The upward movement of water in a plant involves all the following processes except?
A. Translocation
B. Cohesion
C. Tension
D. Transpiration

The by-products of hydrolysis include...
A. Protein and fats
B. Stamen and anthers
C. Carbon dioxide and water
D. Pollen and ovules

Answers

Answer 1

The answer is A. Translocation is the movement of food material such as carbohydrates up the plant to parts such as the leaves. This force is not associated with water movement since it is associated with the phloem tissues of the plant.  

 

The answer is A. Hydrolysis process reduces substances such as carbohydrates to glucose or proteins to constituent amino acids. This requires that water is used up in breaking the bond. Hydrolysis can also happen in reverse where bigger molecules are formed from smaller molecules  by expending water from the bond (condensation reaction).







Related Questions

In a complex food web what would be the most likely result of removing one species of a secondary consumer

Answers

If you remove a secondary consumer then, primary consumers have the chance to overpopulated and Tertiary consumers underpopulate or die off because there's no secondary consumers to eat

The primary cause of recent global warming is believed to be ________.

Answers

the answer is most likely Greenhouse gases

Which of the biomolecules below includes a polydentate ligand called a porphyrin? hemoglobin chlorophyll cytochrome c carbonic anhydrase?

Answers

The correct answer is haemoglobin.
Porphyrins are a group of heterocyclic macrocycle organic compounds with the function to absorb strongly in the visible region of the electromagnetic spectrum. Those molecules are composed of four modified pyrrole subunits connected with carbon atoms. Porphyrins are the conjugate acids of ligands. They bind metals, like iron to form complex- heme which is the component of haemoglobin.

The biomolecule from the given option that includes a polydentate ligand named Porphyrin is called Hemoglobin.

What is Porphyrin?

A porphyrin is a molecule with large rings made up of four pyrroles, which are smaller rings composed of four carbons and one nitrogen. These pyrrole molecules are linked together by a sequence of single-double bonds, forming a large ring known as tetrapyrrole.

Porphyrins are responsible for the red hue color of blood in mammals. These porphyrin molecules are used in the formation of -heme groups in mammals.

The nitrogen molecules in the ring's core have the ability to house an iron molecule that is responsible for the red color of blood called Hemoglobin.

Learn more about porphyrin here:

https://brainly.com/question/16522092

Match these cell cycle checkpoints to their role in genome integrity is the dna replicated with out damage?

Answers

Final answer:

The cell cycle is regulated by checkpoints (G₁, G₂, and M) that ensure genome integrity by assessing DNA integrity, chromosomal replication, and proper attachment of the kinetochores to spindle fibers, respectively.

Explanation:

The cell cycle events are regulated at key points known as checkpoints. These checkpoints help maintain the genome integrity by ensuring that all the necessary actions have taken place correctly before the cell moves to the next phase.

First, the G₁ checkpoint is where the integrity of the DNA is assessed. If any damage to the DNA is detected, the cell cycle is halted until repairs are made. This is to prevent the replication of defective DNA.

The G₂ checkpoint is the phase where cell size and protein reserves are evaluated, and importantly it ensures all the chromosomes have been replicated without damage. If any irregularities are spotted, the cell cycle stops to either complete correct replication or repair the damaged DNA.

Lastly, the M checkpoint or the mitotic checkpoint works during the mitosis phase. Here, proper attachment of each kinetochore to a spindle fiber is assessed. The cell cycle will not proceed until all sister chromatids are correctly attached to the spindle fibers.

Learn more about Cell Cycle Checkpoints here:

https://brainly.com/question/29639561

#SPJ3

How do mycorrhizal fungi benefit plants?

Answers

Mycorrhizal fungi benefit plants in increasing absorption capabilities. Mycelium has the higher absorptive capacity for water and mineral nutrients than plant because of the large surface area of fungal hyphae and because hyphae are longer than plant root hairs. Also, some fungi can mobilize soil minerals which are unavailable to the plants' roots.

Mycorrhizal fungi benefit plants in several ways: Nutrient absorption, Water Uptake, Soil Structure, Protection against Pathogens etc.

1. Nutrient Absorption: Mycorrhizal fungi form a symbiotic relationship with plant roots, greatly increasing the surface area for nutrient and water absorption. The fungal hyphae can access nutrients such as phosphorus, nitrogen, and micronutrients that are otherwise less available to plants due to limited mobility in the soil.

2. Water Uptake: The extensive network of fungal hyphae can absorb water from a larger volume of soil, which is particularly beneficial during periods of drought. This helps to improve the plant's drought resistance.

3. Soil Structure: The hyphae of mycorrhizal fungi can help to stabilize soil structure, which improves soil aggregation and porosity. This leads to better aeration and water retention in the soil.

4. Protection Against Pathogens: Mycorrhizal fungi can protect plant roots from pathogens by competing with them for space and nutrients, and by producing compounds that inhibit the growth of pathogenic microorganisms.

5. Stress Tolerance: Plants with mycorrhizal associations often show increased tolerance to various environmental stresses, including salinity, heavy metal toxicity, and extreme temperatures.

6. Enhanced Growth: By improving nutrient and water uptake, mycorrhizal fungi can enhance plant growth and vigor, leading to increased biomass production and crop yields.

7. Ecosystem Diversity: Mycorrhizal fungi contribute to the diversity of plant communities by facilitating the establishment of certain plant species, which in turn supports a greater diversity of above-ground organisms.

8. Carbon Sequestration: The symbiotic relationship between mycorrhizal fungi and plants can lead to increased carbon sequestration in the soil, as the fungi receive carbon compounds from the plant and store some of it in the soil.

9. Nutrient Cycling: Mycorrhizal fungi play a crucial role in nutrient cycling within ecosystems by facilitating the decomposition of organic matter and the transfer of nutrients from the soil to the plant.

In summary, mycorrhizal fungi are essential for plant health and soil fertility, and they play a key role in sustainable agriculture and ecosystem functioning.

On a hot, dry day, plants close their stomata to conserve water. what impact does this have on photosynthesis?

Answers

The stomata is used for transpiration as well as intake of CO2, which is essential for photosynthesis. Closure of the stomata reduces transpiration rate and stops photosynthesis 

When plants close their stomata to conserve water on hot, dry days, the rate of photosynthesis is inhibited due to lower carbon dioxide intake, which is necessary for the Calvin cycle, and an increased internal oxygen concentration that can lead to photorespiration, reducing photosynthesis efficiency.

On a hot, dry day, plants close their stomata to conserve water, which can have a significant impact on photosynthesis. The closing of stomata reduces the uptake of carbon dioxide (CO2), which is a crucial component for the photosynthetic process. This leads to a decrease in the rate of photosynthesis because the reduced CO2 levels directly affect the Calvin cycle where CO2 is fixed and converted to sugars. Additionally, the closing of stomata to conserve water also prevents the escape of oxygen (O2), which results in an increase in internal O2 concentration, potentially leading to photorespiration, a process that competes with photosynthesis and decreases its efficiency.

. what is causing ellie's thyroid to secrete too much hormone?

Answers

Secreting too much of thyroid hormones is a condition called hyperthyroidism. Causes of hyperthyroidism are different and may happen when the entire gland is overproducing thyroid hormone or a single nodule ("hot")  is responsible for the excess hormone secretion. Some of the causes of hyperthyroidism include thyroiditis (inflammation of the thyroid), clinical conditions like Graves' disease (an autoimmune disease that affects thyroid), thyroid adenoma (benign tumor of the thyroid gland), hypersecretion of thyroid stimulating hormone (TSH)…

Answer:

Ellie's problem is probably being caused by Grave's disease.

Explanation:

Graves Disease is an autoimmune disease, that is, caused by a defect in the immune system that leads to inflammation of the thyroid by the autoantibodies themselves, defense proteins that exist to protect our body from infections and aggressors. The result is that the thyroid begins to secrete more hormone than it should, causing some problems to the body.

an air mass that originates in the pacific ocean west of brazil is most likely what

Answers

Answer:

Warm and wet

Explanation:

Air masses are large portions of air that have relatively homogeneous internal temperature, pressure and humidity conditions, influenced by the region where they are formed. The place of formation of the air mass is called the region of origin, this is where the air mass will acquire its characteristics of temperature, pressure and humidity. Therefore, an air mass originating from western Brazil, will have common characteristics of a tropical region, that is, this air mass will be wet and have a high temperature.

For this reason, we can guarantee that an air mass that originates in the Pacific Ocean west of Brazil is likely to be warm and wet.

Final answer:

An air mass originating in the Pacific Ocean, west of Brazil, would be classified as maritime tropical (mT), implying that it is A. warm and wet.

Explanation:

An air mass that originates in the Pacific Ocean, west of Brazil, is most likely warm and wet. Air masses are classified based on temperature and moisture. Since the Pacific Ocean is a large body of water, an air mass originating there would pick up moisture, making it "maritime" (m) or wet. The geographic location near the equator indicates that the air mass would be "tropical" (T), and thus warm. The combination of maritime and tropical characteristics leads us to classify the air mass as maritime tropical (mT), which is warm and moist.

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Answers

It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to  ttagc sequence on the  DNA strand. The two DNA pieces would also align in anti-parallel alignment.






What makes up scientific argument

Answers

The major ingredient of scientific argument is scientific evidence and known science concepts. Thus through scientific idea, expectations and observations a scientific argument is given birth to. Scientific argument are usually arrived at by mean of scientific methods. 
The scientific argument should have scientific facts, not just opinions, and supporting ideas that can help its argument be considered by the judges and the public. They have to support to their arguments and present their findings which is not manipulated at all.

CAN SOMEONE HELP ME PLZ
Which of these is a characteristic of a parasite?
It is a helpful organism.
It lives inside or on a host.
It makes its own food.
It is always visible to the naked eye.

Answers

The correct answer is it lives inside or on a host.

A is incorrect because a parasite steals from the host, without giving anything in return. Much like a leech

C is incorrect because leeches almost always use their host as a food source

D is incorrect because parasites can often dig beneath the host's skin to be hidden from sight

Answer:

It lives inside or on a host.

Explanation:

BAM!

What type of manufacturing is most responsible for TCE releases?

Answers

Trichloroethylene is used for industrial degreasing operations. It is used as an industrial solvent in the process of manufacturing metal parts. It is used also for vapour degreasing and cold cleaning of metal, and removing oils and tars. It is also widely used for dry cleaning of fabrics.  

What cardiovascular disease creates a large number of abnormal white blood cells?

Answers

White blood cells also called leukocytes are the cells that help fight infection causing protection of the body against a disease or foreign substance. An example is a leukemia which then creates a large number of abnormal white blood cells.

_____ is is an inflammation of the nerve that connects the forearm to the palm of the wrist.

Answers

Answer:   Carpal tunnel syndrome (CTS) is an inflammation of the nerve that connects the forearm to the  palm of the wrist.

Explanation: Carpal tunnel syndrome is an inflammation in hand. Excess pressure in the hand is the reason of Carpal tunnel syndrome. Pain , swelling , numbness in the hand are the common symptoms of Carpal tunnel syndrome. CTS can be treated by applying cold packs on the swelling , by avoiding excess pressure on hand and by giving rest to the hand.

This mutation results from the insertion of two nucleotides into the original sequence which causes the reading frame of the sequence to change this kind of mutation is known as

Answers

The answer would be frameshift mutation.

The frameshift mutation happens when insertion or deletion of a number of nucleotides that is not multiple of 3. The result will definitely cause a problem in the reading sequence.
In this case, there are insertions of two nucleotides and two is not multiple of 3.

Answer:

Frameshift mutation

Explanation:

There are many different types of mutations in genetics, one such mutation is known as a frameshift mutation.

Codons are sequences of three nucleotides that determine the amino acid it codes for, and when something changes with these sequences, then we have a mutation.

In a frameshift mutation, nucleotides are added or deleted in such a way that the reading frame changes. For example:

If we have the nucleotide sequence- AUG UGC ACG UAC UUG CAG...

We can see that the reading frame reads three nucleotides per amino acid, however if an extra two nucleotides are added in a random location, then there is a shift- AUG UGC AUA CGU ACU UGC AG... (the underlined indicate the added nucleotides).

Now every amino acid after the frameshift mutation would be incorrectly coded for.

I need help on what to color!!!

Answers

hard to explain well but I will try:
1. color the pulmonary artery blue - the blood with CO2 is coming back into the heart to switch it for oxygen
2. the pulmonary vein in red - the blood in this vein is now full of oxygen and goes out to the rest of the body
3. the alveoli will be purple because this is where the gas exchange takes place (swapping CO2 for O2)

In _____, an energized molecule directly adds a phosphate group to adp, but _____ uses a concentration gradient of protons as the energy source required to phosphorylate adp.

Answers

In phosphorylation or phosphorylating, the energize molecule would add a phosphate group to adp yet  ATP would use a gradient of protons as energy source needed to phosphorylate adp.Hope this is the right answer to this question and this would help.

Answer:

phosphorylation; ATP

Explanation:

Phosphorylation is the name of one of the processes that occur in mitochondria during cellular respiration. With phosphorylation, cells gain a reservoir of energy for metabolic activities. In this process electron transfer from electronic donors to electronic acceptors occurs. This transfer is the redox reactions that enable the process of energy release, biologically usable for ATP biosynthesis.

In this case, an energized molecule would add a phosphate group to the ADP for ATP formation. However, ATP would use a proton gradient as the energy source needed to phosphorylate ADP.

Population growth how is population growth naturally regulated answer key

Answers

Population growth comes from a balance between food supply and predators. When pray increases food supply decreases, since they are eating them alot. As a result some of the prey dies off since there isn't enough food for them. Then the food supply increases but then suddenly dies off after pray comes backs and eats them. As a result the cycle continues

The natural regulation of population growth can occur through a variety of factors that are intrinsic to the ecosystem and the species themselves. These factors can be categorized into two main types: density-dependent factors and density-independent factors.

Density-Dependent Factors:

1. Competition for Resources: As the population size increases, the availability of resources such as food, water, and space becomes limited. This leads to increased competition among individuals, which can result in decreased birth rates and increased death rates due to starvation, stress, and disease.

2. Predation: Predators tend to eat more from abundant prey populations, which can help control the growth of these populations. As the prey population grows, the number of predators may also increase, further regulating the prey population.

3. Disease: Diseases can spread more rapidly in dense populations. High population density facilitates the transmission of pathogens, which can lead to increased mortality rates.

4. Parasitism: Similar to predation, parasites can have a significant impact on host populations. Higher host densities can lead to higher parasite loads, which can reduce host survival and reproductive success.

5. Territoriality and Intraspecific Competition: Many animals defend territories that provide the necessary resources for survival and reproduction. As populations grow, the size of these territories may shrink, leading to reduced reproductive success and increased mortality due to aggression and stress.

Density-Independent Factors:

1. Weather and Climate: Extreme weather events such as droughts, floods, storms, and temperature extremes can affect populations regardless of their density. These events can cause widespread mortality that is not related to the size of the population.

2. Natural Disasters: Earthquakes, volcanic eruptions, and fires can destroy habitats and cause mass mortality, impacting population sizes independently of population density.

3. Human Activities: Human-induced changes to the environment, such as pollution, habitat destruction, and the introduction of invasive species, can also regulate population growth. These factors can have catastrophic effects on populations, often independent of population density.

Carrying Capacity:

The carrying capacity of an environment is the maximum population size that the environment can sustainably support. When a population reaches or exceeds the carrying capacity, the limiting factors mentioned above become more pronounced, and the population growth is naturally regulated to bring it back to a sustainable level.

In summary, population growth is naturally regulated by a combination of density-dependent and density-independent factors. These regulatory mechanisms ensure that populations do not exceed the carrying capacity of their environment for extended periods, thus maintaining ecological balance.

_______ iron is found in some foods that provide all the amino acids humans require in their diet. heme flat nonheme raw

Answers

The right option is Heme Iron

Heme iron is a form of iron found in some foods that provide all the amino acids humans require in their diet. Heme iron is present in animal foods such as red meats, fish and poultry and it is readily absorbed and not well regulated by the body as the body has no way to remove excess iron.







Answer:

Heme Iron

Explanation:

Iron from the diet of humans is absorbed through the intestinal mucosa cells, mainly in the duodenum, and is transported in the bloodstream and extracellular fluid bound to a plasma protein called transferrin. Two types of iron are provided by the diet: heme iron and non-heme iron. Heme iron is present in animal foods, such as beef, chicken and fish, and non-heme iron, in addition to being offered by red meat, is also found in cereals and other vegetables.

Heme iron is soluble in small bowel conditions and is easily absorbed into the intestinal mucosa without the interference of chemical and / or dietary factors. For this reason, it is highly absorbed: about 15% of the heme iron ingested by the normal individual and 35% in the one with low iron stores. Heme iron is found in some foods that provide all the amino acids humans need in their diet.

What happens when a population is in hardy weinberg equilibrium apex?

Answers

The phenotype frequency does not change. 

A population is not evolving when it is in Hardy-Weinberg equilibrium for a gene, and allele frequencies will not change over time.

What is Hardy Weinberg equilibrium?

According to the Hardy-Weinberg equilibrium, if no disturbing factors exist, genetic variation in a population will remain stable from one generation to the next.

Sum total of all the allelic frequencies is 1.

p² + 2pq + q² = 1

p² = dominant homozygous frequency (AA)

2pq = heterozygous frequency (Aa)

q² = recessive homozygous frequency (aa)

Five factors affect Hardy Weinberg equilibrium:

Gene migration or gene flow: The transfer of genetic material from one population to another. When gene migration takes place multiple times it is known as gene flow.Genetic drift: When gene migration occurs by chance.Mutation: the alteration of a single base unit in DNA, or the deletion, insertion, or rearrangement of larger parts of genes or chromosomes, which changes the structure of a gene and produces a variant form that may be passed down to future generations.Genetic recombination: When chromosomes or chromosome fragments are broken and then rejoined, DNA sequences are rearranged through a process known as genetic recombination.Natural selection: The process through which populations of living things adapt and change is known as natural selection.

Learn more about  Hardy Weinberg's principle here:

https://brainly.com/question/7670970

#SPJ2

during _____, the cell uses information from messenger RNA to produce proteins

Answers

Answer: Translation.

Explanation: Translation is a step in the protein synthesis where the genetic information is carried from the DNA in the form of series of three base code words.

Each code represents a particular amino acid. During this step only the coding is decoded to produce the specific sequence of the amino acids in the polypeptide chain.

Which of the 3 muscles have cells that are shaped like cylinders with pointy ends?

Answers

This would be the smooth muscle type. Skeletal muscles are much more cylindrical, but they do not terminate at a point, so I believe you are referring to smooth muscle cells.

1.04 properties of water

Answers

Properties of water
1. As universal solvent
2. Specific heat capacity
3. High heat of vaporization
4. surface tension

Water is a unique substance with properties such as being tasteless, odorless, and transparent, and existing in all three physical states naturally. It is a polar molecule and an excellent solvent, with high melting and boiling points due to strong hydrogen bonding. These properties are essential for life and various chemical reactions.

Water is an extraordinary substance with several unique properties that are essential for life. Firstly, water is a liquid at standard temperature and pressure, and it is tasteless, odorless, and transparent. The color of water and ice has a slight blue hue in large quantities, while small amounts appear colorless. Water can exist naturally in all three physical states: solid, liquid, and gas. This versatility is crucial for the planet's water cycle.

Chemically, water is a polar molecule, consisting of two hydrogen atoms bonded to an oxygen atom, creating a dipole moment where the oxygen atom has a partial negative charge, and the hydrogen atoms have partial positive charges. This polarity contributes to water's role as an excellent solvent, sometimes referred to as the 'universal solvent,' because it can dissolve many substances, facilitating numerous chemical reactions.

Water also has unusually high melting and boiling points for a small molecule, at 0°C and 100°C, respectively. This is due to strong intermolecular hydrogen bonding between water molecules. Additionally, water has a high specific heat capacity, meaning it can absorb a lot of heat before increasing in temperature, and a high heat of vaporization, which is the energy required to convert it from liquid to gas. Interestingly, water's solid phase (ice) is less dense than its liquid phase, allowing ice to float, which is crucial for the survival of aquatic life during freezing conditions.

Water is tasteless and odorless.Water is transparent, enabling sunlight to penetrate for aquatic photosynthesis.Water is an excellent solvent, referred to as the 'universal solvent.'Water has high melting and boiling points due to strong hydrogen bonding.Water has a high specific heat capacity and high heat of vaporization.

Complete Question:

What are some properties of water?

Choose all the answers that apply. Which of the following organelles are found in plant cells but not in animal cells?
(1) cell membrane
(2) cell wall
(3) chloroplasts
(4)vacuole
(5)nucleus

Answers

The animals cell doesn't have cell wall and chloroplasts, I think? I'm sorry if I got wrong.

The organelles are found in plant cells but not in animal cells are cell wall and chloroplast. Thus, option B and C are correct.

What is the difference between plant cell and animal cell?

The main difference between plant cell and animal cell is that plant cell contain cell wall and chloroplast and animal cell does not contain cell wall as well as chloroplast. Plant cell contain chlorophyll that provide green color to the plants.The main function of the cell membrane has to keep away the toxic material out of the cell.

Cell membrane has been defined as a wall that differentiate and protect the inner structure of the cell from the outer environment. The main function of the cell membrane has to keep away the toxic material out of the cell. The cell membrane contain channels as well as the receptors that gives the permission to only selective permeable membrane to enter into the cell.

Therefore, The organelles are found in plant cells but not in animal cells are cell wall and chloroplast. Thus, option B and C are correct.

Learn more about plant cell and animal cell here:

https://brainly.com/question/1493437

#SPJ6

Mrs. j. is a 63-year-old woman who has a history of hypertension, chronic heart failure, and sleep apnea. she has been smoking two packs of cigarettes a day for 40 years and has refused to quit. three days ago, she had an onset of flu with fever, pharyngitis, and malaise. she has not taken her antihypertensive medications or her medications to control her heart failure for 4 days. today, she has been admitted to the hospital icu with acute decompensated heart failure.

Answers

She has heart failure, but we need ot ensure that WE do not post these types of prolbmes on the doctor's board. Because one will never make it past the initial insepctinos when it is found that you are not passing medical school

) briefly explain the difference between oxidation and reduction electrochemical reactions

Answers

in electrochemical cell there is an oxidation and reduction such as ( zn - cu ) in galvanic cell the zn lose 2 electrons and its called oxidation reaction (anode ) and cu is gain the electron that the zn lose it so it it is called reduction  reaction (cathode)
and its notation zn^/zn^+2//cu^+2/cu 

The text indicates that the clusters of teenage suicides that occasionally occur in some communities may be the result of

Answers

Social influence I believe is the answer

kidneys couldn't work without the
because

Answers

Kidneys couldn’t work without the liver because water wouldn’t leave the body.

Hope this helps!
~Brooke❤️

Describe the function of each organ through which food passes as it moves through the digestive tract.

Answers

The digestive system is made up hollow organs that consists of the mouth, esophagus, stomach, small intestine, large intestine and anus, sequentially. The supplementary organs are the liver, pancreas and the gall bladder.

The food enters first through the (1) MOUTH where mastication or the mechanical breakdown of food particles takes place. After the food is being swallowed it passes through the (2) ESOPHAGUS which is the conduit between the pharynx and (3) STOMACH which secretes acid and enzymes that chemically breaks down food that is termed as chyme. It comprises 10% of the digestion  and absorption. The chyme or partially digested food goes to the (4) SMALL INTESTINE where 90% of the digestion and absorption takes place. Its main functions is to absorb the nutrients and minerals from the chyme. (5) The LARGE INTESTINE is where the water from the remaining indigestible food matter is being absorbed. It also transmits the useless waste material from the body where it is excreted through the (6) ANUS

Final answer:

The digestive system consists of several organs through which food passes: mouth, pharynx, esophagus, stomach, small intestine, and large intestine.

Explanation:

The digestive system consists of several organs through which food passes as it moves through the digestive tract:

1)Mouth: Ingestion of food occurs in the mouth. Chewing breaks down the food into smaller pieces.

2)Pharynx: The pharynx is a passage that leads from the mouth to the esophagus.

3)Esophagus: The esophagus connects the pharynx to the stomach and uses peristalsis to push food down into the stomach.

4)Stomach: The stomach is a muscular organ that mixes food with digestive juices and continues the breakdown process.

5)Small Intestine: The small intestine is where most of the absorption of nutrients from food takes place. It is lined with villi, which increase its surface area for better absorption.

6)Large Intestine: The large intestine absorbs water from the remaining food waste and forms it into feces, which will be eliminated through the anus.

Compare and contrast eukaryotic cells with prokaryotic cells. Which type of cell might have been the first one to evolve and explain why this may have been the first.

Answers

Eukaryotic cells and prokaryotic cells contain a cytoplasm and ribosomes. Eukaryotic cells have organelles and a nucleus.

Prokaryotic cells were most likely to evolve first because of the simple structure.

Answer:

Prokaryotic cells are single-celled organisms that lack membrane-bound organelles and eukaryotic cells contain membrane-bound organelles.  

Prokaryotic cell lack nucleus and its genetic material is circular in form which is present in its cytoplasm while eukaryotic cell has a membrane-bound nucleus which contains linear DNA.

Prokaryotic cells might have been the first ones to evolve because prokaryotic cell is simple in organization while eukaryotic cell are more complex.  

Eukaryotic cells contain some organelle like mitochondria and chloroplast which resembles the prokaryotic cell because both have linear DNA and 70s ribosome.  

So it supports endosymbiotic theory which says that a large prokaryotic cell engulfs a small prokaryotic cell and both remained in symbiotic association with each other and evolved to form eukaryotic cells.

Other Questions
Extend your thinking: household appliances are usually connected in a parallel circuit. why do you think it might be a problem if too many appliances are turned on at once? (hint: current in a wire also produces heat.) Find the area of the circle r= 7 Why did Germany declare war on Belgium, although they were a neutral country? Fernando favors capital punishment. his attitude began to change when he was asked to offer arguments opposing it in a university debate class. his attitude change is best explained by ________ theory. The biological approach to psychological disorders is most likely to focus on _____. how many lines of symmetry does the figure have?? describe fundamental principles for evacuation of a healthcare setting Why is ground meat more susceptible to microbial contamination than unground meat? Read these lines from the text: Bees affect almost every aspect of the human food chain. From the fruits, vegetables, and grains we eat, to the grasses and grains we feed our livestock, we depend on bees to keep us healthy. What does the word aspect mean? Advance Slant Find Piece True or false: convection is the term used to describe how molecules move within a fluid such as a liquid or gas. Math Financial Literacy HELP How does a civilization respond when they can no longer meet their needs? Please select the word from the list that best fits the definition a cloud that forms near the ground Assuming a truck container holds 24 cases, how many cases would 6 truck containers hold? What did ponyboy mean when he said it was only yesterday but yesterday was years ago a life time ago? Sharon is paving a rectangular concrete driveway on the side of her house. The area of the driveway is 5x^2 + 43x - 18, and the length of the driveway is x + 9.Additionally, Sharon plans to install a carport over a small portion of the driveway. The volume that the carport can enclose is 48x^3 + 68x^2 - 8x - 3, and the area of driveway beneath the carport is 8x^2 + 10x - 3.Determine the width of the entire driveway and height of the carport in terms of x. Replace the values of m and b to complete the expression that represents the width of the entire driveway on the first line, and then replace the values of m and b to complete the expression that represents the height of the carport on the second line.You have to type the answer in mx+b im just trying to graduate.... which of the following is a balanced chemical equation for the reaction of magnesium with nitrogen gas to form magnesium nitride In which sentence would the word "humble best be replaced by the word "modest?Humble Pluto was once considered a planet, but is now only a dwarf planet.The humble child sat by herself in the corner of the room.The experience will surely humble most individuals.His humble attitude made it easy for everyone to like him. After initial settlement, what was the relationship between the Jamestown colony and the neighboring Powhatan tribes?They were often in conflict over land.They were allies who support each other against enemies.The settlers bought land from the Powhatan.The Powhatan gave their land to the settlers. In this segment, you learned that writers change elements of a play (setting, characters, theme, dialogue) when creating modern adaptations. Choose one element and write two to three complete sentences explaining how it might be changed and what effect that change might have on the outcome of the play.