What did the british call the boston massacre?

Answers

Answer 1
The incident on King Street
hope I help


Related Questions

What was the most important building in colonial new england?

Answers

The answer would be the meeting house.

What basic rights are protected by the first amendment?

Answers

Hello!

The First Amendment grants the rights to freedom of speech, freedom of the press and freedom of religion. In addition, it also protects the right to petition the government. 

I hope this helps answer your question! Have a fantastic day!

Write 2 to 4 lines on whether you think Genghis Khan was a vicious barbarian or a unifier who paved the way for the modern world.

Answers

Interestingly enough, Genghis Khan was a mix of a barbarian and a unified who paved the way for the modern world.  He did kill tens of thousands of people and take their money, but he also created one great empire people could live under, and unified people that way.

How did immigrants deal with the challenges they faced?

Answers

They had to overcome them and work extremely hard to make it in the new world I hope this helps a lot didn't have anything good to go back to.
Final answer:

Immigrants in the late 19th and early 20th centuries faced challenges such as language barriers and adapting to new customs. They often settled in communities with people from their home country and relied on these communities for support. Discrimination varied depending on ethnicity, but many immigrants found economic opportunities in the United States.

Explanation:

Immigrants in the late 19th and early 20th centuries faced various challenges when coming to the United States. They dealt with language barriers and the need to adapt to new customs and societal norms. To address these challenges, immigrants often settled in communities with people from their home country, where they could maintain their language, customs, and cultural practices. They also relied on these communities for support in navigating their new lives.

However, the response of the host country varied depending on the ethnicity of the immigrants. Some groups, like Germans and Eastern European Christians, were largely accepted, while others, such as Irish, Jewish, and Italian immigrants, faced discrimination and anti-Semitism. The discrimination against immigrants was reinforced by their ethnic differences, including skin tone, language, religion, and food preferences, which made them easy targets for hatred and blame.

Despite the challenges and discrimination, many immigrants found economic opportunities in the United States. They worked in various industries, such as factories, the garment industry, the steel industry, the fishing industry, agriculture, mining, building trades, and domestic service. They believed in the American Dream and viewed assimilation as a way to achieve upward mobility and financial success.

Learn more about the challenges faced by immigrants here:

https://brainly.com/question/28437263

#SPJ2

Was was the compromise at the constitutional convention of 1787

Answers

The Connecticut Compromise (also known as the Great Compromise of 1787 or Sherman Compromise) was an agreement that large and small states reached during the Constitutional Convention of 1787 that in part defined the legislative structure and representation that each state would have under the United States Constitution. It retained the bicameral legislature as proposed by Roger Sherman, along with proportional representation of the states in the lower house, but required the upper house to be weighted equally between the states. Each state would have two representatives in the upper house.

Contents  [hide] 1Context2The Compromise3Aftermath4See also5References

Context

On May 29, 1787, Edmund Randolph of the Virginia delegation proposed the creation of a bicameral legislature. Under his proposal, membership in both houses would be allocated to each state proportional to its population; however, candidates for the lower house would be nominated and elected by the people of each state. This proposal allowed fairness and equality to the people. Candidates for the upper house would be nominated by the state legislatures of each state and then elected by the members of the lower house. This proposal was known as the Virginia Plan.

Less populous states like Delaware were afraid that such an arrangement would result in their voices and interests being drowned out by the larger states. Many delegates also felt that the Convention did not have the authority to completely scrap the Articles of Confederation,[1] as the Virginia Plan would have.[2] In response, on June 15, 1787, William Paterson of the New Jersey delegation proposed a legislature consisting of a single house. Each state was to have equal representation in this body, regardless of population. The New Jersey Plan, as it was called, would have left the Articles of Confederation in place, but would have amended them to somewhat increase Congress's powers.[3]

At the time of the convention, the South was growing more quickly than the North, and Southern states had the most extensive Western claims. South Carolina, North Carolina, and Georgia were small in the 1780s, but they expected growth, and thus favored proportional representation. New York was one of the largest states at the time, but two of its three representatives (Alexander Hamilton being the exception) supported an equal representation per state, as part of their desire to see maximum autonomy for the states. (The two representatives other than Hamilton had left the convention before the representation issue was resolved, leaving Hamilton, and New York state, without a vote.)

Answer: were are the answer choices

Explanation:

Who were the redcoats and why were they called that?

Answers

The British because their military uniforms included white breeches with a red coat.
The British because their uniforms were red. They were also called lobster backs because of the color

What powers did the articles of confederation gave to congress and what powers did they withhold?

Answers

Congress could declare war and make peace, but it could not levy taxes.

In the 1950s and 60s the proclamation of state's rights was usually made by those opposing the national governments efforts in the area of

Answers

Government officials say that they are trying not only the way they can be treated and the
Civil rights for African Americans.

Hope this helps :) 

Which outcome did NOT occur following the Supreme Courts decision in United States vs. Nixon?

A. President Nixon resigned.

B. President Nixon released the tapes.

C. President Nixon was impeached.

D. President Nixon lost him remaining political support.

Answers

i think its d 
hope this helps 

Answer:

President Nixon was NOT impeached.

Explanation:

He was going to be but he resigned before he was.

The two major parties kept the focus of the 1848 presidential election campaign on

Answers

the personalities of Senator Cass and General Taylor

How is the right hand side of the woodcut different from the left hand side? What is the effect of this difference ?

Answers

Final answer:

In a woodcut, differences between the left and right sides could be present in color, line, texture, and content, depicting two contrasting themes or ideas. The effect of this lies in the contrasting narratives or visual appeal the artist wants to convey. Duality, balance, rhythm, or tension could be emphasized within the artwork.

Explanation:

Without having the specific woodcut in question, it's not possible to provide a definitive interpretation. However, due to the general nature of your query, it appears that the woodcut is divided into two contrasting fields. There may be several visual elements such as color, line texture, and content that differentiate the right hand side from the left hand side of the woodcut. The differences between the two sides could convey contrasting themes or ideas.

For example, refer to the case of brain lateralization where the brain functions related to the right and left hands may portray two distinct fields of cognitive development, affecting the interpretation of the work.

The effect of this difference lies in the contrasting scenarios, visual appeal, or narratives that the artist wants to depict. It could emphasize the duality or interplay between two opposing factors, or create visual tension, balance, or rhythm within the artwork.

Learn more about Art Interpretation here:

https://brainly.com/question/28248155

#SPJ12

The igbo ukwu of africa worked largely with _____.

Answers

The correct answer is metals. Hope this helps!

Answer:

metals

Explanation:

apex

What region, conquered by cambyses, represented the westernmost advance of the achaemenid empire?

Answers

The western-most lands conquered by the Achaemenid Empire extend into what is now modern-day Egypt and Libya. Most of the lands conquered under Cambyses fall in Egypt, while they were extended further into Libya under Darius I.

How states must honor one another's laws?

Answers

by getting all the governors to get together and discuss about the laws of each state.

The hill of samaria was bought, and on it the capital city of israel, which was also called samaria, was built by .

Answers

Omri,according to the Bible, the sixth king of Israel. However, a "substantial" modern hypothesis maintains that, as founder of the House of Omri, an Israelite royal house, his kingdom formed the first state in the Land of Israel, and that Judah only achieved statehood later.

Final answer:

The capital city of Samaria, located on the hill of Samaria, was established by King Omri, the sixth king of Israel, around 880 BCE. Samaria became the capital of the northern kingdom of Israel after the division of the kingdom post-Solomon.

Explanation:

The Capital City of Samaria

The hill of Samaria was purchased, and upon it, the capital city of the northern kingdom of Israel, also known as Samaria, was constructed. After the death of King Solomon, the unified monarchy over the Israelites ended, leading to the creation of two separate kingdoms: Israel in the north with its capital at Samaria, and Judah in the south with its capital at Jerusalem. Israel, being larger and wealthier, often interacted with and even waged wars against Judah.

In the history of Israel, King Omri, the sixth king of Israel, is credited with buying the hill of Samaria and establishing it as the capital around 880 BCE. His move to establish Samaritan territory was driven by strategic and administrative motives. Samaritans in the region were known for their frequent interactions with neighboring peoples and many continued polytheistic worship practices alongside the worship of Yahweh.

How did divisions within the arab empire lead to emergence of the abbasid dynasty?

Answers

The Umayyad Caliphate was an Islamic Empire with its capital in Damascus, and it was characterized by the importance given to Arab citizens, who were considered as first-class citizens, while other ethnicities were considered second-class citizens, even though they were Muslims as well. This division among the population brought discontent among different groups, like Persians and Kurdish, who wanted to have access to political and social privileges. For this reason, the Abbasid dynasty took advantage of these groups who opposed the Umayyad and organized a conspiracy in Kufa, in the Eastern region of the empire, in order to seize control of the Caliphate. They succeeded in their military campaign, established the Abbasid Caliphate, and moved the capital to Baghdad. With the Abbasid Caliphate, a great cultural movement started in the Islamic world for centuries, known as the Islamic golden age.

The emergence of the Abbasid dynasty was facilitated by widespread discontent with Umayyad rule and the effective mobilization of diverse, marginalized groups under a unifying cause.

Divisions within the Arab Empire, particularly during the late Umayyad period, were rooted in ethnic, social, and political discontent. The Umayyads favored Arab Muslims, causing resentment among non-Arab converts (mawali), who felt marginalized. Additionally, the Umayyad rulers were criticized for their luxurious lifestyles and perceived moral decline, which alienated many pious Muslims.

These internal divisions created fertile ground for the Abbasids, who capitalized on widespread dissatisfaction. Promising a more inclusive and just rule, the Abbasids garnered support from diverse groups, including non-Arab Muslims, disaffected Arab tribes, and Shia factions.

The Abbasid revolt, led by Abu Muslim, effectively harnessed this discontent, culminating in the overthrow of the Umayyad dynasty in 750 CE and the establishment of the Abbasid Caliphate.

For what primary purpose did the Spanish enslave many American Indians?

Answers

to work in the mines and grow sugar

Answer:

The  Spanish conquistadors enslaved American Indians because they needed labour to work in mines and grow sugar.

Slavery in the Spanish American colonies was an economic and social institution which existed throughout the empire of Spain. In its American territories, it initially bound indigenous people and later individuals of African origin.  

The first speech in the Americas for the universality of human rights and against the abuses of slavery was also given on Hispaniola, a mere nineteen years after the first contact. Resistance to Amerindian captivity in the Spanish colonies produced the first modern debates over race and the legitimacy of slavery.    

Cheers!                                   

 

What simile does Hurston use to express the idea that people are all the same under the skin?

Answers

a brown bag standing next to other colored bags

A brown bag standing next to other colored bags: a simile Hurston use to express the idea that people are all the same under the skin.

Why does Hurston choose to use the word "circumlocutions" in paragraph 11 of "How It Feels to Be Colored Me"?

Hurston contrasts her attitude to the jazz music they are listening to with her white guest's in "How It Feels to Be Colored Me" by using the phrase "circumlocutions." She quickly enters the emotional core of the jazz music, but he hears it in an analytical way and with detachment, adding emphasis to the text's tone.

It's crucial to consider paragraph 11 in the context of the remainder of "How It Feels to Be Colored Me" by Zora Neale Hurston in order to comprehend the significance of the word "circumlocutions" there. Hurston explores what it means to be a Black person in the society of her day in this essay.

Learn more about Hurston here:

https://brainly.com/question/3304126

#SPJ2

President (1) _____ became known as a(n) (2) _____ for pursuing violators of the sherman antitrust act. he promoted (3) _____ to end the pennsylvania coal miners' strike. his program, which was called the (4) _____, was based on government regulation of business. his belief in the (5) _____ of natural resources was balanced with business interests. roosevelt's successor, (6) _____, supported a(n) (7) _____ as a way to lower tariffs. when taft was nominated for reelection in 1912, roosevelt and his supporters formed the (8) _____ party. the split in the republican party resulted in the election of the democratic candidate, (9) _____, whose program was called the (10) _____. one of its key objectives was (11) _____ reform, accomplished in 1913. the president and congress worked to strengthen government control over business. the (12) _____ regulated banking through a central board over regional banks. congress also established the (13) _____ to investigate unfair trade practices. part ii - answer the questions. 14. what was the purpose of the federal reserve act? 15. president theodore roosevelt broke up trusts in what industries? 16. what was the job of the national conservation commision? 17. who was elected president in 1908? 18. in 1912 why did taft win the republican nomination even though roosevelt won every primary?

Answers

Fill in the gaps

1. Theodore Roosevelt

2. Trustbuster

3. Arbitration

4. Square Deal

5. Conservation

6. William Howard Taft

7. income tax

8. Progressive

9. Woodrow Wilson

10. New Freedom

11. Tariff

12. Federal Reserve Act

13. Federal Trade Commission

 

 Part 2

14. The purpose of the Federal Reserve Act was to give the nation a monetary and financial system that is safer, more flexible, and more stable. In accordance with this purpose, the Federal Reserve Act regulated banking through a central board over regional banks.

 

15. President Roosevelt broke up trust in the railroad, beef, oil, and tobacco industries. Because of his anti-trust prosecutions and regulatory reforms, President Roosevelt became popularly known as the "trust buster. He mainly targeted trusts that were found to have jacked up rates and exploited consumers.

 

16. The job of the National Conservation Commission was to prepare an inventory of the nation's natural resources, and develop concepts of resource management as a comprehensive policy recommendation for the government. To carry out this job, the commission was sub-divided into four sections – water, forests, lands, and minerals. Each of the sections had its own chairman.

 

17. William Howard Taft was elected President of the United States in 1908. Taft won the 1908 Republican president nomination with the support of incumbent President Roosevelt, and thereafter won the general elections. He served as the 27th President of the United States from 1909 to 1913.

 

18. Although Roosevelt won every primary, Taft won the Republican nomination because the delegates chosen in the primaries were a minority. Roosevelt in fact insisted that President Taft had instigated fraudulent seating of delegates so as to seize the presidential nomination from the progressive faction of the Party. As a result of this, and with the support of convention chairman Elihu Root, Taft's conservative faction outvoted Roosevelt's progressive faction.

After the Red River War, who became the principal leader of the Comanches as they adjusted to reservation life? Question 5 options: Making Medicine General Philip Sheridan John D. Miles Quanah Parker

Answers

Quanah Parker is the answer or should be

How many states or parts of states did the US create from the Mexican Cession?

Answers

California, Nevada, Arizona, Utah, Wyoming, Colorado, and New Mexico

The states were: California, Nevada, Arizona, Utah, Wyoming, Colorado, and New Mexico.

It would be B. Seven!!!!

Who presides over the senate trial after a president is impeached?

Answers

The Chief Justice presides over president impeachment trails.

The chief justice of the supreme court


What did abraham lincoln say in his inaugural address answers?

Answers

He would not interfere with slavery in the states where it already existed.
He declared that no state could lawfully leave the union by its own action.
i hoped this helped

A(n) ________________ in canada is the equivalent of a "state" in the united states.

Answers

The answer you are looking for is Province.

What was the chief reason for adolf hitler's anti semitism?

Answers

He believed they ruined Germany and their economy during the First World War.

What position in government was jackson elected to in 1828?

Answers

Andrew Jackson was elected to the U-S Presidency in December 2,1828. He was elected over fellow candidate John Quincy Adams.

Were critics of WWI antiAmerican?

Answers

No, were critics of ww2 Anti-American? Just because you are a critic, that does not make you against something.

Hope this Helps! :)

What was the central concern of families in the maurya and gupta empires? (1 point)
a. attaining social recognition
b. acquiring wealth and property
c. following caste traditions
d. gaining local power and influence

Answers

The answer is

C. Following caste traditions and duties

Why are the teachings of confucius different from traditional religious ideas brainly?

Answers

The teaching of Confucius is different from the traditional religious ideas because he does not speak of beliefs of god as they are likely to revolve their beliefs with a movement of having to make a better society because they engage a religion focusing more a rationalistic or humanistic approach.

Answer:He did not speak of god or beliefs

Explanation:.

What is called the power of a court to evaluate actions and decisions made by other agencies of government?

Answers

This is the concept of judicial review, set forth for the first time in McCulloch v. Maryland. This case held that courts are the arbiters who decide if other governmental agencies have created and set forth laws that are in comport with the Constitution.
Other Questions
What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Evaporation is ________. check all that apply. check all that apply. an endothermic process sometimes a warming process always a cooling process sometimes a cooling process an exothermic process always a warming process Why is it important that melanin is present in its highest concentration in the keratinocytes at or near the basale layer of cells? What conclusion can you draw from the fact that Spanish and Portuguese are the most commonly spoken languages in Latin America? A)Latin Americans have chosen to speak Romance languages. B)Latin Americans were born in Spain and Portugal and then moved. C)Spain and Portugal colonized Latin American nations during the 15th and 16th centuries. D)Many Latin Americans travel to Spain and Portugal and learn the language while visiting. which function represents a vertical stretch of an exponential function