What is not a function of the skeletal system?


a) providing movement

b) protecting organs

c) storing minerals

d) making vitamins

Answers

Answer 1

Answer:

Making Vitamins

Explanation:

Answer 2
Final answer:

The skeletal system performs crucial functions such as providing movement, protecting organs, and storing minerals. However, it does not synthesize or generate vitamins. Other body parts such as the skin and gut bacteria are responsible for vitamin synthesis.

Explanation:

The skeletal system in our body performs several crucial functions, including providing structural support that enables movement, protecting our vital organs, and serving as a storage system for essential minerals like calcium and phosphorus. However, one task it does not carry out is the synthesis or making of vitamins. This is a function usually associated with other parts of the body, such as the skin (for Vitamin D synthesis) or the bacteria in our gut (for certain B vitamins and Vitamin K).

Learn more about skeletal system here:

https://brainly.com/question/31883942

#SPJ6


Related Questions

When extending the knee, the hamstrings act as the ___________ muscle?

Answers

The quadriceps femoris muscle 

Describe one limiting factor for the moose population

Answers

Moose is the primary food source of wolves/ Predation

Wolves' main source of food is moose. This population seems to be being constrained by interactions between winter weather, predation on young calves, and dietary restrictions.

What is predation?

Predator is a term used to describe a creature that primarily hunts and eats other species. A species is referred to as a "predator" if it hunts and consumes particular other creatures. Prey is the term used to describe the creatures that predators eat.

Important density-dependent population controls include predator-prey interactions as well as prey-predator interactions. How each population changes in size depend on the size of the other population.

A density-dependent limiting factor kicks in when the population density reaches a certain level. Other examples of limiting factors that depend on density are competition, parasitism, and sickness.

Therefore, Wolves' main source of food is moose limiting factors for the moose population.

Learn more about predation, here:

https://brainly.com/question/20664581

#SPJ2

The macula densa cells respond to ________. the macula densa cells respond to ________. changes in na+ content of the filtrate aldosterone antidiuretic hormone changes in pressure in the tubule

Answers

The macula densa cells respond to changes in na+ content of the filtrate. These cells senses changes in the sodium chloride level, and will trigger an autoregulatory response to increase or decrease reabsorption of ions and water to the blood, for the purpose of altering the volume of blood and return blood pressure to normal. 

The macula densa cells respond to changes in the Na⁺ content of the filtrate. The macula densa cells are located in the distal convoluted tubule of the nephron. They are specialized cells that sense changes in the sodium chloride concentration in the filtrate. Hence option A is correct.

When the sodium chloride concentration is low, the macula densa cells release a signal that causes the juxtaglomerular cells to release renin. Renin is an enzyme that converts angiotensinogen into angiotensin I.

Angiotensin I is then converted into angiotensin II, which is a powerful vasoconstrictor. The vasoconstriction of the afferent arterioles increases the glomerular filtration pressure, which helps to restore the sodium chloride concentration in the filtrate.

The other answer choices are incorrect. Aldosterone is a hormone that increases sodium reabsorption in the distal convoluted tubule.

Antidiuretic hormone (ADH) increases water reabsorption in the collecting duct. Changes in pressure in the tubule do not directly affect the macula densa cells.

Therefore, option A) changes in Na⁺ content of the filtrate is correct.

To know more about macula densa:

https://brainly.com/question/12410538

#SPJ6

The oral cavity is separated from the nasal cavity by the hard and soft __________.

Answers

The oral cavity is separated from the nasal cavity by the hard and soft palate.
Final answer:

The oral cavity is separated from the nasal cavity by the hard and soft palate. The hard palate is the bony part of the roof of the mouth, while the soft palate is the flexible part towards the back.

Explanation:

The oral cavity and the nasal cavity are anatomically separate structures, and they are separated by the hard and soft palate. These form the roof of the mouth and the floor of the nasal cavity. The hard palate is the anterior, bony part of the roof and it separates the mouth from the nasal passages, while the soft palate is the fleshy, flexible part towards the back of the roof of the mouth, continuing the separation between the oral and nasal cavities.

Learn more about hard and soft palate here:

https://brainly.com/question/32469575

#SPJ6

PLEASE BE QUICK I'LL GIVE YOU THE MOST BRAINLIEST ANSWER

Read each example and decide what the resulting effect on the gene pool of that population would be. A zebra migrates to join a different herd of zebras. Competition for sunlight leads to taller trees. The DNA of a snake changes to make its venom stronger. A grassfire randomly sweeps through a population of buffalo and kills most of the animals.

Answers

Final answer:

Scenarios affecting a population's gene pool include gene flow with a zebra joining a new herd, natural selection among trees competing for sunlight, an evolutionary change in a snake's venom, and a bottleneck effect from a grassfire impacting buffalo.

Explanation:

The question pertains to how certain scenarios affect the gene pool of a population. In biology, this is an aspect of evolution and population genetics. Immigration of new individuals into a population, as with the zebra joining a new herd, leads to gene flow, changing the genetic makeup by introducing new alleles. When trees compete for sunlight and the taller ones prevail, this is an example of natural selection favoring alleles that promote height growth. A snake's DNA changing to make its venom stronger may also be a result of natural selection if the stronger venom increases the snake's survival or reproductive success. Lastly, a grassfire sweeping through a buffalo population can cause a bottleneck effect, where the gene pool is significantly reduced and the genetic makeup of the survivors predominates the future population.

Each scenario affects the gene pool differently. Gene flow introduces new genes, natural selection changes allele frequencies based on environmental advantages, and the bottleneck effect drastically reduces genetic diversity and allele frequencies due to random survivorship.

Final answer:

The resulting effects on the gene pool of the population would include gene flow, natural selection, genetic drift, and the bottleneck effect.

Explanation:

The resulting effect on the gene pool of that population would be:

Gene Flow: When a zebra migrates to join a different herd of zebras, it can introduce new genetic variation to the population. This can lead to changes in the gene structure of the population.Natural Selection: Competition for sunlight leading to taller trees can drive natural selection. Trees that grow taller can have an advantage in accessing sunlight, causing individuals with genes for taller growth to have higher fitness and increased representation in the population.Genetic Drift: If the DNA of a snake changes to make its venom stronger, this can cause a change in allele frequencies within the population. However, it is important to note that genetic drift is a random process and can happen due to chance events.Bottleneck Effect: The grassfire randomly sweeping through a population of buffalo and killing most of the animals can result in a large portion of the gene pool being wiped out. The survivors would then become the genetic structure of the entire population, which may be very different from the pre-disaster population.

Hormones play an important role in regulating blood glucose levels. for example:

Answers


 

Hormones play important roles in regulating blood glucose levels. For example, (i) the hormone insulin regulate blood glucose levels by suppressing the breakdown of proteins into amino acids and of adipose tissue into free fatty acids. (ii) The hormone asprosin regulate blood glucose levels by enhancing the release of liver glucose during fasting.





If you ate a samples of the different carbohydrates seen here, how would the available energy differ from each source and why? A) The simple sugars would have less energy than the complex sugars, because the molecules are smaller. B) The simple sugars would have more available energy, because they are small molecules and are easy to break down. C) The complex carbohydrates would produce the most energy, because they have a high C:H ration and relatively little oxygen. D) All of the carbohydrates would produce about the same amount of energy, as they all have a large amount of oxygen atoms.

Answers

The correct answer is D



A) The simple sugars would have less energy than the complex sugars, because the molecules are smaller.

B) The simple sugars would have more available energy, because they are small molecules and are easy to break down.

C) The complex carbohydrates would produce the most energy, because they have a high C:H ration and relatively little oxygen.

D) All of the carbohydrates would produce about the same amount of energy, as they all have a large amount of oxygen atoms.

Final answer:

Simple sugars, being small molecules, are quickly broken down and absorbed by the body, leading to a rapid but short-lived burst of energy. Complex carbohydrates, with their longer chains of sugar molecules, provide a more sustained energy release. The energy difference arises from the rate at which these carbohydrates are metabolized.

Explanation:

When considering the energy available from different types of carbohydrates, it's important to understand that carbohydrates serve as a significant source of energy for the body. The body breaks down these carbohydrates into glucose, which is then used in cellular respiration to fuel various activities. Carbohydrates come in two main forms: simple sugars (monosaccharides like glucose and fructose) and complex carbohydrates (polysaccharides like starch and glycogen). The process of sugar catabolism breaks down complex carbohydrates into their simpler forms, making them available for ATP production in cells.

Complex carbohydrates are longer chains of sugar molecules and thus take longer to break down, which implies a more sustained release of energy compared to simple sugars. Simple sugars, being smaller molecules, can be quickly broken down and absorbed, leading to a rapid but short-lived burst of energy. Therefore, the correct answer would be (B) The simple sugars would have more available energy, because they are small molecules and are easy to break down.

In fruit flies, the allele for vestigial wings is recessive to the allele for wild-type wings, and the allele for white eyes is recessive to the allele for red eyes. the gene controlling wing type is carried on an autosome, whereas the gene controlling eye color is carried on the x chromosome. a true-breeding female with wild-type wings and white eyes is crossed with a male with vestigial wings and red eyes. what proportion of the offspring are expected to be males with wild-type wings and white eyes? give your answer as a fraction or a decimal value from 0 to 1.

Answers

Answer:

Both parents were heterozygous

Explanation:

Lets suppose N is the dominant and n is the recessive.

If both parents are heterozygous, they can create flies with vestigial and normal wings. The result of that is 25% NN, 50% Nn, and 25% nn. If you add up the flies that were vestigial and the flies that were normal, it would be 120. The male and female flies with vestigial wings add up to be 33, 33/120 is 27.5% which is a little over 25%.

Final answer:

The proportion of males with wild-type wings and white eyes in the offspring can be expected to be 1/4 or 0.25.

Explanation:

To determine the proportion of males with wild-type wings and white eyes in the offspring, we need to understand the inheritance of these traits in fruit flies. The vestigial wings allele is recessive to the wild-type wings allele, while the white eyes allele is recessive to the red eyes allele. The gene-controlling wing type is carried on an autosome, while the gene-controlling eye color is carried on the X chromosome.

The true-breeding female with wild-type wings and white eyes can be represented as XWXW. The male with vestigial wings and red eyes can be represented as XWY. When they are crossed, the offspring will inherit one X chromosome from the female and one X chromosome or a Y chromosome from the male.

When the XWXW female is crossed with the XWY male, there are three possible combinations of offspring genotypes: XWXW (red-eyed females), XWY (white-eyed males), and XWY (red-eyed males). Since we are interested in the proportion of males with wild-type wings and white eyes, which corresponds to the XWY genotype, the expected proportion can be represented as 1/4 or 0.25.

Without the water cycle, all organisms would die ? True or false

Answers

The answer  for  this is true

Crude oil is a toxic chemical that is ____

A. Organic
B. A pathogen
C. A heavy metal
D. Inorganic

Answers

Correct Answer is D.) Inorganic. (Gradpoint)

Answer:

A. Organic  is the correct answer.

Explanation:

Crude oil is a toxic chemical that is Organic.Crude oil is an organic chemical composed of hydrogen, carbon and it also contains some amount of sulfur, oxygen, and nitrogen.crude oil found inside the Earth.When petroleum originates directly from the ground as the liquid is called crude oil.crude oil is natural resources that cannot be renewed because it is nonrenewable resources.crude oil is a very toxic mix of carcinogens, mutagens, neurotoxins, neurotoxins, and respiratory irritants.

The oldest technique for stretching, which is seldom used because it can cause muscle soreness, is called _______ stretching.

Answers

Ballistic stretching is your answer. Have a great day.

Rainforests are not exclusively found near the equator. please select the best answer from the choices provided

Answers

i do not see any choices provided. 
c.Half of all rainforest plants have been tested for their medicinal properties. on edgunuity 

Jenny is losing weight, has poor tolerance to heat, and has mood swings, high blood pressure, and a rapid heart rate. she has very high levels of thyroid hormone, high levels of tsh, and a goiter. which of these diagnoses is the most likely for jenny's condition?

Answers

The answer would be: defective receptors for thyroid hormone control by the anterior pituitary

Jenny condition match with hyperthyroidism where the body produces too much thyroid hormones. The cause of hyperproduction of thyroid hormone could be cancer in thyroid cells or disruption of negative feedback mechanism. In this case, negative feedback of anterior pituitary should be the problem.
Final answer:

The most likely diagnosis for Jenny's condition is Graves' disease, an autoimmune condition that leads to hyperthyroidism and can cause symptoms such as weight loss, poor tolerance to heat, and a goiter.

Explanation:

The most likely diagnosis for Jenny's condition based on the symptoms mentioned, including weight loss, poor tolerance to heat, mood swings, high blood pressure, rapid heart rate, high levels of thyroid hormone, high levels of TSH, and a goiter, is Graves' disease. Graves' disease is an autoimmune condition that leads to hyperthyroidism and can cause symptoms such as heat intolerance, weight loss, and a goiter. Additionally, Jenny's symptoms of rapid heart rate and mood swings are commonly experienced in hyperthyroidism. Treatment options for Graves' disease may include anti-thyroid medications, radioactive iodine therapy, or surgery to remove the thyroid gland.

Learn more about Graves' disease here:

https://brainly.com/question/12897028

#SPJ3

Which structure supports and connects the cells of the nervous system?

Answers

Neuroglia, which is sometimes referred to as "glia", are cells that are not neurons but merely support and provide protection for neurons. They are called 'non-neuronal cells' and they exist in the central nervous system (brain and spinal cord) and the peripheral nervous system (nerves outside the brain and the spinal chord).

How much time passed between the appearance of the first prokaryotic cells and the emergence of multicellular organisms?

Answers

Prokaryotes were the first organisms to evolve on Earth, so, the first prokaryotic cells appeared 3.8 billion years ago. After them, Eukaryotic unicellular organisms developed, when one cell engulfed the other cell (endosymbiotic theory). Those unicellular eukaryotes form multicellular aggregates and that represents an evolutionary transition from single cells to multicellular organisms. Multicellular organisms evolved from unicellular eukaryotes at least 1.7 billion years ago.

About 2 billion years passed between the appearance of the first prokaryotic cells and the emergence of multicellular organisms.

 

Final answer:

The first prokaryotic cells appeared about 3.5 billion years ago, while the first definite multicellular organisms with tissues evolved around 630-542 million years ago. Between these milestones, eukaryotic cells emerged about 2.1 billion years ago.

Explanation:

The evolution of life on Earth began with the appearance of the first prokaryotic cells around 3.5 billion years ago. These cells were the only life forms for about 1.4 billion years until the appearance of eukaryotic cells approximately 2.1 billion years ago. As eukaryotes evolved, they became more complex, leading to the development of multicellularity about 1.5 billion years ago. However, the oldest definite multicellular organisms with tissues, as evidenced from the Ediacaran period, evolved around 630-542 million years ago. It's important to note that these estimates are based on fossil records and genetic evidence, and exact timings may vary slightly based on different sources.

Learn more about Evolution of Life here:

https://brainly.com/question/17193750

#SPJ3

Which of the following occurs when the Earth's crust shifts?

Answers

earthquakes happen hope it helps

Answer:

earthquakes

Explanation:

The youth movement originated with the ___ the generation born after ___

Answers

I believe that the youth movement originated with the baby boomers, the huge generation born after the world war II. By 1970, 58.2 % of the population in America was under the age of 35 years. The economic boom of the 1950s meant more families could afford to send their children to College. College life gave the young people a sense of freedom and independence. It was on college campuses across the nation that youth protest movements began and reached their peak. 

Which feature does not result from seismic activity?
a. volcanoesB. rock layersC. glacier depositsD. faults

Answers

Final answer:

c) Glacier deposits do not result from seismic activity, which includes earthquakes, continental drift, mountain building, and volcanic eruptions, unlike volcanoes, rock layers, and faults.

Explanation:

The feature that does not result from seismic activity is c) glacier deposits. Seismic activity, which includes events like earthquakes, continental drift, mountain building, and volcanic eruptions, can lead to the formation of volcanoes, rock layers, and faults. Glacier deposits are formed through glacial processes, which are categorized under exogenic forces rather than the endogenic forces responsible for seismic activity. For example, volcanism on the Hawaiian Islands is due to a hotspot, not directly due to plate boundaries often related to seismic events.

The passage of water through a selectively permeable membrane from a less concentraded region to a more concentrated region is called

Answers

I believe the answer for the above question is Osmosis. It is the net movement of water molecules through a selectively permeable membrane, from a region of greater water concentration to a region of lesser water concentration. It is the diffusion of water through a selectively permeable membrane. It occurs when two solutions of different solute concentration are separated by a selectively permeable membrane. 

Which method is best for tracking your progress with weight traingin?

Answers

A chart. To count reps and such. And know when to add more weight of the bars and the like.

A large plant population may impose selective pressure on a smaller, isolated group of plants, resulting in a change in allele distribution. which mechanism is responsible for this change in the allele distribution? mutation hybridization trait acquisition genetic drift

Answers

The answer is genetic drift. This is the change of allelic frequency in a population due to natural selection in favor of particular traits. The effect of natural drift is greater is a population of small size that in a big population. When the allelic frequency of the isolated group of plants reaches 0, it is deemed as lost.

Is a significant environmental phenomenon that impacts weather patterns thus food production. farmers across the continent plan their planting and harvesting and pastoralists move their cattle and herds according to its rainmaking mechanism. unpredictable weather patterns and growing populations can lead to desertification and this can lead to droughts which can cause mass starvation among populations?

Answers

Watch the backyardigans and learn team work.

In a lysogenic infection, once the dna of the virus is incorporated into the bacterial dna, the dna is called a

Answers

This is called a prophage.

Janie is three years old. what serving size of mashed pinto beans would you recommend for her? janie is three years old. what serving size of mashed pinto beans would you recommend for her? 4 tablespoons 3 tablespoons 2 tablespoons 5 tablespoons

Answers

Transition from breast or formula feeding until solid food is vital for child's development. Children can learn skills while eating solid food and will be ready to try mashed cooked beans around 7-10 months old. For a 3 year old toddler,it is recommended around 3 tablespoons.

You are looking at tissue under a microscope. One cell shows half the amount of DNA of some of the other cells. This cell is most likely to be in which phase of the cell cycle?

Answers

This cell is most likely in G1 phase. 

Maurie regularly takes a pain reliever for her back pain. after a few weeks, she notices that she needs to increase the amount of pain-relieving drug that she takes each day in order to achieve the same level of pain relief. the phenomenon that maurie is experiencing is called drug _____.

Answers

Drug tolerance

Drug tolerance is a condition in which a drug’s effect is reduced as an individual continues to use it. An individual with a drug tolerance has to administer larger doses of the same drug in order to obtain the same desired effect exhibited by the drug initially. For the question given above, the phenomenon that Maurie is experiencing is called drug tolerance.






There are two bird species on a midwestern prairie that look very much alike physically and are probably descended from a common ancestor. during courtship, however, the males of one species stands on one leg while looking at the female. the males of the second species uses both feet to drum on the prairie floor. the females will only mate with those males who behave appropriately during courtship. what is this an example of?

Answers

I believe this is an example of Behavioral isolation. Behavioral isolation is an evolutionary mechanism that helps members of the same species identify each other as proper mates. It involves differences in courtship or mating behaviors; unlike temporal isolation which involves differences in the timing of courtship or mating behaviors

A mammal embryo worksheet. fill in the blanks with the correct answers. after two months of development, the embryo is called a fetus. the ___ is formed in part from the inner lining of the uterus and in part from other membranes. it is through the placenta that that the embryo/fetus is nourished while in the ____ and _____ are carried away.

Answers

Embryo Fetus is Nourished

After two months of development, the embryo is called a fetus. The endometrium is formed in part from the inner lining of the uterus and in part from other membranes. It is through the placenta that that the embryo/fetus is nourished while in the umbilical cord and three blood vessels are carried away.


Final answer:

An embryo develops into a fetus after two months. The placenta, formed from the inner lining of the uterus and other membranes, nourishes the fetus. Wastes are removed via the placenta while the fetus is in the uterus.

Explanation:

After two months of development, the embryo is called a fetus. The placenta is formed in part from the inner lining of the uterus and in part from other membranes. It is through the placenta that the embryo/fetus is nourished while in the uterus and wastes are carried away.

Learn more about Embryo to Fetus Development here:

https://brainly.com/question/36723489

#SPJ6

The earth liberation front (elf) is an example of what type of organization?

Answers

ELF or the Earth Liberation Front is a group of individuals engaging in action like economic sabotage and the guerilla welfare in order for the exploitation as well as the destruction of the environment would stop. Hope this is the answer on this question.

In what ways was the development of a body cavity or coelom an advantage for bilaterally symmetrical animals

Answers

The advantage is that the animals with bilateral symmetry can find food and mates and also avoid predators because they have sensory organs and good muscle control. An example of such animals would be human beings. Additionally, bilaterally symmetric animals have sensory organs focused at the head which interacts with the environment before the rest of the body does, which allows quick reaction and ability to be motile.
Other Questions
What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure