using trig to find a side. help please !

Using Trig To Find A Side. Help Please !

Answers

Answer 1

Answer:

The length of LM to the nearest tenth of a foot would be 11.7

Step-by-step explanation:

Using the law of sines (b = c·sin(B)/sin(C)) you would plug in your missing values

x=7*sin(59)/sin(31)


Related Questions

The diameter of a cylindrical construction pipe is 6 ft. If the pipe is 30 ft long, what is its volume?

Use the value 3.14 for pi, and round your answer to the nearest whole number.

Be sure to include the correct unit in your answer.

Answers

Answer:

848 ft³

Step-by-step explanation:

The volume of a cylinder is given as:

V = pi * r² * h

Where r = radius of the cylinder

h = length of the cylinder.

The diameter of the cylindrical pipe, d = 6 ft

The radius of the cylindrical pipe, r = d/2 = 6 / 2 = 3 ft

The length of the cylindrical pipe, h = 30 ft

The volume of the cylindrical pipe is:

V = 3.14 * 3² * 30

V = 847.8 ft³ = 848 ft³ (to the nearest whole number)

The volume of the cylindrical pipe is 848 ft³.

Final answer:

The volume of a cylindrical construction pipe with a diameter of 6 ft and length of 30 ft can be calculated using the formula for the volume of a cylinder (V = πr²h). Given the specifics, the volume of the pipe is approximately 848 cubic feet.

Explanation:

The subject of this question is determining the volume of a cylinder, in this case, a construction pipe. The formula used to calculate the volume of a cylinder is V = πr²h. Here, the diameter of the cylindrical pipe is 6 ft, therefore radius (r) is half of diameter which is 6/2 = 3 ft and the length of the pipe, h, is 30 ft. Substituting r and h into the equation, we have V = 3.14 * (3ft)² * 30ft = 3.14 * 9ft² * 30ft = 847.8 cubic feet. Rounding to the nearest whole number, the volume of the pipe is approximately 848 cubic feet. The unit of volume in this instance is cubic feet, which is a measure of space occupied by a three-dimensional object.

Learn more about Volume of Cylinder:

https://brainly.com/question/16041415

#SPJ3

I have 420 apples & its 35% of what I needed how many apples do I need

Answers

Answer:

1200 apples.

Step-by-step explanation:

The way I thought about this was, you need to figure out how many apples per percent. Thus, I divided 420 by 35, which gave me 12.

We have deduced that every percent = 12 apples.

Multiply 12 by 100 (apples per percent x total percentage)

12 x 100 = 1200

Question
Segments AC and BD are diameters of circle Q.
a. Find the measure of arc AB
b. Find the measure of arc AD

Answers

Answer:

Arc AB = 80°

Arc AD= 100°

Step-by-step explanation:

Arc AB

Since AC is the diameter, it would be 180°, and since arc BC is given (100°), arc AB would be 80°

Arc AD

Since BD is a diameter, it would also be 180°. Arc ED is given and previously you found arc AB. So subtract 50 and 80 from 180 and you'll get 50° for arc AE. Add that with arc ED and you'll get 100°

Find an equation of the hyperbola with center at the origin that satisfies the given condition: A vertex at ( 0,-12) and a focus at (0,-13)

Answers

Answer:

c:

Step-by-step explanation:

Which is a factor of x^2-9x+14

Answers

Answer:

x =2 or x=7

Step-by-step explanation:

x^2-9x+14= 0

Now splitting the middle term we get,

x^2-7x -2x +14 =0

x(x-7) - 2(x-7) =0

(x-2) (x-7) =0

x-2=0 or x-7 =0

x =2 or x=7

The factors of [tex]x^2-9x+14[/tex] are (x - 7) and (x - 2)

What is an algebraic expression?

"It is a mathematical statement which consists of variables and constants, and some algebraic operations."

What is quadratic expression?"It is a polynomial expression with degree 2""The general form is [tex]ax^{2} +bx+c[/tex] where a, b, c are real values with [tex]a\neq 0[/tex] "

For given question,

We have been given a quadratic expression [tex]x^2-9x+14[/tex]

We need to factorize given quadratic expression.

[tex]\Rightarrow x^2-9x+14\\\\= x^2-7x-2x+14~~~~~~~~...........(-9x=-2x-7x~~and~14=(-9)\times (-2))\\\\=x(x-7)-2(x-7)\\\\=(x-7)(x-2) ~~~~~~~~~~~~............(Seperate~out~common~terms)[/tex]

Therefore, the factors of [tex]x^2-9x+14[/tex] are (x - 7) and (x - 2)

Learn more about the quadratic expression here:

https://brainly.com/question/14680354

#SPJ2

Plzzz help I have to turn this in by 3:30 pm

Answers

Answer:

1. 24      2. 12       3. it is a very easy concept

Step-by-step explanation:easy

It’s 5:50pm what’s up

How can you tell if a fraction is a perfect square?

Answers

Answers: A fraction is a perfect square if it's reduced version (of an improper fraction if the number is greater than 1) has both numerator and denominator numbers that are perfect squares. IE: 25/36 is a perfect square because both 25 and 36 are perfect squares.

Step-by-step explanation:

So for example 5/25 is a perfect square but 2/5 wouldn't be a perfect square.

Tell me if this helped you

If a fraction can be expressed as the product of two equal fractions, it may also be expressed in its simplest form as a perfect square.

What is a fraction?

Fraction number consists of two parts, one is the top of the fraction number which is called the numerator and the second is the bottom of the fraction number which is called the denominator.

A fraction is a perfect square if both the numerator and the denominator of its reduced version, which is an improper fraction if the integer is greater than 1, are perfect squares. To put it another way, 25/36 is a perfect square as 25 and 36 are both perfect squares.

Thus, if a fraction can be expressed as the product of two equal fractions, it may also be expressed in its simplest form as a perfect square.

Learn more about the fraction here:

brainly.com/question/1301963

#SPJ2

14 girls and 17 boys attend a party. 6 girls and 7 boys brought balloons. What is the probability of randomly choosing a girl or someone who did not bring a balloon

Answers

Answer:

[tex]\dfrac{24}{31}[/tex]

Step-by-step explanation:

Given information:

Total number of girls = 14

Total number of boys = 17

Total number of peoples = 14 + 17 = 31

6 girls and 7 boys brought balloons.

Let A and B are two events, such that

A = Choosing a girl

B = Choosing someone who did not bring a balloon.

[tex]A\cup B[/tex] = Choosing girl or someone who did not bring a balloon.

[tex]n(S)=31,n(A)=14,n(B)=18,n(A\cup B)=14+10=24[/tex]

The probability of randomly choosing a girl or someone who did not bring a balloon is

[tex]P=\dfrac{n(A\cup B)}{n(S)}[/tex]

[tex]P=\dfrac{24}{31}[/tex]

Therefore, the required probability is [tex]\dfrac{24}{31}[/tex].

The probability of randomly choosing a girl or someone who did not bring a balloon at a party is 24 out of 31, which simplifies to the fraction 24/31.

To solve this problem, we can use the concept of probability and the addition rule since the events are not mutually exclusive.

First, let's define the total number of people at the party: 14 girls + 17 boys = 31 people.

Next, we look at the number of girls who brought balloons, which is 6, meaning there are 14 - 6 = 8 girls who did not bring balloons.

Similarly, 17 boys - 7 boys who brought balloons = 10 boys who did not bring balloons.

Now, let's calculate the number of ways to choose a girl or someone who did not bring a balloon. For the girls, it's simply the total number of girls, 14. For those who did not bring balloons, we need to add the number of girls who did not bring balloons to the number of boys who did not bring balloons: 8 girls + 10 boys = 18 people who did not bring a balloon.

Combining these, the event of choosing a girl overlaps with the event of choosing someone who did not bring a balloon, so we have to subtract the number of girls who did not bring a balloon once to avoid double-counting: 14 + 18 - 8 = 24.

Thus, the probability is: 24 out of 31, which we can write as 24/31.

You want to go on a trip to Disney World with your friends. The trip costs $1450 and they have a special discount of 35% off. The tax rate for the package is 10%. What is the total price of the trip?

Answers

Answer: the total price of the trip is

$1087.5

Step-by-step explanation:

The trip costs $1450 and they have a special discount of 35% off. It means that the amount that would be taken off is

35/100 × 1450 = $507.5

The cost of the trip would be

1450 - 507.5 = $942.5

The tax rate for the package is 10%. It means that the amount of tax to be paid is

10/100 × 1450 = $145

Therefore, the total price of the trip would be

942.5 + 145 = $1087.5

6. Calculate Suppose Cory's
blood pressure is 125 at its
highest point. To return his
blood pressure to normal,
Cory must reduce it by what
percentage? (Show your
work.)

Answers

Answer:

Let's suppose that the ideal blood pressure is 100 (the ideal values are between 90 and 110, i am taking the middle value)

If 125 is the 100%, and we want to go to 100, then we need to decrease by:

125 - 100 = 25

now, to calculate the percentage that represents the 25, we need to calculate:

(25/125)*100% = 20%

So to reduce his blood pressure to normal, he must reduce it by 20%

Final answer:

To find out by what percentage Cory must reduce his blood pressure to normal, subtract the normal from Cory's blood pressure, divide the result by Cory's initial blood pressure, and then multiply by 100. For instance, if normal blood pressure is 120, Cory must reduce his blood pressure by approximately 4%.

Explanation:

To calculate the percentage that Cory needs to reduce his blood pressure, we first need to know the normal blood pressure level. For example, if the normal blood pressure is considered to be 120, then we can proceed as follows:

 First find the difference between Cory's actual blood pressure and the normal blood pressure. In this case, it would be 125 - 120 = 5.  Then, divide this difference by the initial (Cory's) blood pressure, which is 5 / 125 = 0.04.  Multiply the result by 100 to get it in percentage terms: 0.04 * 100 = 4%.

So, Cory would need to reduce his blood pressure by approximately 4% to return to a normal level, assuming normal blood pressure is 120.

Learn more about Percent Reduction here:

https://brainly.com/question/31667656

#SPJ3

Hal has three pieces of wood. Board A is 12 inches long, board B is 3 inches long, and board C is 7 inches long. If the full length of each board is used, can the three pieces of wood be placed together to form a triangle?

Answers

With a question this long you’d expect a big answer. But the answer is just no

The two angles shown are complementary angles.What is the value of x?

Answers

Answer:

complementary angles are angles that sum up to 90 degrees. that is all I can say because I can't see any diagram

Answer:

complementary angles are angles that sum up to 90°

i can't see any diagram

A raindrop was 24 meters above the ground, falling straight down at a constant velocity. It took the raindrop 3 seconds to fall half the distance to the ground. What was the raindrops velocity?

Answers

Answer:

4 m/s downwards

Step-by-step explanation:

Velocity is given by dividing the distance by time taken to cover the diatance. Therefore, expressed as v=d/t

The distance is given as 24 m but the time given covers only half the distance. Therefore, the distance is 0.5*21=12 m

Time taken is given as 3 s

Substituting 12 m for d and 3 s for t then

V=12/3= 4 m/s

Velocity must have direction component hence velocity is 4 m/s downwards

Find the center and radius of the circle with the equation:
(x - 3)2 + (1 - 1)2 - 10
center: (-3,-1)
au center ( 1)
radius: 4
radius: 4
center: (-3,-1)
d. center (
31)
radius: 16
radius 16
Please select the best answer from the choices provided
Pleaseeee help

Answers

Answer:

It’s 14

Step-by-step explanation:

Just add

The diameter of a circle is 101010 units. What is the radius of the circle?

Answers

Answer:

50505 units

Step-by-step explanation:

The radius is the fixed distance from the center of a circle to any point on its circumference. The radius of a circle always equals half of its diameter, so to find the diameter, multiply the radius by two. ( 101010/ 2=50, 505 units)

Taxicabs downtown charge a flat fee of $3.25, plus a state tax of $0.50, plus $0.50 for each 1/ 5 mile they travel with a passenger. Travis took a taxicab from his office to a meeting on the other side of town. The cab ride cost $14.75, which includes a $3.00 tip. In decimal form, how far is it from his office to the meeting?

Answers

Answer:

3.2 miles

Step-by-step explanation:

Initial fee plus state tax first because they are static:

3.25 + 0.5 = 3.75

Remove the initial charge plus tip from total cost:

14.75 - 3 - 3.75 = 8

Divide by 0.5 to get how many 1/5 of a mile he went:

8 / 0.5 = 16

Divide 16 by 5 to get miles:

16 / 5 = 3.2 miles

Answer:

3.2 miles

Step-by-step explanation:

Initial fee plus state tax first because they are static:

3.25 + 0.5 = 3.75

Remove the initial charge plus tip from total cost:

14.75 - 3 - 3.75 = 8

Divide by 0.5 to get how many 1/5 of a mile he went:

8 / 0.5 = 16

Divide 16 by 5 to get miles:

16 / 5 = 3.2 miles

Which expression is equivalent to (StartFraction (2 a Superscript negative 3 Baseline b Superscript 4 Baseline) squared Over (3 a Superscript 5 Baseline b) Superscript negative 2 Baseline EndFraction) Superscript negative 1?

Answers

Answer: C is the correct answer!!!! I got it correct! Trust me!!!!!

The expression equivalent to the given expression is [tex]\left[\dfrac{1}{(36a^{4}b^{10})}\right][/tex] and this can be determined by using the arithmetic operations.

Given :

Expression  ---   [tex]\left[\dfrac{(2a^{-3}b^4)^{2}}{(3a^5b)^{-2}}\right]^{-1}[/tex]

The following steps can be used in order to evaluate the given expression:

Step 1 - The arithmetic operations can be used in order to evaluate the given expression.

Step 2 - Write the given expression.

[tex]\left[\dfrac{(2a^{-3}b^4)^{2}}{(3a^5b)^{-2}}\right]^{-1}[/tex]

Step 3 - Simplify the above expression.

[tex]\left[\dfrac{1}{(3a^5b)^{2}(2a^{-3}b^4)^{2}}\right][/tex]

Step 4 - Open the brackets and square the given terms in the denominator.

[tex]\left[\dfrac{1}{(9a^{10}b^2)\times (4a^{-6}b^8)}\right][/tex]

Step 5 - Multiply the terms present in the denominator.

[tex]\left[\dfrac{1}{(36a^{4}b^{10})}\right][/tex]

Therefore, the correct option is C).

For more information, refer to the link given below:

https://brainly.com/question/25834626

Two of the steps in the derivation of the quadratic formula are shown below.

Step 6: StartFraction b squared minus 4 a c Over 4 a squared EndFraction = (x + StartFraction b Over 2 a EndFraction) squared

Step 7: StartFraction plus or minus StartRoot b squared minus 4 a c EndRoot Over 1 a EndFraction = x + StartFraction b Over 2 a EndFraction

Which operation is performed in the derivation of the quadratic formula moving from Step 6 to Step 7?

subtracting StartFraction b Over 2 a EndFraction from both sides of the equation
squaring both sides of the equation
taking the square root of both sides of the equation
taking the square root of the discriminant
GIVING 20PTS. TO WHOEVER HELPS ALONG WITH 5 STARS

Answers

Answer:

C

Step-by-step explanation:

I just guessed and got it right

Answer:

C. taking the square root of both sides of the equation

what is Value of Gummy Bear,Value of Lollipop,Value of Lime Gummy,Value of Ring Pop,Value of the Question Mark

Answers

Gummy Bear = 16

Lollipop = 16

Lime = 0

Ring pop = 4

Question mark (total) = 36

A car moves at a constant speed of 50 miles per hour. How long does it take the car to go 200 miles?

Answers

Answer: 4 hours

Step-by-step explanation: If you take 50 times 4 it will get you 200. Another way to look at it is the car is going 50 miles per hour, so in one hour the car has gone 50 miles, in two hours it’s gone 100, three hours it’s gone 150, so in four hours it’s gone 200 miles

Final answer:

To calculate how long it takes to travel 200 miles at a constant speed of 50 miles per hour, divide the distance by the speed. The car will take 4 hours to cover the distance.

Explanation:

To determine how long it takes a car moving at a constant speed to cover a certain distance, we use the formula time = distance \/ speed. In this case, the car is moving at a constant speed of 50 miles per hour and needs to cover a distance of 200 miles.

We can calculate the time it will take as follows:

Time = Distance \/ Speed
Time = 200 miles \/ 50 miles per hour
Time = 4 hours

Therefore, it will take the car 4 hours to travel 200 miles at a constant speed of 50 miles per hour.

Don has an album that holds 900 hockey cards. Each page of the album holds 9 hockey cards. If 68​% of the album is​ empty, how many pages are filled with hockey cards​?

Answers

Since there are 9 hockey cards per page and it holds 900 hockey cards you can multiply 9 by 68 to get the total of 612 hockey cards. Then take 900 and subtract 612 from it and you should get 288 hockey cards in the album. Then divide that number by 9 to get the total number of pages filled 288/9=32 pages filled

Answer:

The answer is 288 pages are filled with hockey cards

Step-by-step explanation:

First, you need to figure out what percentage of the album is full which is 32% So, with that 32% you figure out how many pages that is. So you would find 32% of 900 which is 288 therefor, that would be your answer.

I hope this helped <3

Katarina bought a package of 500 stickers. Each sheet in the package has 20 stickers.
25% of the stickers on each sheet are hearts. The remaining stickers are stars.

Answers

The correct options are: B and D.  The true statements about stickers are: Katarina has 375 star stickers and 75% of the stickers are stars.

Let's analyze each statement given the information that 25% of the 500 stickers are hearts, and the remaining stickers are stars.

1. Total number of stickers: 500

2. Percentage of heart stickers: 25%

3. Percentage of star stickers: 100% - 25% = 75%

Now, let's calculate the actual numbers:

- Number of heart stickers:

[tex]\[ 25\% \text{ of } 500 = \frac{25}{100} \times 500 = 0.25 \times 500 = 125 \][/tex]

- Number of star stickers:

[tex]\[ 75\% \text{ of } 500 = \frac{75}{100} \times 500 = 0.75 \times 500 = 375 \][/tex]

Now, let's evaluate each statement:

A. Katarina has 100 heart stickers.

- False. Katarina has 125 heart stickers.

B. Katarina has 375 star stickers.

- True. Katarina has 375 star stickers.

C. The package contains 20 sheets of stickers.

- Not enough information is given to determine this. This statement is irrelevant without knowing how many stickers are on each sheet.

D. 75% of the stickers are stars.

- True. 75% of 500 stickers are stars.

E. The number of heart stickers is the same as the number of star stickers.

- False. The number of heart stickers (125) is not the same as the number of star stickers (375).

So, the true statements are:

B. Katarina has 375 star stickers.

D. 75% of the stickers are stars.

The complete question is:

Katarina bought a package of 500 stickers. 25% of the stickers are hearts. The remaining stickers are stars. Select all the statements that are true.

A.Katarina has 100 heart stickers.

B.Katarina has 375 star stickers.

C.The package contains 20 sheets of stickers

D.75% of the stickers are stars.

E.The number of heart stickers is the same as the number of star stickers.

Can someone explain what you do here!! Kind of low on time!!

Answers

Answer:

a:

[tex]sin(\theta)=\frac{opposite}{hypotenus}[/tex]

[tex]sin(60)= \frac{a}{4\sqrt3}[/tex]

[tex](4\sqrt3)sin(60)= a[/tex]

[tex](4\sqrt3)(\frac{\sqrt3}{2})= a[/tex]

[tex]6= a[/tex]

b:

the answer choices all have the same value for b, so I dont have to solve for b at all.

[tex]b=6\sqrt2[/tex]

c:

[tex]cos(\theta)=\frac{adjacent}{hypotenus}[/tex]

[tex]cos(60)= \frac{c}{4\sqrt3}[/tex]

[tex](4\sqrt3)cos(60)= c[/tex]

[tex](4\sqrt3)(1/2)= c[/tex]

[tex]2\sqrt3= c[/tex]

d:

d is inside a 45-45-90 triangle. Therefore, side a and d must be of the same length.

[tex]d=a[/tex]

[tex]d=6[/tex]

Triangle A B C is shown. Angle A C B is a right angle. The length of the hypotenuse is 20.

What additional information would be necessary to determine sin(A) without using the Pythagorean theorem? Explain.


The length of AC is needed because it is the side adjacent to ∠A.

The length of AC is needed because it is the side opposite ∠A.

The length of BC is needed because it is the side opposite ∠A.

The length of BC is needed because it is the side adjacent to ∠A.

Answers

Answer:

The length of BC is needed because it is the side opposite ∠A.

Step-by-step explanation:

Given the right angles triangle as shown in the attachment, we can get sin(A) without using Pythagoras theorem. Instead we will use SOH CAH TOA trigonometry identity.

According to SOH:

Sin(A) = Opposite/Hypotenuse

Sin(A) = |BC|/|AB|

Opposite side of the triangle is the  side facing ∠A.

Based on the formula, we will need to get the opposite side of the triangle which is length BC for us to be able to determine sinA since the hypotenuse is given.

Answer:

Bc is needed because it is opposite of A

Step-by-step explanation:

You are solving 5 – 83 = y3. Which equation will you get if you multiply both sides by 3?

Answers

Answer:

15 - 3(8³) = 3y³

Step-by-step explanation:

5 – 8³ = y³

3(5 - 8³) = 3(y³)

15 - 3(8³) = 3y³

Answer:

15-8=y

Step-by-step explanation:

0.0025 as a square root

Answers

Answer:

Accoridng to your question we have to find the square root of 0.0025

However students face some problem in finding square roots of number in decimal but it is too easy to find .

√0.0025

0.05 is the square root of 0.0025

after decimal there are two zero and by square root there will be one zero and 25 is the square root of 5 .

so thus we find the square root amd the correct answer is 0.05

Final answer:

The square root of 0.0025 is 0.05, which follows the rule that the square root of a decimal results in half the number of decimal places in the square root, compared to the original number.

Explanation:

The student has asked to find the square root of 0.0025. When expressed as a square root, the number 0.0025 is equal to 0.05 because (0.05 * 0.05 = 0.0025). This can be understood by recognizing that the decimal places need to be managed correctly when finding the square root of a decimal. For instance, the square root of 25 is 5, and since 0.0025 has four decimal places, the square root will have half as many decimal places, resulting in 0.05. This concept is further emphasized by using fractional powers, such as re-expressing a number squared (x²) as the square root ( √x ), where x to the power of 2 is the same as x to the power of 1/2.

(AKS 16/17): You have earned $200 doing chores around the house. How long will it
take to triple your money if you keep it in an account earning 4.25% compounded
continuously? Use the formula:

Answers

Answer:

It will take 26 years

Step-by-step explanation:

In this question, we are tasked with calculating the time it will take for an amount of money earned to be tripled if compounded continuously.

To calculate this amount of time, we are going to use the formula for compound interest.  Mathematically, for an interest compounded, the amount is as follows;

[tex]A = P(1 + r/n)^{nt}[/tex]

Where;

A is the amount at the end of compounding; which is 3 times the original amount = 3 × $200 = $600

P is the initial amount = $200

r is the rate of compounding = 4.25% = 4.25/100 = 0.0425

n is the number of times in which the amount is compounded annually, we take this as 1

t is the time taken to reach the amount

We substitute these values in the equation;

600 = 200(1 + 0.0425/1)^t

Divide through by 200

3 = (1.0425)^t

Take the logarithm of both sides

log 3 = log(1.0425)^t

log 3 = tlog 1.0425

t = log 3/log1.0425

t = 26.4 which is approximately 26 years

A ratio of the number of items within a defined unit of area measures

Answers

Answer:

Density

Step-by-step explanation:

Density is the number of items per unit area. It is gotten by dividing the number of items by the area it occupies. It measures the compactness of an item in a given area. The higher the density, the more compact items are per unit area and the lesser the density, the less compact items are per unit area. It is measured in items/m²

09 CP
Write an algebraic expression for the phrase.
-2 times the quantity q minus 3
A.-2(9-3)
B.-29 - 3
C. 9-3
D. 90-2 - 3)

Answers

Answer:

the answer should be as follows:

-2(q-3)

the closest answer would be A

100 POINTS if it is wrong i will delete your answer! Calculating Monthly Expenses

The second step to building a family budget is to outline your expenses in greater detail, itemizing fixed and variable expenses.

Suppose the table below shows your family’s monthly expenses by category.

Expense Fixed or Variable Expense? Average Monthly Cost Yearly Cost Percent of Yearly Budget (Rounded)

Income Tax Fixed $400 $4,800 "$4,800" /"$48,900" " = 9.8%"

Housing $950

Food $7,800

Clothing Variable $75

Transportation Fixed $6,000

Insurance & Medical $1,200

Entertainment $100 $1,200

Emergency Fund Fixed $50

Savings for College Fixed $600

Savings for Retirement $100 $1,200

Total $4,075 $48,900 100%


Fixed expenses are expenses that do not change from month to month, and variable expenses are expenses that can fluctuate from month to month. Complete the second column of the chart by determining if each expense is fixed or variable. (10 points – 2 points each)


Choose an example of a fixed expense and an example of a variable expense, and explain why they are classified that way. (4 points)

Answers

Answers:

Across->

Housing: Fixed, $950, $11,400, ?

Food: Variable, $650, $7,800,?

Clothing: Variable, $75, $900,?

Transportation: Fixed, $500, $6,000,?

Insurance&medical: Variable, $1,200, $14,400,?

Entertainment: Variable, $100, $1,200,?

Emergency fund: Fixed, $50, $600,?

Saving for C: Fixed, $50, $600,?

Saving for R: Fixed, $100, $1,200,?

Step-by-step explanation:If it is the cost monthly you are looking for, divide the yearly cost by 12. If you are looking for yearly cost, multiply the monthly cost by 12.

And if you would like to know what a variable and fixed expense is, the variable expense is the expense that can change, so say for instance, food isn’t gonna cost at two different places, so it’s variable. A fixed expense is an expense that is regularly paid and always the same cost.

Answer:

Housing: Fixed, $950, $11,400, 23.3%

Food: Variable, $650, $7,800, 16%

Clothing: Variable, $75, $900, 1.8%

Transportation: Fixed, $500, $6,000, 12.3%

Insurance&medical: Variable, $1,200, $14,400, 29.5%

Entertainment: Variable, $100, $1,200, 2.5%

Emergency fund: Fixed, $50, $600, 1.2%

Saving for C: Fixed, $50, $600, 1.2%

Saving for R: Fixed, $100, $1,200, 2.5%

Step-by-step explanation: Added correct percentages...

Other Questions
40% of OatyPop cereal boxes contain a prize. Hannahplans to keep buying cereal until she gets a prize. What isthe probability that Hannah only has to buy 3 or lessboxes before getting a prize?We need to design a simulation. Which random device can we use to BESTrepresent this situation?Use a double-sided coin andassign heads as the prize andtails as no prize.Use a number cube with thenumbers 1 through 6 and assign1 through 2 as the prize and 3through 6 as no prize.Use a random number generatorranging from 1 to 10 and assign1 through 4 as the prize and 5through 10 as no prize.Use a deck of cards and assignspades as the prize and allother suits as no prize. There are three groups that contain carbon but are not organic compounds:carbon chlorides carbon oxides carbon iodides carbides carbonates When should you use the median and interquartile range as your measure of center and measure of variability tocompare populations shown on a box plot? Check all that applywhen there are outliers in the data setswhen there are no big gaps in the middle of the data setswhen the plots representing the data are symmetricalwhen the plots representing the data are nonsymmetricalwhen there are no outliers in the data setIntroDone To assist with a class demonstration, a student (whose mass is 60 kg) filled a water balloon with 2 kg of water. He then climbed to the second floor (10 metres) of the school and held the balloon out of a window. How much work did the student do? What is it called when plants give off water vapor as a waste product? Jason is entering a weight lifting contest. Gurrently, his maximum bench press weight is 105 pounds. If he increases the weight by 7 pounds each week, What is the maximum weight he be able to bench press after 13 weeks? Which statement best summarizes the central idea of thisexcerpt?DOUO One must know the process of hiring servants.0 It is important to always honor one's servants.O It is necessary to choose trustworthy servants.O The intelligence of servants must be considered.herofich 1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes. if tan 0= -3/8 which expression is equivalent to cot0? A fairground ride spins its occupants inside a flying saucer-shaped container. If the horizontal circular path the riders follow has a 6.75 m radius, at how many revolutions per minute are the riders subjected to a centripetal acceleration equal to that of gravity What should you expect to happen if you participate in a poetry workshop? Gothic archtiture rarely used on the outstide of cathedrals and churhes. true or false Theo's Survey ResultsEye ColorBrown BlueBoy2525GenderGirl2525Theo recorded the gender and eye color of students walking in the hallway at his middle school. What is theexperimental probability in simplest form that the next student he sees will be a boy with brown eyes?