants to buy a house and believes that interest rates will rise, he should __________. apply for a fixed-rate mortgage apply for an adjustable-rate mortgage use his credit card wait until a better time

Answers

Apply for a fixed rate mortgage

Anne owns a business that trades in perishable commodities. Which property would Anne be interested to invest in? office building land warehouse showroom

Answers

I believe a Warehouse is the most likely answer.

The badys and their maid, alice, took a trip to hawaii for their summer vacation. the travel agent told ike bady that the trip would cost $210 for each child plus another $315 per adult. according to ike's credit card receipt, the trip cost a total of $2,205 for all 9 of them. find the number of adults and children on the trip by writing and solving a system of equations.

Answers

Let x be the number of children
Let y be the number of adults

Equation 1: x + y = 9
Equation 2: y = 9 - x

           210x + 315y = 2205
     210x + 315 (9-x) = 2205
210x + 2835 - 315x = 2205
            2835 - 2205 = 315x - 210x
                         630 = 105x
                  630/105 = 105x/105
                             6 = x

There are 6 numbers of children.

To get the y, use the Equation 2: y = 9 - 6 ---> y = 3
Therefore there are 3 adults on the trip.

How would you expect a drought to influence the ppf for onions​ (on the x​-axis) and other goods and services​ (on the y​-axis)? how would you expect the drought to change the opportunity cost of producing​ onions? a drought that limits onion production would shift the ppf​ _____ and​ _____ the opportunity cost of producing onions.
a. ​inward; decrease
b. ​inward; increase
c. ​outward; decrease
d. ​outward; increase?

Answers

.How would you expect a drought to influence the PPF for onions (on the x -axis) and other goods and services (on the y -axis)? How would you expect the drought to change the opportunity cost of producing onions?A drought that limits onion production would shift the PPF _____ and _____ the opportunity cost of producing onions. A. inward; decrease B. outward; increase C. outward; decrease D. inward; increase

How does inflation affect the minimum wage?

Answers

Inflation can raise or lower minimum wage depending on how much inflation is.
Final answer:

Inflation reduces the purchasing power of minimum wage, leading to a decrease in real income for wage earners. Wage adjustments that lag inflation contribute to financial insecurity for workers and prolonged disputes with employers. The absence of regular adjustments exacerbates the decline in the real value of minimum wage.

Explanation:How Inflation Affects the Minimum Wage

Inflation impacts the value of minimum wage by decreasing its purchasing power over time. Even though nominal wages rise, they may lag behind inflation for periods because wage adjustments typically happen only once or twice a year. If minimum wage adjustments are not made frequently to reflect inflation, workers experience a loss in real income. For instance, from 1967 to 2020, the federal minimum wage's purchasing power dropped significantly even though the nominal wage increased from $1.40 to $7.25 per hour. This reduction in purchasing power illustrates the negative effect of inflation on minimum wage earners.

Moreover, the extent to which wages keep up with inflation is a source of financial insecurity for workers. It can lead to difficult and prolonged negotiations between employers and employees. As per Figure 22.6, the real minimum wage continued to decline after 2010, indicating that adjustments for inflation were insufficient to maintain workers' buying power.

What part of the offered deal is the interest rate?

Answers

Interest rates are the portion of the loan that is charged to the borrow from the lender. The number is represented as an interest rate as an annual percentage. The annual percentage is divided into a monthly percentage and then is added to the loan payment each month. 

Answer:

1. C

2. A

3. C

welc

Explanation:

When purchasing a dishwasher a manager can tell if it is in compliance with the regulatory authority by?

Answers

When purchasing a dishwasher a manager can tell if it is in compliance with the regulatory authority by? Appliances have to be compliant with federal regulations. To check if a dishwasher is in compliance, a manager can make sure there are NSF seals or ANSI certifications on the dishwasher. 
Final answer:

A manager can determine if a dishwasher is in regulatory compliance by checking for certifications and labels on the product that proves it meets the necessary standards. Examples of such standards are the Energy Star label in the United States. They can also ask the manufacturer or supplier for a list of compliances.

Explanation:

When purchasing a dishwasher, a manager could ascertain its regulatory authority compliance by looking for certifications and labels on the product that indicate it meets the required standards in its respective region. For example, in the United States, a dishwasher in compliance must have an Energy Star label, which signifies that the appliance meets the energy efficiency guidelines set by the Environmental Protection Agency (EPA) and the Department of Energy (DOE).

A manager can also verify compliance by reaching out to the manufacturer or supplier who should be able to provide a full list of the certifications and standard compliances that the dishwasher possesses.

Learn more about Regulatory Compliance here:

https://brainly.com/question/32680107

#SPJ6

Other Questions
determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure Summarize the narrative Churchill present Read this timeline:1975: federal election commission (fec) is established2002: bipartisan campaign reform act (bcra) is passed2010: citizens united v. fec is decidedwhat process do the events in the timeline reflect?