What is one difference between an electromagnetic wave and a mechanical wave?
A
An electromagnetic wave can travel through a vacuum. A mechanical wave must have a medium to travel through.

B
An electromagnetic wave moves parallel to the direction of the wave's travel. A mechanical wave can move only perpendicular to the direction of the wave's travel.

C
An electromagnetic wave moves perpendicular to the direction of the wave's travel. A mechanical wave can move only parallel to the direction of the wave's travel.

D
A mechanical wave can travel through a vacuum. An electromagnetic wave must have a medium to travel through.

Answers

Answer 1
Electromagnetic waves are waves that have no medium to travel whereas mechanical waves need a medium for its transmission. Electromagnetic waves travel in a vacuum whereas mechanical waves do not. ... While an electromagnetic wave is called just a disturbance, a mechanical wave is considered a periodic disturbance.


The answer is A :)
Answer 2

An electromagnetic wave can travel through a vacuum without a medium, while a mechanical wave requires a medium to propagate. The answer is option D.

One difference between an electromagnetic wave and a mechanical wave is how they propagate through space. An electromagnetic wave can travel through a vacuum without the need for a medium, whereas a mechanical wave must have a medium like air, water, or solids to travel through. This is because electromagnetic waves, which include light waves, are composed of oscillating electric and magnetic fields that can generate each other, whereas mechanical waves, like sound waves, rely on the vibration of particles in a medium to propagate.


Related Questions

HELP ASAP PLZZZZZZ

What is Chemical energy?
A)energy carried by light
B)energy of moving electrons
C)holds protons and neutrons together in the nucleus of an atom
D)holds the atoms in the molecule together

Answers

B because the electrons are moving to create a new form. Chemical energy is changing the form.


Hope this helps.

How much work is done by gravity when a pine cone (of mass 50g) falls from the top of a tree, 9 m high?

Answers

Answer: 4.41 joules

Explanation:

Given that:

work is done by gravity = ?

Mass of pine cone (m) = 50g

Convert mass in grams to kilograms

Since 1000g = 1kg

50g = (50/1000) = 0.05kg

Height of tree (h) = 9 m

Apply the formula for work,

Work = mass x acceleration due to gravity x height

Acceleration due to gravity has a value of 9.8m/s^2

Work = mgh

Work = 0.05kg x 9.8ms^2 x 9m

Work = 4.41J

Thus, 4.41 joules of work is done by gravity.

Answer:

4.5 J

Explanation:

I took the test

29. If you traveled to Mars, your mass would be
than your mass on Earth. *

Answers

yes it would be the same your weight would change:)

If you traveled to Mars, your mass would be exactly, precisely equal to your mass on Earth, PROVIDED you did not relieve the boredom of space travel by eating too many astronaut steaks along the way.

The only things that can affect your mass are your personal diet, exercise, sleep, and stress habits.  

Your mass has nothing to do with gravity. Your WEIGHT has.

Rank the nonmetals in each set from most reactive (1) to least reactive (3).

Bromine:

Chlorine:

Iodine:

Answers

Answer:

Bromine: 2 Chlorine: 1 Iodine: 3

Explanation:

hope this helps yall

Answer:

Bromine:

2

Chlorine:

1

Iodine:

3

Explanation:

What is the speed of light in a vacuum

Answers

Answer:

299 792 458 m / s

Explanation:

299 792 458 m / s I can confirm that 299 792 458 m / s is the answer

Which of the following descriptions explains the process of water freezing? A) Water molecules speed up until they escape into a different phase. B) Water molecules slow down until they begin to bond together C) Water molecules are squeezed together by high pressure until they begin to stick to one another. D) As water molecules cool, their shape changes from rounded to irregular, making them more likely to link to one another.

Answers

Answer:

B

Explanation:

Answer: B. Water molecules slow down until they begin to bond together

Explanation:                                                                                                                                  When the water is to be cooled, the molecules start to slow down and becomes no longer energetic which means that they are going to bond together.

Two charged particles are separated by a distance of .99m. If the charge on particle one is .00045C and the charge on particle two is .0000032C. What is the amount of force between them?

Answers

Answer:

The force between the two charges will be 13.22N.

Explanation:

The force between the two charges is given by Coulombs law which says

[tex]F = k\dfrac{Q_1Q_2}{R^2}.[/tex]

In our case

[tex]Q_1= 0.00045C[/tex],

[tex]Q_2 = 0.0000032C[/tex],

[tex]R = 0.99m[/tex].

therefore,

[tex]F = (9*10^9)\dfrac{(0.00045C)(0.0000032C)}{(0.99m)^2}.[/tex]

[tex]\boxed{F=13.22N}[/tex]

Hence, the force between the two charges will be 13.22N.

A _______ is a tool often used to measure the amount of force exerted by an object

Answers

Answer:

Force meter

Explanation:

Answer:

.o.o

Explanation:

678

In this diagram, the Moon is directly in front of the Earth. What would MOST LIKELY happen if the moon was not directly in front of the Earth? A) There would be a total solar eclipse. B) There would not be a solar eclipse. C) There would be a partial eclipse. D) There would be a lunar eclipse.

Answers

Answer: C There would be a partial eclipse.

Explanation:

Partial solar eclipses happen when the Moon comes between the Sun and Earth, but the Moon only partially covers the Sun's disk. When this occurs, the Moon, the Sun and Earth don't align in a perfectly straight line, and the Moon casts only the outer part of its shadow on Earth. This happens when only a portion of the Sun is blocked by the Moon. It occurs when the observer is within the penumbra.

Answer: C partial eclipse

Explanation:

got it right:)

The iron ball is suspended from a box that floats in water.The box has a height of 5.00 cm, a face area of 10.0 cm​2​, and a density of 0.30 g/cm3, and 2.00cm of its height is above the water surface. What’s the radius of the ball?

Answers

Answer:

The iron ball is suspended from a box that floats in water. The box has a height of 5.00 cm, a face area of 10.0 cm ​ 2 ​ , and a density of 0.30 g/cm3, and 2.00 cm of its height is above the water surface. What’s the radius of the ball? Hints: ❏ Identify all forces acting on the box and write Newton’s second law. ❏ The box is stationary, which means the forces (including buoyant force) are balanced. You can use this to find tension in the rope. ❏ Identify all forces acting on the ball and write Newton’s second law. ❏ Iron ball is stationary, which means the forces (including buoyant force) are balanced.

Step by step:

please help i need an explanation

Answers

Answer:

--

Explanation:

All potential and kinetic energy is transferred into heat. Therefore keeping the law of conservation of energy valid. No energy is created nor destroyed only changing shape.

a car is moving at 5.82 m/s when it accelerates 2.35m/s^2 for 3.25s. what is its final velocity?

Answers

Answer: 13.46 m/s

Explanation:

Initial velocity V1 = 5.82 m/s

acceleration A = 2.35m/s^2

Time taken T = 3.25s

Final velocity V2 = ?

Recall that acceleration is the rate of change of velocity per unit time i.e acceleration = (V2 - V1)/T

2.35m/s^2 = (V2 - 5.82 m/s) / 3.25s

cross multiply

2.35m/s^2 x 3.25s = (V2 - 5.82 m/s)

7.6375m/s = V2 - 5.82 m/s

V2 = 7.6375m/s + 5.82m/s

V2 = 13.46 m/s

Thus, the car final velocity is 13.46 m/s

Answer:

The final velocity is 13.5m/s

Explanation:

a = (v-u)/t

2.35 = (v-5.82) / 3.25

7.6375 = v - 5.82

v = 7.6375 + 5.82

v = 13.5 m/s

Explain why the stars look different between Jane and John

Answers

To summarize, Jane's star has a red light and is traveling towards the earth while John's star star has a blue light and is traveling away from the earth. ... The stars look different because they are traveling in different directions.

how many protons make an atom

Answers

Answer:

The atomic number is the number of protons in an atom of an element. In our example, krypton's atomic number is 36. This tells us that an atom of krypton has 36 protons in its nucleus.

Explanation:

Depends on what kind of atom it is. The number of protons can be seen in the periodic table as the atomic number. The number of proton within an atom is always equal to the number of electron.

It takes 3 minutes to make toast in a 1500 watt toaster. Calculate how much work is done by the toaster.

Answers

Answer: 2.7 x 10^5 joules

Explanation:

Given that:

Time taken = 3 minutes

convert time in minutes to seconds

(Since 1 minute = 60 seconds

3 minutes = 3 x 60 = 180 seconds)

Power of toaster = 1500 watt

Work done by the toaster = ?

Recall that power is the rate of work done per unit time

i.e Power = work/time

work = Power x Time

Work = 1500 watt x 180 seconds

Work = 270000J

Place the result in standard form

270000J = 2.7 x 10^5J

Thus, 2.7 x 10^5 joules of work is done by the toaster.

please help i don’t get this

Answers

Answer:

i think it is with friction because when we move we go against friction so like when were walking friction is trying to decrease our speed

Explanation:

Define temperature using molecular theory

Answers

Answer: At the molecular level, temperature is related to the random motions of the particles (atoms and molecules) in matter. ... The temperature of the puddle, or of any object, is a measure of the average of the individual translational energies of all of its atoms or molecules.

Explanation: my science teacher already tought us this

Clearly, temperature has to do with the kinetic energy of the molecules, and if the molecules act like independent point masses, then we could define temperature in terms of the average translational kinetic energy of the molecules, the so-called "kinetic temperature".

Calculate the braking distance for a vehicle traveling at 30 mi/h (13.4 m/s) with an acceleration of - 9.0 (m/s)/s while breaking.

Answers

Answer:

Braking distance of vehicle is 9.97 m

Explanation:

It is given initial velocity of the vehicle u = 13.4 m/sec

Acceleration of the vehicle [tex]a=-9m/sec^2[/tex]

As the vehicle finally stops so final velocity of the vehicle v = 0 m/sec

We have to find the braking distance s

From third equation of motion

[tex]v^2=u^2+2as[/tex]

[tex]0^2=13.4^2+2\times -9\times s[/tex]

s = 9.97 m

So braking distance of the vehicle is 9.97 m

Why is photosynthesis important to the biosphere? *
A. It produces oxygen for animals to breathe
B. It produces sugars for animals to eat
C. It gets rid of carbon dioxide
D. All of these
dont answer unless its the real answer please

Answers

Answer:

I picked all of these for a assignment I did.

Explanation:

88 kg fullback moving east with a speed of 5.0 m/s is tackled by a 97 kg opponent running west at
3.0 m/s, and the collision is perfectly inelastic. What is the speed of the players just after the tackle?
A) 149 m/s
B) 23.1 m/s
C) 7.31 m/s
D) 0.81 m/s​

Answers

I think it is b. 231 ms

The speed of the players just after the collision is (D) 0.81 m/s

Inelastic collision:

Given that the mass of the fullback is m = 88kg

mass of the opponent, M = 97 kg

speed of the fullback, u = 5 m/s

speed of the opponent, U = 3 m/s

In an inelastic collision, the two bodies move together at the same speed and the total momentum of the system remains conserved.

Let the final speed be v, then by conserving the momentum we get:

mu - MU = (m + M)v

Since the opponent must be moving in opposite direction to the fullback, therefore his momentum is -MU.

88×5 - 97×3 = (88 +97)v

149 = 185v

v = 0.81 m/s

So both the players move with a speed of 0.81 m/s

Learn more about inelastic collision: https://brainly.com/question/2356330?referrer=searchResults

Help ASAP!!!!
If the hydroxide ion (OH-) concentration is greater than the hydronium ion (H3O+) concentration, then what is the solution?

A.
acidic

B.
basic

C.
neutral

D.
salty

Answers

If the hydroxide ion (OH-) concentration is greater than the hydronium ion (H3O+) concentration, then the nature of the solution would be basic, therefore the correct answer is option B.

What is a Chemical compound?

A chemical compound is a combination of two or more either similar or dissimilar chemical elements.

If the hydroxide ion (OH-) concentration is equal to the hydronium ion (H3O+) concentration then the nature of the solution would be neutral.

The correct response is option B because the nature of the solution would be basic if the concentration of hydroxide ions (OH-) is higher than that of hydronium ions (H3O+).

                         

To learn more about a chemical compound here, refer to the link;

brainly.com/question/12166462

#SPJ2

Which lenses are convex? Check all that apply. 1 2 3 4 5 6

Answers

Answer:

1,2,3,6

Explanation:

This is correct because i took the quiz and got it correct

1 2 3 and 6 are convex lenses.

What is convex lenses?The convex lens is a lens that converges rays of light that convey parallel to its principal axis (i.e. converges the incident rays towards the principal axis) which is relatively thick across the middle and thin at the lower and upper edges. The edges are curved outward rather than inward.

To learn more about The convex lens refer:https://brainly.com/question/26961264

#SPJ2

what should i do if i'm stuck at home? Any thing except watching movies and going to sleep

Answers

card games

board games

bird watch

write a song

make a game

count stuff

throw a ball with someone

play outside

Elevation and the presence of features such as mountains and rivers make up an area’s

Answers

Answer:

valley

Explanation:

a valley is the space between two mountains and may comprise a river as well

how much energy is required to move a 4.00-microcoulomb charge through a potential difference of 36.0 volts?

Answers

Answer:

1.44 X 10^-4J

Explanation:

V=w/q =605/sc=12V

The energy required to move a 4.00-micro coulomb charge through a potential difference of 36.0 volts will be 1.44 X 10⁻⁴ J.

What is the electrical potential difference?

The amount of work performed in an electrical field to move a unit charge from one location to another is defined as the electrical potential difference.

The given data in the problem is;

W is the energy =?

q is the charge = 4.00-microcoulomb

V is the potential difference = 36.0 volts

The electric potential is the ratio of electric potential energy and charge.

[tex]\rm V= \frac{W}{q} \\\\\ W=Vq \\\\ W= 36.0 \times 4.00 \times 10^{-6} \\\\ W=144 \times 10^{-6} \\\\ W=1.44 \times 10^{-4}[/tex]

Hence the energy required will be 1.44 × 10⁻⁴ J.

To learn more about the electric potential difference refer to the link;

https://brainly.com/question/9383604

Which of the following is an example of a pull? A. Doing pushups b. Playing catch with a baseball c. Walking up a staircase d. Reeling in a fish with a fishing pole

Answers

Answer:

D, reeling in a fish

Explanation:

Answer:the answer is D. Reeling in a fish with a fishing pole

Explanation:

you have to pull on the fish with the fishing pole in order to catch the fish

hope this helps

mark brainliest please

Which of the following best explains why the tidal bulges on Earth are larger closest to the Moon compared to the tidal bulges closest to the Sun?

A) The Moon is closer to Earth than the Sun
B) The Moon has a greater mass than the Sun
C) The Sun has a greater mass than the Moon
Eliminate
D) The Sun is closer to Earth than the Moon

Answers

Answer:

C. because the moon is closer so it buldges or looks bigger

Explanation:

1. The experiment shown below is finished. What can you conclude from these results?

Daily water: 90 mL

Daily water: 50 ml

Daily water: 10 mL

Seed C

Seed C

Seed C

Sprouts: 16

Sprouts 12

Sprouts: 0

Heat: Medium (24 °C)

Heat: Medium (24 °C)

2

Heat: Medium (24 °C)

3

O A. Seed C germinates more with more light

O B. Seed C germinates more with less light.

O C. Seed C germinates more with more water.

OD Seed Caerminates more with less water.

Answers

Answer:

C. Seed C germinates more with more water.

Explanation:

In this experiment, the seed (seed C) was subjected to certain conditions and the result is what has been presented for us to make an inference.

We observe the following from the information given us:

I. the same seeds were used for the experiment

II. the same heat medium of 24 °C was used for all the seeds

III. different daily amount of water was supplied the seeds - 90 ml, 50 ml and 10 ml

From the experiment, we have this result:

the seed that was watered with 10 ml daily did not sprout anything, the seed that was watered with 50 ml daily yielded 12 sprouts while the seed that was watered with 90 ml daily yielded 16 sprouts

When we consider the amount of water given the seed & the produce of the seed, it is safe to conclude that with increase in daily water, there is increase in the number of sprouts by the seed

Hence, C. Seed C germinates more with more water is the correct answer

Final answer:

The given experiment shows that Seed C's germination is directly proportional to the amount of water it receives. More water results in more sprouts.

Explanation:

From the given experiment results, the conclusion can be drawn that Seed C germinates more with more water. This is evident as the seed sprouted 16 times with a daily water method of 90 mL, 12 times with 50 mL, and not at all with 10 mL. So, the amount of sprouts is directly proportional to the amount of water provided, the more the water, the more the sprouts. This supports the option that Seed C germinates more with more water. Also, the heat was kept constant to ensure that it doesn't affect the experiment results.

Learn more about Seed Germination here:

https://brainly.com/question/23561613

#SPJ3

A 600kg car is at rest , and then accelerates to 5n/s what is the original kinetic energy?

Answers

m = 600 kg
u = 0 (as the car was at rest initially)
v = 5 m/s
Initial kinetic energy = ½mu²
= ½×600×0
= 0
Final kinetic energy = ½mv²
= ½×600×25
= 7500 J

Which of the following is a part of the digestive system

Answers

The Pancreas

Is an inflammation organ that lies in the lower part of the stomach which plays a big part in the digestive system.

Answer:

The hollow organs that make up the GI tract are the mouth, esophagus, stomach, small intestine, large intestine, and anus. The liver, pancreas, and gallbladder are the solid organs of the digestive system.

Have a good day! :D

Other Questions
A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units? What is the value of a? Word bank:borrarchrtercorreo basuraen lneaesnobestrsGUSTAVO Voy a leer el correo electrnico.REBECA Bah, yo slo recibo ____________. Lo nico que hago con la computadora es ________________ mensajes.GUSTAVO Mira, cario, hay un anuncio en Internet: un viaje barato a Punta del Este. Es un vuelo ___________________.REBECA ltimamente tengo tanto ____________________. Sera buena idea que furamos de vacaciones. Pero busca un hotel muy bueno.GUSTAVO Rebeca, no seas ___________________, lo importante es ir y disfrutar. Voy a comprar los boletos ahora mismo ______________________. IM giving 15 points please help!a 42 meter lighthouse is observed by a ships officer at a 65 degree anlge to a path of the ship. At the next sighting, the lighthouse is observed at a 42 degree angle. To the nearest meter what is the distance between the 2 sightings? What made Jake suspicious about the man with the camera?he was wearing dark glasseshe took a photo of themhe was the same man who sold Jake the maphe had followed them all dayIts C