What are two of the federal laws passed by the government in the early 1970’s that deal with protecting our environment?

Answers

Answer 1

Answer:

The Clean Air Act, The Endangered

Explanation:

The Clean Air Act : It was although introduced by president Johnson in mid 1960s, but got important amendments in 1970s. It undertook many steps to control air pollution. One most important provision of 1970s version was elimination of lead based gasoline.

The Endangered Species : It was an important act regarding preservation of endangered (on the verge of extinction) species. It was passed by President Richard Nixon in early 1970s. The law had been successfully implemented, as no specie had gone extinct after getting in the act's list.


Related Questions

Terance "the tower" Thomas weighed himself three times this morning. At 7:00 a.m. "the tower" weighed 295 pounds, at 7:02 he weighed 200 pounds, and finally at 7:04 he weighed 499 pounds. The scale "the tower" is using has issues of: A) reliability. B) triangulation. C) conceptualization. D) induction.

Answers

Answer:

A. reliability

Explanation:

Answer:

D) induction.

Explanation:

The measurement is not static as the scale goes from up to down.

Amelia loves to meet friends after work for drinks because she considers this a time to relax. Yuri thinks that she is lazy by taking the time off, and that drinking that early in the evening is unhealthy. George Kelly would propose that these discrepancies reflect a difference between Yuri's and Amelia's _____.

Answers

Answer:

The correct answer is : Personal constructs

Explanation:

This theory says that people employ unique, organized systems of bipolar personal constructs,  and sees people as attempting to anticipate their worlds and they use their constructs to make sense of their observations and experiences which is different for everyone.

When reading text and answering associated questions, in which format should your answers appear?
a. Paragraph
C. Story
b. Outline
d. Copied
Please select the best answer from the choices provided
O o oo

Answers

A paragraph would show my answers to explain

Answer:

Story is the right answer did it on edge.

Explanation:

Hope it helps

Tyrel is testing whether exposure to political news causes people to be more opinionated. For each participant, Tyrel flips a coin and places all the heads in one group and all the tails in another. The heads group watches 20 minutes of political news, while the tails group watches 20 minutes of local nonpolitical news. Afterward, all participants write a persuasive essay and Tyrel measures how strongly and how many times they state their opinions.

Answers

Answer:

Explanation:

Tyrel is testing whether exposure to political news causes people to be more opinionated. For each participant, Tyrel flips a coin and places all the heads in one group and all the tails in another. The heads group watches 20 minutes of political news, while the tails group watches 20 minutes of local nonpolitical news. Afterward, all participants write a persuasive essay and Tyrel measures how strongly and how many times they state their opinions.Tyrel would make use of either random assignment  random assignment  or posttest-only design in this study, these design gives same opportunity to be assigned and equal chance to the participant of the test .

According to Alderfer's ERG theory, A : needs are related to each other in a stair-step fashion. B : Adler's growth needs match up with Maslow's lower-order needs. C : satisfied lower-level needs can become reactivated when a higher level need cannot be satisfied. D : existence needs are the highest level needs.

Answers

Answer:

C : satisfied lower-level needs can become reactivated when a higher level need cannot be satisfied.

Explanation:

According to Alderfer's ERG theory an already satisfied lower-level needs can become reactivated when a higher level need cannot be satisfied.

1) In the image above, what group or groups is the KKK threatening?
2) According to Tourgee, what types of people are being attacked by the KKK? Why would the KKK want to attack those people?
3)How does the way John Stephens was killed support the idea that the KKK was a terrorist organization?
4) What is the author, Tourgee, worried about now that John Stephens is dead now? Why is he suspicious of the this?

Answers

Answer:

In the image above we can see that the KKK is threatening people who think differently from them. According to Tourgee, the KKK is threatening Republican citizens. These threats are happening, because they account for differences of opinion and the Republicans' attempt to not allow the KKK to do any activity.Stephens was torturously and slowly killed in front of KKK members. This torture supports the idea that the KKK is a terrorist organization. Tourgee is concerned that he is the next victim, because he knows that he has been pursued for months.

Explanation:

All of the above questions were answered based on the supporting text provided.

This text shows a man's lament to inform the KKK atrocities and all the evil that this organization has established for those who do not follow its concepts. In addition, the author is concerned with being the next KKK victim and reinforces the need to establish guidelines to limit and even end any and all KKK activities.

In the image above KKK is threatening people who think differently from them.

According to Tourgee, KKK is threatening Republican citizens. The threats is because they account for differences of opinion and the Republicans' attempt to not allow the KKK to do any activity.

Stephens was torturously and slowly killed in front of KKK members. This torture supports the idea that the KKK is a terrorist organization.

Tourgee is concerned that he is the next victim, because he knows that he has been pursued for months.

How to answer comprehensions?

Here's a gradual guide to answering comprehensions efficiently:

Skim the questions first: Before diving into the passage, take a active glance at the questions to receive a sense of what you'll be looking for. This will help you focus your translation and identify appropriate information more capably.Read the passage cautiously: Once you have a general understanding of the questions, state the passage utterly and attentively. Pay attention to analyses, identify indispensable content, and understand the overall intention and purpose of the text.Re-read the questions: After ending the initial lesson, go back to the questions and state them cautiously again. This time, maintain the passage in mind and try to expect the answers based on your understanding of the content.Answer the questions one at a time: Take each question one at a time and devote effort to something providing a clear and accurate reaction. Support your answers with evidence from the enactment, and avoid making acceptances or guessing.

Learn more about comprehensions here: https://brainly.com/question/24716030

#SPJ3

Need help All of the following statements about the Declaration of Independence are TRUE except:
A.
It was called "an expression of the American mind."
B.
It was a document in which the colonists declared their freedom from Britain.
C.
It divided power between the legislative, executive, and judicial branches of the government.
D.
It stated that people have the right to overthrow their government when their basic rights are being violated.

Answers

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Christine went to jail because she was part of a demonstration/protest to stop an international arms conference. Christine believes that international arms dealing is a major cause of worldwide human suffering. Kohlberg would say that Christine is at the _____ level of moral development.

Answers

Answer:

post conventonal

Explanation:

Lawrence Kohlberg was an American psychologist which was best known for his theory of stages on moral development. He was a professor in the Psychology Department at the University of Chicago and at the Graduate School of Education at Harvard University.

ethical motive, a concept which came up  largely by psychologist Lawrence Kohlberg,that  identifies the ethical reasoning of moral actors who make decisions based on rights, values, duties, or principles that are (or could be) universalizable.

Cerberus is
a.
a beast cruel and monstrous.
c.
a man with a big belly.
b.
a dog that barks.
d.
a beast with two throats.

please help

Answers

Answer: a beast cruel and monstrous.

Explanation: Cerberus is a giant three-headed dog who guards the entrance to hades to prevent the dead from leaving. It is one of the offspring of Echidna and Typhon. It has three heads and a snake like tail. From the given options, the option that best describes Cerberus is a beast cruel and monstrous. This assumptions are made based on it's physical characteristics and function.

Answer:

a. a beast cruel and monstrous.

Explanation:

This is the description that would best fit Cerberus. Cerberus is a multi-headed monster that guards the Underworld according to Greek mythology. Cerberus is first described in Hesiod's Theogony, although he continued to appear in various Greek, Roman and Byzantine sources. Cerberus is particularly well-known because his capture was one of Heracles's twelve labors.

Who discovered that the amount of conformity (decreased/increased) if the participants were allowed to submit their answers privately in writing instead of sharing them aloud with the group which showed that the participants did in fact know the correct answer?

Answers

Answer:

Solomon Asch

Explanation:

In Solomon Asch's classic obedience experiment, The rate of conformity is decreased,if the participants were allowed to submit their answers privately in writing instead of sharing them aloud with the group

Because at a point in the trails, most participants at least occasionally gave the same wrong answer ,this pattern shows clearly that the participants knew that this answer is incorrect. so,if the participants were allowed to submit their answers privately in writing instead of sharing them aloud with the group,rate of conformity will greatly reduced.

Answer:

Solomon Asch

Explanation:

Solomon Asch did an experiment to probe the range to which pressure from a majority group  can affect an individual conform.

He had the believe that the main issue  with Sherif's experiment of conformity no correct answer was found of  the ambiguous autokinetic experiment.  He asked the question how could we be sure that a person conformed when there was no right answer.

In 1951 Asch discovers a means what is was known as a classic experiment in social psychology, to a line judgment task. there will be an obvious or correct answer.

There were several experiments conducted by researchers to evaluate children's susceptibility to suggestive questioning. Even though these studies show a significant proportion of children changing their accounts in response to misleading questions, these studies probably still underestimate the children's tendency to agree with misleading questions. Here are the reasons for such underestimation, except: _____________.A) The questioning techniques in real cases were much more forceful than in experiments. B) In real cases, children were questioned multiple times by different interviewers. C) The information obtained by interviewers in real cases was shared with parents who also questioned their children.D) Children in the experiments were much older than children in the day care center cases.

Answers

Answer:

In real cases, children were questioned multiple times by different interviewers.

Explanation:

Because they were questioned multiple times they were susceptible to it

Answer: D. ) Children in the experiments were much older than children in the day care center cases.

Explanation: There are varying contrast in the techniques adopted in the research or experimental study and the real cases which allowed the outcome of the experiment to differ substantially from real world scenario. Even though the participant involved in the study belong to the same age bracket as those used in the experiment, bias introduced due to forceful and repeated questioning and disclosing questions to parents ensured that children in the real cases were more likely to disagree with misleading questions than in the experimental research.

Rebekah was hired soon after graduation and assigned to complete a management trainee program. She will move to various jobs each month for a nine-month period of time. Her employer is utilizing the ________ form of training.

Answers

Answer:

The answer is job rotation

Explanation:

Some employers use job rotation as a training method for their employees, so workers can be flexible and versatile in their performance.

Companies currently use job rotation, bearing in mind that one of the benefits of job rotation is that the employee can learn from each area of the company and this helps to feel greater belonging and responsibility.

For example, in the case of Rebekah, her employer uses job rotation at different companies as a way of training for her, in this way Rebekah will learn about the functions of each company and can consider herself a versatile person.

I hope this information can help you.

Which systems advocates that the suffering of the worker should be made lighter through intervention by the government?

Answers

Answer:

Socialism    

Explanation:

Socialism advocates that the suffering of the worker should be made lighter through intervention by the government.

Socialism is a type of economy whereby the factors of production are owned and controlled by the government. In socialist systems, the government controls and intervenes in economic issues. Countries that practice socialism are Cuba and North Korea.

2. The Hershey's Kiss is made from raw materials from different parts of the world. It is also distributed to people all over the world. Explain why global trade occurs.

Answers

Answer: The answers are provided below.

Explanation:

Global trade also known as international trade is the exchange of goods, and services across the international borders. Global trade represents an important share of the gross domestic product of an economy.

Global trade between countries lead to increase in a country's living standards, by providing employment opportunities and enabling consumers enjoy a greater variety of goods.

Furthermore, global trade increases competition and also lowers world prices, thereby providing benefits to consumers as a result of the increase in the purchasing power of their income.

What is the difference between Unruly Act and the Delinquent Act?​

Answers

Answer:

The difference is that delinquent behavior/ act is being guilty of minor charges in criminal offense. The consequences of delinquent behavior is they can get jail time. Unruly behavior is being disobedient or disorderly towards authority of law.

Hope this helped, love! You have a wonderful day!♥♥

Answer:

C. a delinquent act would be a criminal offense if committed by an adult.

Explanation:

It's C on edge luv just trust me

How have attitudes toward space colonization changed over time?

Answers

Answer:

A  lot

Explanation:

Since scientist think that Earth is quickly dying, they want to try and colonize Mars, because that's the most livable planet.

Final answer:

Space colonization attitudes have shifted from idealistic enthusiasm to pragmatic caution, focusing more on Earth's sustainability than immediate extraterrestrial settlement due to high costs and environmental concerns.

Explanation:Attitudes Toward Space Colonization

Attitudes toward space colonization have evolved significantly over time. The early excitement spurred by space exploration and the successful moon landings of the Apollo missions contributed to an optimistic belief in humanity's destiny in space. However, with the recognition of the enormous challenges and costs associated with space travel and colonization, and the finite resources of our home planet, a more pragmatic view has emerged. The romanticized notion of space as the next frontier has faced scrutiny under the harsh realities of costs, technological hurdles, and the inefficiency of colonizing space as a solution to Earth's problems.

In the context of current global challenges, the focus has shifted toward ensuring the sustainability of Earth, relegating space colonization to a long-term possibility rather than an immediate goal. Works of entertainment often depict colonization as an inevitable future, but these narratives contrast sharply with the harsh practical and economic realities of such endeavors. Issues such as the limitations of current spaceflight capabilities, the slow rate of potential population transfer to extraterrestrial colonies, and the necessity to manage Earth's resources wisely have prompted many to re-evaluate earlier assumptions about living off-planet.

The prospect of space colonization has oscillated between a captivating adventure and a distracting fantasy. For our immediate future, most experts recommend focusing on pressing environmental and societal challenges on Earth, with the idea that only by solving these issues can we ever hope to expand into space. Historical exploration does not always lead to settlement, and our fascination with space, while still strong, is now balanced with more grounded perspectives on humanity's place in the cosmos.

Learn more about Space Colonization here:

https://brainly.com/question/41488572

#SPJ2

According to Fodor, in the functionalist view the psychology of a system depends not on the stuff it is made of but on _____. A. what psychologists say about the stuff B. what kind of stuff it is C. how the stuff is put together D. how the stuff relates to modern physics

Answers

Explanation:

According to fodor in the functionalist view the psychology of a system dependents not on the stuff it is made of but on B

The correct answer is letter C

Functional psychologists define psychology as a biological science interested in studying psychic (mental) processes, operations and acts as forms of adaptive interaction. They start from the assumption of evolutionary biology, according to which living beings survive if they have the appropriate organic and behavioral characteristics to adapt to the environment.

They consider mental operations and processes (such as the ability to feel, think, decide, etc.) to be the true object of psychology, and the study of that object requires a variety of methods. They do not exclude self-observation, although they do not approve experimental introspection in the Titchenerian style, because it would be very artificial. They do not rely entirely on self-observation, given their scientific difficulties: it is impossible to check publicly whether a self-observation has been done well and, therefore, it is difficult to reach an agreement based on such observations.

The state of Texas has a unique and varied racial and ethnic history. Today, nearly half of all Texans are either Latino or African American. The remaining population is made up of non-Hispanic whites (generally referred to as Anglos Correct ), Asian Americans, Native Americans, biracial residents, and others. Formerly part of Mexico, Texas has Latino roots that run deep, and the majority of Latinos in Texas are Mexican in origin. African Americans were first brought to the state as slaves but later arrived independently as freedmen. However, laws requiringracial segregation Correct resulted in divided communities. Historically, minority groups in the state suffered tremendous discrimination, and many continue to lag in terms of income, education, and overall health.

Answers

Final answer:

Texas has a complex racial and ethnic history with Hispanic and African American populations playing significant roles in the state's development. Currently, Hispanic Texans make up a large portion of the state's population, and Texas is considered a majority minority state due to its diverse demographics.

Explanation:Texas Demographics and Ethnic History

The state of Texas has a complex and influential racial and ethnic history, reflecting a diverse population that contributes to its identity. Hispanic Texans are a significant part of the state's demographic, with Mexican origin being the majority within this group. Post the Mexican rule, they became Mexican Americans and have since played an integral role in Texas's development. Meanwhile, African American Texans have been present since the Spanish Colonial Era, although their population increased substantially during the period of enslavement. Post-emancipation, they faced harsh segregation laws but despite this, they have remained a vital part of Texas's fabric. As Texas continues to evolve, it is expected that Hispanics will become the largest population group, largely due to births outnumbering those of non-Hispanic whites.

English and German Americans are also present in Texas, with each group settling in different regions of the state. This varied immigration and settlement pattern has made Texas into one of the most ethnically diverse states in the United States, with no single racial or ethnic majority—a phenomenon known as a majority minority state.

___________ is described as a software issue where systems are required to operate as distributed systems across networks that include different computing devices such as mobile phones, tablets, general computing devices, etc. Group of answer choices

Answers

Answer:

Heterogeneity

Explanation:

Heterogeneity is described as a software issue where systems are required to operate as distributed systems across networks that include different computing devices such as mobile phones, tablets, general computing devices,

Answer:

Wireless Hotspot Internet services

Explanation:


Many students in Ms. Janklow's class seem to have little intrinsic motivation for learning math, science, or social studies. Their minds are more apt to be on peer relationships (who the "popular kids" are, who bullies whom on the playground, etc.) than on their studies. Without knowing anything else about Ms. Janklow's students, your best guess would be that they are:

A. kindergartners.
B. second graders.
C. fourth graders.
D. seventh graders.

Answers

The answer is either A or B

Without knowing anything else about Ms. Janklow's students, your best guess would be that they are second graders. The right answer is B.

Based on the description provided, the behavior of the students in Ms. Janklow's class, such as being more focused on peer relationships and playground interactions rather than their studies, is more typical of children in the early elementary grades.

Second graders are around 7-8 years old, and at this age, social interactions and peer relationships often play a significant role in their daily lives, which may impact their intrinsic motivation for academic subjects like math, science, or social studies. Second graders are at an age where social dynamics and peer interactions start to gain prominence, and they may prioritize these aspects over their studies, leading to reduced intrinsic motivation for academic subjects.

The correct answer is option B.

Know more about peer relationships here

https://brainly.com/question/15543881

#SPJ2

Select the correct location on the map.
Locate the area through which goods from East Asia, such as wool, linen, wood, spices, and silk, came to Rome.

Answers

Goods from East Asia, including wool, linen, wood, spices, and silk, reached Rome through a vast trade network known as the Silk Road, involving both land and sea routes that connected the Roman Empire with the East.

The area through which goods from East Asia, including valuable commodities like wool, linen, wood, spices, and silk, were transported to reach Rome primarily consisted of a vast network of trade routes and regions. One of the most famous of these routes was the Silk Road, which connected the East and West. The Silk Road comprised land and sea routes, facilitating the exchange of goods, culture, and ideas.

The land routes of the Silk Road spanned across Central Asia, the Middle East, and eventually reached the Roman Empire. They passed through regions such as Persia, Mesopotamia, and Anatolia. The sea routes, on the other hand, navigated the Indian Ocean and the Mediterranean Sea, connecting ports in India, Southeast Asia, and the Red Sea with the Roman ports like Alexandria.

These interconnected trade routes and regions formed a complex web of commerce, fostering cultural exchanges and contributing to the economic prosperity of Rome, allowing it to enjoy the luxuries and resources of East Asia, including textiles, spices, and exotic woods.

For more such questions on  Silk Road

https://brainly.com/question/1818236

#SPJ3

What's a difference between a state and a colony?

Answers

Answer:

Where they differ from one another is that a colony is ultimately administrated from the mother country it belongs to, and thus has no say in its governance, whereas in a state they have strong political representation within a nation. ... The United States in the past also maintained several Colonies around the world.

Final answer:

In American history, colonies were established by European powers for resource exploitation, while states emerged after the American colonies transitioned to independent republics with elected legislatures and local autonomy.

Explanation:

In the context of American history, a difference between a state and a colony is the form of government and the level of independence.

Colonies were established by European powers in the 16th and 17th centuries for resource exploitation and did not typically have large numbers of Europeans relocating permanently. The relationship between the home country and colonies was primarily one of exploitation.

On the other hand, states emerged after the American colonies transitioned to independent republics or states in the late 18th century. The residents overthrew royal authority and established provincial congresses to fill the void. States aimed to create lasting governments that would promote order and independence, with elected legislatures and local autonomy.

Learn more about difference between a state and a colony:

https://brainly.com/question/15754078

#SPJ2

phi delta theta Now that you've answered why sound learning is important to you, think about why your sound learning and your brothers' sound learning is important to the Fraternity. Why is scholarship important to the fraternity

Answers

Answer:

Scholarship important to the fraternity because they believe that their primary aim of attending college is purposely for studying and learning. this was the idea their founders had in mind. This helps them to make sure the chapter is able to influence the campus community positively.

Explanation:

Phi Delta theta is also known as Phi Delt. It is an international social fraternity established in 1848 by six students during their undergraduate studies at the Miami University, it as its headquarters in Oxford University. This fraternity comprises of 185 active chapters and colonies within over 43 states in the United States and 5 in the Canadian provinces.

This fraternity with Beta Theta pi and Sigma Chi forms Miami Triad.

Scholarship is crucial for fraternities as it signifies academic dedication, attracts like-minded individuals, and opens up opportunities for members.

It enhances the reputation of the fraternity and contributes to the overall development of its members.

By prioritizing scholarship, a fraternity can attract dedicated and driven individuals who value education, creating a community of like-minded peers focused on achieving academic success.

Furthermore, maintaining high academic standards can open up opportunities for members, such as scholarships, academic recognition, and future career prospects.

The American Competiveness in the 21 st Century Act:
a. prohibits U.S. employers from terminating U.S. workers after hiring immigrants as employees.
b. prohibits U.S. employers from hiring immigrants as employers.
c. allows U.S. employers to terminate U.S. employees and hire immigrant employees if necessary to remain competitive.
d. none of the above

Answers

Answer:

d. none of the above

Explanation:

The American Competitiveness in the 21st Century Act (AC21) was passed into law in October 2000 by the government of the U.S and concerns immigration to the United States. It complemented the American Competitiveness and Workforce Improvement Act that was initially passed into law in 1998. The main aim of this Act was to alter the rules concerning caps and portability for the H-1B visa, as it aims to increase the number of available visas to workers and to allow them to change employers without any hassles.

The United States and Saudi Arabia are trading partners due to specialization. Choose the type of specialization trading taking place between the two countries? A) Heavy equipment from the United States is traded for agricultural products from Saudi Arabia B) Oil from the United States is traded for agricultural products from Saudi Arabia C) Oil from Saudi Arabia is traded for agricultural products from the United States. D) Heavy equipment from Saudi Arabia is traded for agricultural products from the United States.

Answers

the answer would be c sense they have good oil

The material expelled when a meteorite strikes the surface of a planet is called ________ and the meteor strike creates a ________. comet; asteroid a celestial sphere; comet planetesimal; impact crater ejecta; impact crater

Answers

Answer:

Ejecta and an impact crater

Explanation:

Normally when a meteorite strikes the surface of a planet, a material called ejecta is released and an impact crater comet is created.

Answer:

impact crater ejecta; impact crater      

Explanation:

Meteorites are rocks that are from outer space that hits the surface of the earth. It is seen as a bright glowing body as it enters the earth's protective atmosphere; these are all originated outside the earth. Where exactly is up for many interesting scientific discussions.

Whenever it hits the earth it  a lot of material is spewed out and this is called ejecta. A lot of dust and fragment is ejected into the air. This can release a cloud of debris and cause obstruction of vision and interfere with breathing.

An impact crater is a circular hole formed when a meteorite hits the surface of the earth. Typically when an object moving at a very high speed.


Which paragraph from the article BEST supports the conclusion that
seniors are applying things they learned in school to get them through the
pandemic? *

1. That is what everybody has been working for all of our high school career, Jones said
in a phone interview. "I would want that to stay the most. Even though it's just walking
across the stage, it's a big deal. College isn't the path for all of us, and this is the last
time we'll all be together."

"2. We joke and try and make each other feel better, but I've had friends who have cried
because they're so upset, Shell said. "It's just all happened so quick. We're confused
and dazed. For the rest of my life I'll remember this."

"3. He said, "You guys need to carry these lessons with you no matter what you're doing.
Be in control. Be grateful. Compete to keep your family safe and the older generation
safe," Graham recalled "It's a cool life lesson that through hard times you can get
through by following those words."

"4. The world's going crazy. No one was prepared for this, but the best thing it has taught
me is to be calm and be humble," he said. "I'm just keeping my mind focused on what I
need to do and to stay calm for my teammates and my family."

Answers

Answer:

1. That is what everybody has been working for all of our high school career, Jones said in a phone interview. "I would want that to stay the most. Even though it's just walking across the stage, it's a big deal. College isn't the path for all of us, and this is the last time we'll all be together."

Explanation:

Option 1 shows the paragraph that best supports the conclusion that  the elderly are applying what they learned at the get them through the pandemic school. This is because the narrator states that although he is going through a difficult situation, as the pandemic appears, it was about this type of situation that he has been working and dedicating himself throughout his high school career. For that reason, it will be easier for him to get through that moment.

Answer: A

Explanation: I looked up the answer and i know for sure....ITS A..  GOT AN A+ ON THIS QUESTION.... FOLLOW ME ON INSTAGRAM _IAMNYRI_

Individuals often make incorrect attributions about cause and effect because
a. a large set of actions and interactions work according to random principles.
b. they are likely to make more intricate connections than are present in reality.
c. they've learned most reactions from modeling caregivers and peers.
d. their intuitive understanding of situations involves cognitive shortcuts.

Answers

Answer: D. their intuitive understanding of situations involves cognitive shortcuts.

Explanation: Cause and effect may be referred as a principle of attributing or formulating relationship or connection between events, whereby one presumes or believes that a certain event or action was caused by or due to the effect of another event. Indivuduals are usually subjected to the notion of cause and effect almost always in our everyday life, particularly as we try to create quick correlation between identical or simultaneous events. However, incorrect attribution are often made due to the fact that situation surrounding the occurrence of events are usually interpreted is usually not detailed, leaving individuals to rely on available information or shortcut which might be insufficient to give a correct interpretation.

In 2008, the United States, as well as the rest of the world, felt the effects of the recession. After the collapse of the housing market, people lost their jobs and they quit spending money. Many people could not afford their mortgages anymore and their homes went into foreclosure. For many people, it was a time of _________________.

Answers

Answer:

Disabilities

Explanation:

the financial crisis of 2008, the biggest economic meltdown in the U.S. since the Great Depression, lasted a little more than 18 months, and ended long ago. From December 2007 to June 2009, the GDP contracted sharply, and then the economy began growing again.

At ground level for many, though, the world has never been quite the same.

“One in five employees lost their jobs at the beginning of the Great Recession. Many of those people never recovered; they never got real work again,” says Wharton management professor Peter Cappelli, director of the school’s Center for Human Resources. “The spike in disability claims was in part caused by the difficulty laid-off people had in securing any jobs. A generation of young people entering the job market had their careers disrupted by it. The fact that this age group continues to delay buying houses, having children, and other markers of stable, adult life is largely attributed to this.”

Reference:

How the Great Recession Changed American Workers

Sep 10, 2018

Business RadioPodcastsResearch

North America

Final answer:

The 2008 recession was a time of economic hardship with increased unemployment, home foreclosures, and a decline in consumer spending. Particularly impacted were the Millennials, who struggled to secure employment during this time.

Explanation:

For many people, the collapse of the housing market and the recession in 2008 was a time of profound economic hardship and uncertainty. Job losses were abundant, with the number of unemployed Americans rising from 6.8 million in May 2007 to 15.4 million in October 2009, according to the Bureau of Labor Statistics (BLS). Perhaps one of the most grim signs of the recession was the increased number of home foreclosures. Many people could not keep up with their mortgage payments and, as a result, their homes were taken by the bank. As many businesses closed down and layoffs increased, consumer spending declined, resulting in a cyclical effect that only exacerbated the economic downturn. Additionally, a large number of smaller businesses, approximately 170,000, closed their doors for good during this difficult period.

For the young generation entering the job market, like the Millennials, this was a particularly rough time. Many found themselves unable to secure employment even after graduating from high school or college. This economic stagnation and difficult job market, compounded with the struggling housing sector, made this a time of serious financial strain for many.

Learn more about Great Recession here:

https://brainly.com/question/33731015

#SPJ11

How long does the adjudication process take for unemployment in michigan

Answers

Answer : 2-6 weeks

Explanation:

Other Questions
A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings? What made Jake suspicious about the man with the camera?he was wearing dark glasseshe took a photo of themhe was the same man who sold Jake the maphe had followed them all dayIts C