Final answer:
One half or one rod of condensed chromatin is known as a c) chromatid. The two identical halves of a chromosome are sister chromatids, and they are connected at a structure called the centromere. The first level of DNA organization is aided by histones.
Explanation:
One half of condensed chromatin is called a chromatid. During the cell cycle, specifically after the DNA has replicated during the S phase, eukaryotic DNA condenses and coils into an X-shaped structure known as a chromosome. This chromosome is composed of two identical parts referred to as sister chromatids. These sister chromatids are held together at a region termed the centromere. Before the cell proceeds to division through mitosis, these chromatids are attached at their centromeres, and they will eventually separate to be allocated to each daughter cell.
The correct answer is C. chromatid. Furthermore, in a eukaryotic cell, the first level of DNA organization is maintained by histones which help package the DNA into structural units called nucleosomes. The histones and chaperone proteins aid in condensing the DNA and preventing it from becoming tangled.
Please answer!!!!! What is the best description of the role of decomposers in the carbon cycle?
A. They release the carbon that remains in the bodies of dead organisms.
B. They absorb carbon from carbon dioxide in the atmosphere.
C. They change carbon dioxide into a form that organisms can use.
D. They prevent carbon from escaping into the atmosphere.
Answer:
D.They prevent carbon from escaping into the atmosphere.
Explanation:
They absorb carbon from carbon dioxide in the atmosphere. They change carbon dioxide into a form that organisms can use.
Hope this helps! : )
According to the text, which statement best describes stem cells? A Stem cells hold genes that send messages to the brains of babies. B Stem cells can change into specific cells and then turn back into stem cells again. C Stem cells are undifferentiated cells that can become any other kind of cell. D Stem cells first develop in adults and are passed on to their offspring.
Stem cells are undifferentiated cells that have the potential to develop into different cell types and are important in the body's development and repair.
Explanation:According to the text, stem cells are undifferentiated cells that can become any other kind of cell. Stem cells have the ability to differentiate into various cell types and can be found in both embryos and adult tissue. They play a crucial role in the development and repair of the body by replenishing damaged or lost cells. Unlike other cells, stem cells can self-renew and maintain their undifferentiated state, making them valuable resources for medical research and potential therapies.
Learn more about Stem Cells here:https://brainly.com/question/34281766
#SPJ11
The different from of a gene for a given trait are called
Their called Alleles
Answer:
Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism.
Explanation:
How would a change to the sequence of nucleotides in a DNA segment affect the
mRNA transcribed from the DNA?
Answer:
The mRNA that was transcirbed determines what amino acid would be attached.
Explanation:
For instance, lets say the complementery mRNA codon said GAU, the amino acid assosioted with this codon is aspartic acid. If the sequence were to change to GAA then the amino acid would be glutamic acid. I hoped this helped! If need any clarifications tell mehhhhh!!
Yes, any change in the gene sequence WILL AFFECT the mRNA transcribed from the DNA. However, a change in the mRNA sequence MAY or MAY NOT affect the protein translated from the mRNA.
During gene transcription, a fragment of DNA is used as a template to create an exactly complementary messenger RNA (mRNA) sequence.
In consequence, any change in the DNA nucleotide sequence will produce a change in the complementary mRNA sequence.
Subsequently, this mRNA travels to the ribosome where it is used as a template to create a protein by a process called 'translation'.
During translation, triplets of nucleotides or 'codons' are read by the ribosome in order to add specific amino acids in the nascent polypeptide chain.
There are codons that encode for the same amino acid, thereby a change in the mRNA sequence may or may not produce changes in the protein synthesized from the mRNA. It is for that reason that the genetic code is said to be redundant.
In conclusion, any change in the gene sequence WILL AFFECT the mRNA transcribed from the DNA. However, a change in the mRNA sequence MAY or MAY NOT affect the protein translated from the mRNA.
Learn more in:
https://brainly.com/question/7239640?referrer=searchResults
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Answer:
1) The right end is the 5' region and the left end is the 3' region
2) 5'-UAACGGUGCAUCGAUAGCAUGC-3
In superheroes, the ability to Fly (F) is dominant over not being able to fly (f). Superman can fly (Ff) (he has one dominant and one recessive trait). He marries Storm (from the X-men) who also has one dominant and one recessive trait (Ff), and can fly.
Answer:
Probability that the descendents are able to fly: 3/4Probability that the descendents are not able to fly: 1/4
Explanation:
The question is incomplete.
We can build a Punnett square to find the offspring and then determine the probability that the descendents inherit the ability to fly.
Superman's genotype: FfStorm's genotype: FfWrite the columns and rows titles:
F f ← Superman's genes
F
f
↑
Storm's genes
Fill in the cells with the possible combinations:
F f
F FF Ff
f Ff ff
Homozygous FF: 1 can fly
Heterozygous Ff: 2 can fly
Homozygous ff: 1 cannot fly
Total: 4
Probabilities:Homozygous FF: 1/4 can fly
Heterozygous Ff: 2/4 can fly
Homozygous ff: 1/4 cannot fly
Able to fly: 1/4 + 2/4 = 3/4Not able to fly: 1/4
Since the ability to fly (F) is dominant, the heterozygous Ff descendents are able to fly. That is 3/4.
Only the homozygous ff are not able to fly. That is 1/4.
If a mixture of these three substrates was presented to elastase with the concentration of each peptide equal to 0.5 mMmM, which would be digested most rapidly? Which most slowly? (Assume enzyme is present in excess
Answer:
If we take the Kcat / KM ratios, we find that PAPAF would be digested more quickly and PAPAG would be slower.
Explanation:
It is important to highlight that elastase is an enzyme that is not only in humans, to degrade elastic fibers, but is also in microorganisms as a virulence factor for the invasion of tissues in our body in less time and in a more destructive way.
A scientist wants to turn a group of specialized cells into stem cells. Which type of cell should be choose?
To revert specialized cells to stem cells, induced pluripotent stem cells (iPSCs) technology is utilized, where adult cells are genetically reprogrammed to a pluripotent state.
To turn specialized cells back into stem cells, a scientist should use methodologies to create induced pluripotent stem cells (iPSCs). iPSCs are genetically reprogrammed adult cells that regain pluripotency, which means they can differentiate into any cell type from the three germ layers. There are several types of stem cells used in research, including embryonic stem cells (pluripotent) and adult stem cells (multipotent). However, iPSCs provide a unique advantage as they can be created from the patient's own specialized cells, which potentially reduces the risk of rejection if used for therapeutic purposes.
An essential step in creating iPSCs involves reprogramming the specialized cells by introducing factors that reset their gene expression profiles. This process makes the cells revert to a state similar to that of embryonic stem cells. In the laboratory, iPSCs are then grown under specific conditions that allow them to maintain their undifferentiated state or to be differentiated into the desired specialized cell type.
during photosynthesis,energy from sunlight is used to start a reaction. And water.
Answer:
Photosynthesis uses light energy to convert carbon dioxide and water into glucose and oxygen gas
Explanation:
Each molecule of glucose essentially “stores” up to 38 molecules of ATP which can be broken down and used during other cellular reactions. ATP, or adenosine triphosphate, is the form of chemical energy cells use to function.
Answer:
1.carbon dioxide
2.glucose
3.oxygen
Explanation:
which plane velocity was greatest? Yeagers Bell x-1, The Concorde, SR71 blackbird, none they all traveled at the same speed.
Answer:
The SR-71 Blackbird.
Explanation:
The Lockheed SR-71 "Blackbird" was an American strategic reconnaissance aircraft that traveled at over mach 3, or 3 times the speed of sound. The Concorde was a French passenger jet with a top speed of just over mach 2. The Bell X-1 was the first supersonic test plane and had to be dropped from a larger plane to reach altitude.
The plane velocity of SR71 blackbird was the greatest. The correct option is C.
What is velocity?The directional speed of an item in motion, as measured by a specific unit of time and observed from a certain point of reference, is what is referred to as velocity.
Velocity is the pace and direction of an object's movement, whereas speed is the time rate at which an object is travelling along a path. In other words, velocity is a vector, whereas speed is a scalar value.
The SR 71 Blackbird is the fastest piloted aircraft. (Some unmanned vehicles have moved more quickly.) It has moved at a 936 m/s speed. This is Mach 3, or roughly three times the speed of sound.
Thus, the correct option is C.
For more details regarding velocity, visit:
https://brainly.com/question/18084516
#SPJ2
What type of cell would meosis occur?
Answer:takes place in the cell nuclei of eukaryotic cells that are related to reproduction. Cells not associated with reproduction are called somatic cells, and cells associated with reproduction are known as gamete cells.
Explanation:
it's true
How are the two life cycles different between humans and plants regarding any dominant stages, internalization, and how fertilization happens?
In human life cycles, the dominant stage is the diploid and fertilization is internal. However, plant life cycles commonly involve alternation of generations with a dominant diploid stage and external fertilization that involves pollinators.
Explanation:The life cycles of humans and plants show significant differences. In humans, the dominant stage is the diploid, which is the stage after fertilization and encompasses most of a human's life. Human fertilization is internal and involves the fusion of a male sperm and a female egg within a woman's body. It becomes a zygote, which evolves into a multicellular organism through cell division.
In plants, particularly among angiosperms, the life cycle involves alternation of generations. The diploid (2n) sporophyte is usually the dominant and noticeable stage. The sporophyte develops spores through meiosis which germinate into a gametophyte (n). The gametophyte may produce eggs in archegonia and sperm in antheridia, and fertilization results in a zygote that develops into a sporophyte. Notably, the fertilization in plants is external, with pollen containing sperm cells transferring to eggs by wind, insects or other pollinators.
Learn more about Life Cycles here:https://brainly.com/question/31945588
#SPJ3
An orange tree is an example of a because it contains seeds in fruit.
Answer:
flowering plant
Explanation:
Answer:
Flowering plant
Explanation:
It contains seeds in the fruit.
Which image represents cytokinesis in an animal cell
Answer:the third image represents
Explanation:
Cytokines is the third image
True or false in terms of symmetry, the human body is radically symmetrical
Answer:
False
Explanation:
Humans and most animals exhibit "bilateral symmetry"
Part A The Cell Theory states that:
Choose all that apply, and keep in mind that just because a statement is accurate does not necessarily make it a correct response to a question being asked. Choose all that apply, and keep in mind that just because a statement is accurate does not necessarily make it a correct response to a question being asked.
A. on early earth, the surface to volume ratio of the cell was much larger because the percent oxygen in the air was much less
B. all living things are composed of cells.
C. viruses are considered living things, but only in some cases
D. cells have more DNA in them in G2 than in G1
E. all cells arise from preexisting cells
F. the cell is the fundamental unit of life.
G. prions are living things
Answer:
The following statements are true and are relevant to The Cell Theory:
B. all living things are composed of cells.
E. all cells arise from preexisting cells
F. the cell is the fundamental unit of life.
Explanation:
Although lower percentage of atmospheric oxygen in earlier times (220 million years ago) is true, it is not possible that the ratio was "much larger" than what it is today.
Option C is correct but not pertinent to the cell theory. Viruses are considered as living things once they are inside a host.
G1 and G2 are growth phases and have the same amount of DNA in them. It is during the mitotic phase that the DNA is increased. Hence, option D is incorrect.
Option G is false as well. Prions are not considered as living things, they are just proteins that can cause infections.
Hope that answers the question, have a great day!
Bio Stuff. PLeae help
Plz Help if anyone know this I’m really struggling especially because this question is just 50 points it’s self.
Answer: The inner planets are Mercury, Venus, Earth, and Mars
Explanation:
The inner planets are also called the terrestrial planets by astrologers. This is because they have a distinguished characteristics which make them.distinct from the outer plantets. They are small Rocky planets and they are made up of silicate , iron and nickel metal.
These planets are arranged based on their distance from the sun i.e from the closet to the sun to there farthest.
They are Mercury, Venus, Earth and Mars.
Cells only synthesize DNA from the 5′ to the 3′ end, and since double-stranded DNA is complementary, both strands cannot be replicated in the same way. How do cells handle this situation? View Available Hint(s) Cells only synthesize DNA from the 5′ to the 3′ end, and since double-stranded DNA is complementary, both strands cannot be replicated in the same way. How do cells handle this situation? The lagging strand is not synthesized at this point. The lagging strand must be synthesized in smaller units that are ultimately attached by the action of DNA ligase. Okazaki fragments are synthesized from both the leading and lagging strands. The lagging strand undergoes a conformational change to make a hairpin structure, which allows DNA synthesis in the proper order.
Answer:
The lagging strand undergoes a conformational change to make a hairpin structure, which allows DNA synthesis in the proper order.
The lagging strand must be synthesized in smaller units that are ultimately attached by the action of DNA ligase.
Explanation:
For DNA synthesis to occur on the lagging template strand, the lagging template strand is oriented in such a way that it forms an hairpin structure with the SSB proteins still in place.
This allows the structure to be in corformation with the rest replisome machinery and also allow the synthesis of DNA in the 5'-3' direction forming okazaki fragments in a discontinous backstitching mechanism which are then sealed toghether by the enzyme Ligase.
Which of the following statements is correct? Which of the following statements is correct? The heart is ventral to the breastbone. The heart is posterior to the spine. The breastbone is posterior to the spine. The breastbone is ventral to the spine
Answer:
The correct is, the breastbone is anterior (ventral) to the spine.Explanation:
1. Anterior; it means that something is towards the front of the body or is more towards the front of the body than something else.
2. Posterior: the word posterior means that something is towards the back of the body or more towards the back of the body than another thing when comparing two different structures.
For example, our breastbone, is anterior to our spine, and our spine is posterior to our breastbone, since the breastbone is towards the front of our body and the spine is toward the back of our body.
The correct statement is: 'The heart is ventral to the breastbone'. 'Ventral' refers to the front side of the body. Therefore, the heart is located in front of the breastbone. Other statements are incorrect based on anatomical orientations.
Explanation:The correct statement is: 'The heart is ventral to the breastbone'. In anatomical terminology, 'ventral' refers to the front side of the body.
Therefore, when you say the heart is ventral to the breastbone, you're saying the heart is located in front of the breastbone (or sternum), which is correct. The heart is not posterior (behind) the spine as the heart is located in between the lungs, slightly towards the left.
Similarly, the breastbone is not posterior to the spine, but is in front of it. So, it is not correct to say 'The breastbone is ventral to the spine' as the breastbone is dorsal (towards the back) to the spine.
Learn more about Anatomical Orientation here:https://brainly.com/question/35495394
#SPJ6
What would be the most likely effect on the transcription of the trp structural genes for the mutation scenarios provided? mutation that prevents ribosome binding to the mRNA 5' UTR mutation that changes region 1 tryptophan codons into alanine codons mutation that creates a stop codon in region 1 of mRNA 5' UTR deletions in region 2 of the mRNA 5' UTR deletions in region 3 of the mRNA 5' UTR deletions in region 4 of the mRNA 5' UTR deletion of the string of adenine after region 4 of the mRNA 5' UTR
Answer:
I've responded to each scenario individually, please see below:
1. mutation that prevents ribosome binding to the mRNA
No transcription occurs
2. 5' UTR mutation that changes region 1 tryptophan codons into alanine codons
Transcription when alanine is low
3. mutation that creates a stop codon in region 1 of mRNA 5' UTR
Transcription occurs, a truncated protein will be made during translation
4. deletions in region 2 of the mRNA 5' UTR
Transcription occurs, region 1 and 2 might get paired together
5. deletions in region 3 of the mRNA 5' UTR
Transcription occurs, region 3 and 4 could combine to form a hairpin loop structure
6. deletions in region 4 of the mRNA 5' UTR
Transcription occurs, region 3 and 4 could combine to form a hairpin loop structure
7. deletion of the string of adenine after region 4 of the mRNA 5' UTR
Transcription occurs, however, it will not be as stable a molecule because of losing its polyA tail
Hope that answers the question, have a great day!
Answer:
Explanation:
Trp structural genes are the genes that make up the trp operon. This operon encodes genes that leads to the production of enzymes that aids in the synthesis of tryptophan. the operon is made up of five structural gens, trp A, B, C, D, E. Attenuation is a mechanism that causes premature termination of transcription of the trp operon when tryptophan is abundant.
Mutation that prevents ribosome binding to the mRNA: Transcription of the trp structural genes will not occur. there will be no gene expression will occur.
5' UTR mutation that changes region 1 tryptophan codons into alanine codons: If alanine codons have replaced tryptophan codons, then under conditions of low alanine, the stalling of the ribosome will not occur. The attenuator will form, stopping transcription.
mutation that creates a stop codon in region 1 of mRNA: this will cause the ribosomes to stall there and transcription will not proceed because the attenuator can be formed.
5' UTR deletions in region 2 of the mRNA: If region 2 of the mRNA 5' UTR is deleted, the antiterminator cannot be formed thus allowing formation of the attenuator and transcription stops.
Deletions in region 3 of the mRNA 5'UTR : Attenuation will not occur, and transcription of the trp structural genes will proceed.
Deletions in region 4 of the mRNA 5'UTR : There will be no formation of the attenuator by the 5' UTR mRNA. Transcription will proceed.
Deletion of the string of adenine nucleotides that follows region 4 in the 5'UTR: No termination will occur because for the attenuator to function as a terminator, it requires uracil nucleotides and not adenine following region 4 in the mRNA 5' UTR.
Pleaes help. Bio stuff
Answer:
Blue eyes
Explanation:
The punnet square would depict two heterozygous parents for brown eyes (Bb)
[tex]\left[\begin{array}{ccc}BB&Bb&\\Bb&bb\\\end{array}\right][/tex]
The punnet square would look like that, which shows the genotype for each offspring.
The genotype bb is responsible for the phenotype blue eyes
Identify true statements about the synthesis of various lipids.
a. Triacylglycerols are synthesized by adding fatty acid groups to a glycerol backbone.
b. The triacylglycerol biosynthetic pathway provides the precursors for the synthesis of glycerophospholipids.
c. Glycerophospholipids may be synthesized from diacylglycerols.
d. Triacylglycerols are synthesized by adding ketone bodies to a glycerol backbone.
e. Arachidonate is a precursor in the synthesis of prostaglandins.
f. The glycerophospholipid biosynthetic pathway provides precursors for the synthesis of triacylglycerols.
In lipid synthesis, triacylglycerols are formed by adding fatty acids to a glycerol backbone, not ketone bodies. Glycerol-3-phosphate, the starting molecule in triacylglycerol synthesis, is also a precursor for glycerophospholipid synthesis. Diacylglycerols can form glycerophospholipids, and arachidonate is a precursor for prostaglandins. The glycerophospholipid biosynthetic pathway does not provide precursors for triacylglycerol synthesis.
Explanation:The synthesis of various lipids encompasses diverse processes.
a. The statement 'Triacylglycerols are synthesized by adding fatty acid groups to a glycerol backbone' is true. Fatty acids are attached to a glycerol backbone to form triacylglycerols.
b. The statement 'The triacylglycerol biosynthetic pathway provides the precursors for the synthesis of glycerophospholipids' is true. Glycerol-3-phosphate, the starting molecule in triacylglycerol synthesis, is also a precursor for glycerophospholipid synthesis.
c. The statement 'Glycerophospholipids may be synthesized from diacylglycerols' is true. Diacylglycerols can be further modified to form glycerophospholipids.
d. The statement 'Triacylglycerols are synthesized by adding ketone bodies to a glycerol backbone' is false. Triacylglycerols are not formed by adding ketone bodies to a glycerol backbone; they're formed by adding fatty acids.
e. The statement 'Arachidonate is a precursor in the synthesis of prostaglandins' is true. Arachidonic acid is indeed a precursor for eicosanoid molecules, including prostaglandins.
f. The statement 'The glycerophospholipid biosynthetic pathway provides precursors for the synthesis of triacylglycerols' is false. It's actually the triacylglycerol biosynthetic pathway that provides precursors for the synthesis of glycerophospholipids, not the other way around.
Learn more about Lipid Synthesis here:https://brainly.com/question/31314539
#SPJ2
In which process does RNA polymerase help synthesize mRNA from a DNA template?
RNA polymerase synthesizes mRNA from a DNA template in a process called transcription, which takes place in several phases including initiation, elongation, and termination.
The process in which RNA polymerase helps synthesize mRNA from a DNA template is known as transcription. This process begins with the binding of RNA polymerase to a DNA promoter sequence. The DNA unwinds to form a transcription bubble, where the enzyme reads the template strand of the DNA from 3' to 5', while synthesizing the complementary mRNA strand in the 5' to 3' direction. RNA polymerase uses ribonucleotide triphosphates (rNTPs) to add new nucleotides to the growing RNA chain, and divalent metal ions like Mg2+ are necessary for the catalysis of this reaction. Transcription continues with the elongation phase where RNA polymerase keeps adding nucleotides to the 3' end of the growing strand until it reaches a terminator sequence that signals the end of transcription. The resulting mRNA then undergoes further processing and eventually exits the nucleus to be translated into a protein by ribosomes in the cytoplasm.
For each of the following sentences, fill in the blanks with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. Transporter proteins and ion channels function in membrane transport by providing a ________1__________ pathway through the membrane for specific polar solutes or inorganic ions. A _________2_________ is highly selective in the solute it transports, binding the solute at a specific site and changing conformation so as to transport the solute across the membrane. For an uncharged molecule, the direction of passive transport across a membrane is determined solely by its ________3__________ gradient. On the other hand, for a charged molecule, the _________4_________ must also be considered. The Na K pump is responsible for maintaining high extracellular sodium ion concentrations. This pump carries out a type of transport called _________5_________ . Group of answer choices 1
Answer:
I believe the answer choices are:
passive, symport, free diffusion, hydrophobic, ion channel, hydrophilic, light-driven, passive transport, facilitated diffusion, concentration, amino acid, membrane potential, active transport, transporter protein, noncovalent, amphipathic.
Transporter proteins and ion channels function in membrane transport by providing a 1. hydrophilic pathway through the membrane for specific polar solutes or inorganic ions. A 2. transporter protein is highly selective in the solute it transports, binding the solute at a specific site and changing conformation so as to transport the solute across the membrane. For an uncharged molecule, the direction of passive transport across a membrane is determined solely by its 3. concentration gradient. On the other hand, for a charged molecule, the 4. membrane potential must also be considered. The Na+/ K+ pump is responsible for maintaining high extracellular sodium ion concentrations. This pump carries out a type of transport called 5. active transport.
Explanation:
Polar or water soluble solutes can only interact with the hydrophilic domains of transport proteins.Transporters, along with permeases and carriers, are a type of membrane transport proteins. Transport proteins bind the solute molecules and undergo conformational changes to transfer the molecule across the membrane.Uncharged molecules moves across membranes based on their concentration gradient i.e. the difference of concentration between the intra and extracellular environment. Whereas, charged molecules and ions require a membrane potential to be transported. One example is the Na+/K+ pump.Na+/K+ pump is an ATP dependent ion channel that utilizes the enzyme Na+/K+-ATPase to break down ATP into ADP and inorganic phosphates.Combinatorial control of gene expression a. involves every gene using a different combination of transcriptional regulators for its proper expression. b. is seen only when genes are arranged in operons. c. involves only the use of gene activators that together regulate genes appropriately. d. involves groups of transcription regulators working together to determine the expression of a gene.
Answer:
The true statement will be - D
It is a involvement of groups of transcriptional regulators which work together to determine the expression of a gene.
Explanation:
Combinatorial gene regulation is a mechanism by which small numbers or groups of transcriptional factors or regulators can control the expression of a much larger gene with temporal and spatial patterns.
The process by which a cell regulates the conversion of DNA to RNA to increase gene activity is known as Transcriptional regulation. A single gene can be regulated by altering the RNA which is transcribed.
The gene control allows the cell to respond to a variety of intracellular and extracellular signals.
Combinatorial control of gene expression involves groups of transcription regulators working collectively to regulate the expression of a gene. Every gene can potentially use a unique combination of these regulators for its adequate expression. It's not confined to operons or with the use of only gene activators.
Explanation:The combinatorial control of gene expression refers to a mode of gene regulation where groups of transcription regulators work collectively to determine the expression of a gene. This principle infers that every gene can potentially use a unique combination of transcriptional regulators for its appropriate expression. However, it's not exclusive to genes arranged in operons or involving only gene activators. This control is a complex process which involves both activators and repressors that bind to specific DNA sequences, thereby increasing or decreasing the transcription of genes.
Learn more about Combinatorial Control here:https://brainly.com/question/33439981
#SPJ3
Why do some pigments travel faster along the chromatography strip than others ?
Answer:
Some pigments dissolve in water easier and are pulled with the water farther up the paper.
Others are more attracted to the paper and move more slowly. Usually smaller molecules will move farther than larger ones.
Some of the pigments travel briskly along the chromatography strip in comparison to others based upon their solubility. The more soluble the pigment is the more it will travel, and vice versa.
What is the concept of chromatography?An analytical technique, which is generally used to separate a mixture of chemical substances into its individual constituents based upon their solubility is known as chromatography.
One of the method of chromatography is paper chromatography, in which the substances like chromatography strip is used to separate molecules based upon their different solubilities. One can separate the sample of dissolved pigments with the help of chromatography strip.
In the process, the solvent carries the dissolved pigments as it moves up the paper. In the process, the separation of pigments takes place on the basis of their distinct solubilities in a solvent. The pigments mediates at distinct rates due to their distinct solubility. The most soluble pigment will travel the greatest distance, and a pigment, which is less soluble will move a shorter distance.
Thus, some of the pigments travel faster along the chromatography strip based upon their solubilities.
Find out more information about chromatography here:
https://brainly.com/question/5632230
. What are, and what are the distinguishing characters, of the two major groups of Protostomes? 2. Look at the phylogeny of the Lophotrochozoans. Identify the taxa possessing a lophophore. What does that imply about the evolution (loss or gain) of this trait?
Answer:
a)Lophotrochozoam
Many free living things larvaeSeveral groups has lophophoreNearly all animals are sessile adultsb)Ecdyozoams
Phyla where the organisms molt their outer layer for growth.Which of the following among A-D is false concerning animal viruses? A) During the courses of an influenza virus infection, flu virus proteins are likely to be found in the nucleus, host cell membrane, and cytosol. B) The type of life cycle an animal virus possesses is mostly determined by its genome type C) Lambda phage can form a prophage; an equivalent animal virus type like this would be a retrovirus D) Interferons are produced by certain hosts to defend against animal viruses E) None of A-D is false; all are true
Answer:E. None of A-D is false; all are true
Explanation: virus protein are most likely to be found in nucleus, cytosol and host membrane during the cause of an influenza because the virus first penetrate the cytosol before it RNA are transported to the nucleus where transcription and replication of the viral RNA occurs. Every other option is correct
occurs when nearby objects obstruct the solar radiation to the PV module.
Answer:
dem points forgive me
Explanation:
runj u jik mii