The two girls recieved the package at 11 a.m. Each of them starred at the box with consternation, wondering what was inside. Finnally, Beth announced that she was going to open it, and Michelle nodded, her face frowning scowl. Which word from the passage is NOT misspelled? A) recieved B) starred C) consternation D) Finnally

Answers

Answer 1
c)consternation is the answer 

Related Questions

A sentence tat contains two or more independent clauses but does not contain any dependent clauses is known as

Answers

It is known as a compound-complex sentence.

I hope this helps!

How does the metaphor in the line "It grew, a starlit flag unfurled!" in the last stanza affect the poem

Answers

The metaphor in the final stanza has two effects. "A starlit flag unfurled" compares the land to a flag.

On one level, this metaphor conveys the power of finally seeing land after all that time at sea. One light becomes an entire starlit flag. The hope that one light gives is power.

However, there is a much deeper level to this metaphor. It likens the land to the American flag, indicating he had both seen land and discovered a nation simultaneously. At this point, Columbus "gained a world."

Answer:

It highlights the excitement the sailors felt upon first sighting land

Explanation:

took the test :D

How does Wiglaf show his own honor

Answers

Wiglaf is a young warrior in the service of his king, Beowulf. ... Wiglaf is the only one willing to risk his life to help his ruler. He declares that he would rather be burned to death than to abandon his king, and he rushes to Beowulf's defense.

Answer:

Explanation:

Wiglaf is a young but strong and fearless warrior. He has great courage but most importantly, he is deeply loyal to his leader Beowulf. There is an honor code between the king or lord and his followers (also called retainers) by which the followers show loyalty and devotion and fight no matter the result. In return, the leader rewards them with land, protection and treasure.

Wiglaf follows this code of honor when he decides to risk his own life to help Beowulf battle against the dragon. When he realizes that his leader is in great danger, he called the other warrios but they all flee. Wiglaf stays and stubs the dragon bravely. This allows Beowulf to kill the dragon.

Select the word from the drop-down menu that best completes the sentence.
After listening to each party’s claims, the _ proposed a reasonable compromise.
A. mediate
B. mediation
C. mediator
D. mediatory

Answers

Answer:

he is correct c mediator

Explanation:

After listening to each party’s claims, the mediator proposed a reasonable compromise. The correct option is C.

What is the role of the mediator according to the evaluative model?

An evaluative mediator helps the parties come to a resolution by highlighting the flaws in their arguments and speculating on what a judge or jury would most likely decide. An evaluative mediator may provide the parties with formal or informal recommendations regarding how the issues should be resolved.

The mediator supports and directs the parties as they work out their own settlement. Although he or she does not make the final decision, the mediator aids in the parties' comprehension of and attention to the crucial issues that must be resolved. In order to negotiate a dispute resolution, the mediator's job is to facilitate conversations between the parties. Rights: A commitment from the parties to mediate in good faith, as evidenced by the ratification of the Agreement to Mediate, is something the mediator is entitled to.

Thus, the ideal selection is option C.

Learn more about mediators here:

https://brainly.com/question/29318361

#SPJ6

Who was the educator that made a bet about Sonny’s competition at the science fair in the rocket boys ?

Answers

i say the educator that made a bet about sonnys competition was homer hickam jr.

Little Mrs. Sommers one day found herself the unexpected possessor of fifteen dollars. It seemed to her a very large amount of money, and the way in which it stuffed and bulged her worn old [pocketbook] gave her a feeling of importance such as she had not enjoyed for years. . . . A man with keen eyes, who sat opposite to her, seemed to like the study of her small, pale face. It puzzled him to decipher what he saw there. In truth, he saw nothing—unless he were wizard enough to detect a poignant wish, a powerful longing that the cable car would never stop anywhere, but go on and on with her forever. Source: Chopin, Kate. “A Pair of Silk Stockings.” The Awakening and Selected Short Stories. Project Gutenberg, 11 Mar. 2006. Web. 12 May 2011. Which point of view does this excerpt illustrate? third-person limited second-person third-person omniscient first-person

Answers

third-person omniscient

In third-person omniscient the narrator knows what many characters are thinking and feeling. We know that the narrator is aware of the women's thoughts and feelings when it says, "It seemed to her" and "a feeling of importance." We also know that the narrator is aware of the man's feelings when it says, "It puzzled him." 
Second-person point of view is mostly found in instruction manuals and cookbooks where the author is telling you to do something. Second-person pronouns are you, your, yours. 
First-person point of view is when the narrator is telling a story about him or herself. First-person pronouns are I, me, my, mine. 

Final answer:

The excerpt from "A Pair of Silk Stockings" by Kate Chopin is an example of a third-person limited point of view, focusing solely on Mrs. Sommers's internal experience.

Explanation:

The excerpt from Kate Chopin's "A Pair of Silk Stockings" illustrates a third-person limited point of view. This point of view allows the reader to understand the inner thoughts and feelings of Mrs. Sommers, the main character, without providing insight into the thoughts of any other characters. For example, the excerpt offers a glimpse into Mrs. Sommers' feelings of importance after acquiring fifteen dollars, which hints at her usually modest existence. The third-person limited perspective is evident when the narrative describes the man with keen eyes unable to decipher what he sees on Mrs. Sommers's face, indicating that the narrator does not offer an omniscient view of all characters' thoughts.

help please
1.Which of the following is a reason to use a direct quotation?

a.when it’s the only support you have for a point

b.when the quote is a good length and fits well into the paragraph

c.when the words of an authority are needed to emphasize the point

d.when you don’t understand an idea or know how to state your point

2.What is the best use of a style manual?

a.to see if the paper’s supporting details are correct

b.to make sure the spelling is correct throughout

c.to establish the specific formatting of the paper

d.to proofread the paper for typos and errors

Answers

Question one would be C.
And question two would be C.

Answer:

C and C.

Explanation:

According to Accelerate...

"The words of an authority, when well-stated, carry a lot more weight than your words would. In that case, use the quotation. If it’s too long, use the most important points and condense, using ellipses to indicate missing words." (for #1)

"The style manual is not an encyclopedia or dictionary. It’s purpose is to make sure your style conforms to set standards." (for #2)

A thesis must be supported by _____.

evidence
outlines
paragraphs
other novels

Answers

A or C, but I believe it to be A more so.
A Evidence , good luck

Which of the following is the BEST theme of our text Nectar in a Sieve?
Question 10 options:


Out with the old and in with the new.


Love can overcome all obstacles.


Tradition giving way to modernity has both positive and negative consequences


The struggle to find faith is a difficult one but will ultimately be worth the fight.

Answers

I can already tell you that you can eliminate the first two answers. Out with the old and in with the new and love can overcome all obstacles. I have not read the book, but I read a briefly summary of it online. After all it is about life and struggles. Life, consciousness, existence and finding hope. That's how I know it's D. The struggle to find faith is a difficult one but will ultimately be worth the fight  Hope I helped. 

To find the theme of "The Pursuit of Happiness," the reader should
A) study any statistics, facts, and reasons in the poem.
B) look for ways the poem tries to persuade the reader.
C) locate the message that the poem conveys to the reader.
D) look for supporting evidence that backs up claims in the poem.

Answers

Answer:

C) locate the message that the poem conveys to the reader.

Explanation:

To find the theme of "The Pursuit of Happiness," the reader should locate the message that the poem conveys to the reader. You can see the poem's more significant meaning and main idea by examining its tone, images, and symbols. To gain insights, you need to know what the author was trying to say and how the phrase makes you feel.

Thinking about the historical background and drawing on personal experiences can improve the reading. Exploring the poem's depths leads to a deep connection with and understanding the message, allowing the reader to fully grasp its details and complexities.

Consider different points of view to fully understand the poem's themes and messages. This will make your reading experience more enjoyable and help you know how important the poem is in the bigger picture.

Which pronouns in this excerpt from Mark Twain’s “Eve’s Diary” show it is written in the first-person point of view?

Answers

Final answer:

The pronouns 'I' and 'me' in the excerpt from Mark Twain's 'Eve's Diary' indicate that it is written in the first-person point of view, with the narrator directly recounting their own experiences.

Explanation:

The pronouns in the excerpt from Mark Twain’s “Eve's Diary” that show it is written in the first-person point of view are “I” and “me”. When a story is narrated from the first-person point of view, the narrator is a character within the story, telling the tale from their own perspective. In this mode of narration, the reader is privy to the narrator’s thoughts, feelings, and biases. Examples of these first-person pronouns from the passage include “I had become a good steersman,” and “Mr. Bixby served me in this fashion once.” These pronouns indicate that the narrator is recounting his own experiences directly, making it a first-person narrative.

Which is true when a country is experiencing a Golden age

A. It’s citizens enjoy widespread economic prosperity and significant achievements in art, music, and/or literature or are attained.

B. People attend well-written plays and become more educated and enlightened as a result.

C. Great wealth is evenly distributed among every citizen.

D. A beautiful, kind, and wealthy queen is respected by her subjects.

Answers

The correct answer is A.

A Golden Age is a period of peace and prosperity. Furthermore, there are significant achievements in cultural development, which include art, music, and literature.

Therefore, only A. best summarizes the effect of a Golden Age on a population. Citizens enjoy widespread economic prosperity and significant cultural achievements are attained.
A. It’s citizens enjoy widespread economic prosperity and significant achievements in art, music, and/or literature or are attained.

As we see winston sipping his drink in the chestnut tree cafe, what is this scene meant to remind us of?

Answers

Answer:

This scene is meant to remind us of the novel that Winston saw the thoughts of criminal jones.

Explanation:

This scene is meant to remind us of the novel that Winston saw the thoughts of criminal jones at the Chestnut tree.As Winston was watching, Rutherford began to cry.   At that time, he noticed that they looked old and rough.  Winston is now in their position. He was a thinking criminal and was tortured by Big Brother.

Learn more :

https://brainly.com/question/8841444?referrer=searchResults

Identify the sentence in which the underlined verb does not agree with its subject

Answers

22. The answer is "There are no information to support these ratings." There is singular, so "are" would not work. "Are" is typically used when the subject is plural. I hope this helps!

21. The answer is "Neither of the twins are interested in sports.". The verb that should be used is "is", not "are". I hope this helps!

Refer to Explorations in Literature for a complete version of this article.

The last paragraph in the article "Nixon Resigns" by Carroll Kilpatrick describes the weather and the "orderly crowd" outside the White House.

Which statement best explains why the author included this information in the article?

A.The information shows that a remarkable event occurred on an ordinary day.

B.The information provides key details to support the facts of the article.

C.The information was mistakenly included and has no bearing on the article.

D.The information provides a logical conclusion to the entire article.

Answers

A.The information shows that a remarkable event occurred on an ordinary day.

WIth this ending to the whole article, it gives a sensation of desolation, a rainy humid august day, it gives the sensation of being there, of something really big happened with the first ever US president to resign, and the weather couldn´t be worst, rainy, crowds gathered, and all in shock.

Which of the following is a run-on sentence?

A. The game was tied at halftime; each coach gave his team a pep-talk.
B. The game will be called if the storm continues, the weather is dangerous.
C. The players continue to work on both hitting and fielding, allowing them to improve both skillsets.
D. While the rain was drenching at times, the fans were dedicated and refused to leave.

Answers

The correct answer is B. The game will be called if the storm continues, the weather is dangerous.
A run-on sentence is a grammatically incorrect sentence where two or more clauses are connected without using an appropriate conjunction, or without a conjunction at all. As you can see in sentence B, we have two clauses (the game will be called if the storm continues and the weather is dangerous) which are ungrammatically connected with just a comma. 

B because each part of the sentence would soun more sensible if read alone as seperate statements.

“Can't see it,” remarked Rainsford, trying to peer through the dank tropical night that was palpable as it pressed its thick warm blackness in upon the yacht. In this passage, the word palpable means A. thick and humid. B. rhythmic. C. eerie and frightening. D. something one can touch.

Answers

Palpable means that something can be felt or touched. In the short story "the dank tropical night that was palpable as it pressed its thick warm blackness in upon the yacht". The answer is D.

Answer:

In this passage, the word palpable means D. something one can touch.

Explanation:

The adjective palpable can literally refer to something one can touch, as in "The palpable scar on his face made him insecure". In the way it is used in the excerpt we are studying here, palpable still refers to something that can be touched but in a more figurative manner. Palpable refers to a feeling or a sensation so strong that it can almost be physically felt or touched.

In the excerpt, the dank night was palpable due to the strong feeling its darkness caused. It was warm and black, probably even a bit scary and mysterious, so it made a strong impression on the character.

Which quality of an epic hero does Odysseus display in lines 3–11?

Answers

Odysseus demonstrates heroic, god-like actions.

Definition of captivating

Answers

To draw attention to some one

For example: To captivate his audience the author uses imagery
Get ppl interested into the story and have a exciting thought

Everything we learn about, daisy we learn through?
A.The Miller Family
B.Winterbourne
C.A first-person Narrator
D.Society

Answers

Winterbourne


The point of view of the novel is first person peripheral. However, there are very few times where we actually see the thoughts or opinions of the narrator. The narrator only tells us about Daisy as Winterbourne sees her. We never find out the narrator's opinions or thoughts about Daisy. It's as if the narrator is just repeating what Winterbourne has relayed to him.

In 'Daisy Miller: A Study,' we learn about Daisy through the perspective of Frederick Winterbourne, who is intrigued by her behavior and attempts to understand her within European social norms.

In Henry James's novella Daisy Miller: A Study, we learn about the character of Daisy chiefly through the perspective of Frederick Winterbourne. Winterbourne, an American expatriate, seeks to understand Daisy's innocence and character against the backdrop of European society.

His perception of her is a blend of curiosity, bewilderment, and a reflection of his own social and psychological fears, as he tries to reconcile Daisy's behavior with the unwritten rules of European manners and etiquette for young women. Thus, the answer to the question is B. Winterbourne.

Can anybody help me with this ?

Answers

The answer is, True. hope this helps! =^.^=

Which best explains how Anaya’s word choice establishes his voice in the excerpt? Anaya compares “tortillas” to “the soul” of a Mexican-American writer, demonstrating the ability of these writers to combine Spanish and English in their writing. Anaya compares “tortillas” to “the soul” of a Mexican-American writer, emphasizing his belief that writers must be allowed to express their culture and heritage. Anaya compares “tortillas” to “the soul” of a Mexican-American writer to persuade people to read more literature by writers that come from mixed heritages and diverse cultures. Anaya compares “tortillas” to “the soul” of a Mexican-American writer to express his opinion that only those writers who exist outside of the mainstream are worthy of an audience.

Answers

Answer:

Anaya compares “tortillas” to “the soul” of a Mexican-American writer, emphasizing his belief that writers must be allowed to express their culture and heritage.

Explanation:

In "Take the Tortillas Out of Your Poetry", Rudolfo Anaya states that Mexican-American authors can't put their legacy and language into writing and that ought not to make it troublesome for them to be treated as equal to other American writers.

The best explanation for Anaya's word choice is Anaya compares “tortillas” to “the soul” of a Mexican-American writer, emphasizing his belief that writers must be allowed to express their culture and heritage.

What is Anaya saying?

In ''Take the Tortillas Out of Your Poetry'," Rudolfo Anaya talks about how Mexican-American writers are not allowed to write much on their heritage.

He argues that this needs to end because Mexican-American writers and writers of all kinds, need to be able to adequately express their culture and heritage in their writing.

Find out more on ''Take the Tortillas Out of Your Poetry'' at https://brainly.com/question/15110235.

What does jimmy end up telling martha when they reunite? how does she respond?

Answers

???????????????????????????

At what point is one's responsibility to society more important than individual safety?

Answers

i'm giving my opinion on this but i personally think that you should know when to look out for others and when to look out for yourself. If your always helping somebody else out take some time to help yourself. if you are self absorbed, then take a look at the problems going on in the world.

99 POINTS AND BRAINLIEST FOR BEST ANSWER

.Write a letter of complaint. Follow the rules for a formal letter, and use the full-block style. The complaint may be about anything you wish (such as malfunctioning equipment, poor building maintenance, or disruptive noises from a nearby business).You can base your letter on a true experience, or you can make up all the details you need.

AND IT HAS TO BE PLAGARISM FREE!!!!

Answers

Answer:

i like your username lol

Explanation:

the answer is D, heterozygous

Answer:

Lag

Explanation:

SO MUCH LAG ON MY COMPUTER, IT'S LIKE CORONA CORRUPTED IT!

( btw YouDaBest lol :P)

help me I put 99p and breanliest please help
d
d
d
d
d
it is 15p please help me:_:

Answers

this is personal and stuff a middle school student knows. mine is; I am an impulsive buyer. I buy anything I want like magazines as long as I have money.
 if a budget was to be set in place I could save up to go to concerts and things like that.
yes I do plan on using one because there is a lot of things I want to do yet cant because I spend too much.

Answer:

this is personal and stuff a middle school student knows. mine is; I am an impulsive buyer. I buy anything I want like magazines as long as I have money.

if a budget was to be set in place I could save up to go to concerts and things like that.

yes I do plan on using one because there is a lot of things I want to do yet cant because I spend too much.

Explanation:

Based on your understanding, what literary device being used? allusion metaphor personification simile

Answers

Allusion i believe. Sorry im late

Answer:

allusion

Explanation:

Emily was a shy girl. which is the subject and verb

Answers

emily is the subject since she’s a person and the verb is shy since it describes her

How many years was odysseus gone from his family? 2. what did odysseus do at troy that made him famous? 3. what year did homer write the odyssey? 4. who wrote the odyssey? 5. what is the name of odysseus' land? the tragedy 6. how many men did odysseus have when he left troy? 7. how many men did odysseus bring home with him? 8. how many men does scylla eat? 9. how does odysseus' ship sink? 10. what did odysseus miss by not being at home for so many years?

Answers

20.
odyssues was the only one left when he got home

scylla eats 2-3 men

Final answer:

Odysseus was gone from his family for 20 years due to his involvement in the Trojan War and subsequent journey home. He is famous for coming up with the idea of the Trojan Horse. The Odyssey was written by the ancient Greek poet Homer in the 8th century BCE.

Explanation:

1. Odysseus was gone from his family for a total of 20 years. He spent 10 years fighting in the Trojan War and another 10 years trying to make his way back home.

2. Odysseus is famous for coming up with the idea of the Trojan Horse. He devised a plan to build a giant wooden horse and hide Greek soldiers inside. The Trojans mistakenly brought the horse into their city, allowing the Greek soldiers to sneak out and conquer Troy.

3. Homer is believed to have written the Odyssey in 8th century BCE

4. The Odyssey was written by the ancient Greek poet Homer

5. In the tragedy, Odysseus' land is called Ithaca.
6. Odysseus had 12 ships and 720 men when he left Troy.

7. Odysseus brought none of his men home. They were all lost during their journey.

8. Scylla is a sea monster with six heads and she eats six of Odysseus' men.

9. Odysseus' ship is destroyed by a storm and the sea god Poseidon after his crew kills the sacred cattle of the sun god Helios.

10. Odysseus missed out on seeing his son Telemachus grow up and rule his kingdom in Ithaca.

Learn more about Odysseus' journey and achievements here:

https://brainly.com/question/27771890

#SPJ2

I NEED HELP ASAP!
The applicant indicated that her strengths included copy-editing reports, designing presentations, and _______.
Which phrase would preserve the parallel structure in the sentence?
A) what a lot of other skills.
B) the ability to speak Chinese
C) a knowledge of computer programming
D) troubleshooting computer network problems

Answers

I am positive the answer is D.

If you need anything else you can always ask me :)

Hope this helps :)
Other Questions
BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts.