What is typically attached to the acceptor end of a tRNA?
a. a protein
b. an amino acid
c. a ribosome
d. a nucleosome

Answers

Answer 1

Answer:

The correct answer is b.  an amino acid

Explanation:

A tRNA is called adaptor RNA which have cloverleaf-like secondary structures. These structures contain stems and loops which make up the acceptor arm, anticodon stem and loop, D- stem and loop, and T- stem and loop.

Acceptor arm contains seven base pairs and four single stranded nucleotide which include conserved CCA sequence. The function of acceptor arm is attach amino acids require for  protein synthesis.

The anticodon loop gives information to acceptor to attach a specific amino acid according to the sequence present in mRNA. The first amino acid which attaches to acceptor arm is methionine.

Thus, the correct answer is b. an amino acid.


Related Questions

Describe the role of chiasmata in chromosome segregation during meiosis.

Answers

Explanation:

The phase of Prophase I of meiosis is very long and divided into 5 subphases: Leptotene, Zygote, Pachytene, Diplotene, and Diakinesis. During a phase of the Diplotene, the degree of condensation is high, which allows individualizing the sister- chromatids that remain attached by the cohesins. The synaptonemal complex disintegrates, and from the centromeres begins a repulsion between homologous chromosomes, which remain associated only with the places where they occur as permutations.

These sites are called chiasmas (Greek, crossed) because they show the crossover of homologous chromatids. Chiasmas represent the cytological finding of the occurrence of permutation. The presence of at least one bivalent chiasm is essential to ensure the correct segregation of the homologous chromosomes in anaphase I.

The antibiotic ciprofloxacin often is prescribed for serious cases of food poisoning caused by the bacterium Campylobacter jejuni, which is common in the intestines of farm animals and is not harmful to them, but may cause acute food poisoning in humans. Which of the following is correct given prolonged use of this antibiotic?
(A) Prior to antibiotic treatment, most Campylobacter are ciprofloxacin-resistant.
(B) Ciprofloxacin treatment kills or halts the growth of the sensitive strains, yet the resistant strains survive.
(C) Repeating the treatment of the same patient or a population multiple times results in a strain of Campylobacter that is more susceptible to the antibiotic.
(D) Treatment with ciprofloxacin causes the patient to evolve resistance such that the next time the patient gets an infection, it will no longer be effective.

Answers

Answer:

(B) Ciprofloxacin treatment kills or halts the growth of the sensitive strains, yet the resistant strains survive.

Explanation:

Campylobacter jejuni is the causal agent of the food-borne infection with the highest incidence in Europe. Both poultry and wild birds are a major reservoir of the bacteria, the bacteria lives in the intestines of warm blooded animals but is only quite harmful to humans. It has been identified that the diversity fo genes is responsible for its resistance to antibiotics.

Describe the sliding filament theory of muscle contraction. Be sure to use the terms actin and myosin in your answer.

Answers

Answer:

The sliding filament theory is the illustration that how the contraction of muscles takes place in order to generate force. At the start of the process, the motor neuron instigates an action potential or impulse to pass down a nerve cell to the neuromuscular junction. This activates the sarcoplasmic reticulum, which discharges calcium into the cells of the muscles.  

When calcium comes within the muscle cells, it combines with troponin, thus, permitting the binding of actin with myosin. The actin and myosin bind with each other and form cross-bridges, which further contracts by utilizing ATP as the source of energy.  

ATP is manufactured again, thus, permitting actin and myosin to sustain their strong binding condition. Relaxation takes place when stimulation of the nerve ceases. Calcium is then moved back within the sarcoplasmic reticulum dissociating the association between the actin and myosin.  

The actin and myosin go back to their unbound condition making the muscle to relax.  

Differentiate among somatic cells, gametes, and zygotes with regard to the number and origin of their chromosomes.

Answers

Answer:

Somatic cells are the ones obtained by mitosis. They constitute the body tissues and have a variety of different functions. They are diploid, which means they have two copies of each chromosome (2n), one obtained from the father and one from the mother.

Gametes are obtained by meiosis. A diploid cell divides to form four haploid gametes, they have a single copy of each chromosome (n), obtained from the parent cell.

Zygotes are obtained by the fusion of two gametes, one from the father and one from the mother, they are diploid again having two copies of each chromosome.

How many lobes are found in Bufo Marinus liver?
a. One
b. Two
c. Three
d. Four

Answers

Answer:

c. Three

Explanation:

There are  3 lobes found in Bufo Marinus liver.

The right lobe, the left anterior lobe, and the left posterior lobe.

The liver is not primarily an organ of digestion, it does secrete a digestive juice called bile.

In a short essay (100–150 words), explain how genetic information—along with an understanding of the process of descent with modification—enables scientists to reconstruct phylogenies that extend hundreds of millions of years back in time.

Answers

Answer:

Evolutionary biology illustrates both the pattern and processes. The processes of evolution are natural selection and other mechanisms, which modifies the genetic structure of the populations. These processes result in evolutionary patterns, that is, the products generated by evolution with time.  

Phylogeny refers to the evolutionary history of a species or a group of species. In order to redevelop phylogeny, the scientists use systematics, that is, an analytical method to categorize the diversity and finding the evolutionary associations between the extinct and the living species.  

The evidence used to redevelop phylogenies can be attained from the fossil record and from the biochemical, morphological, and genetic similarities between the species. The scientists are functioning to develop a universal tree of all life, which will get refined with the gathering of new information.  

Final answer:

Genetic information and an understanding of descent with modification allow scientists to reconstruct phylogenies extending back millions of years.

Explanation:

In order to reconstruct phylogenies that extend hundreds of millions of years back in time, scientists use genetic information and an understanding of the process of descent with modification. By comparing the nucleotide sequence of a gene across different species, scientists can determine how closely related those species are. Genetic variations among species can be used as a measure of their evolutionary relationships. For example, by comparing the gene sequences of humans and chimpanzees, scientists have determined that these two species are closely related. This genetic analysis allows scientists to construct a timeline of the evolutionary history of life on Earth, known as the 'tree of life'.

An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3'

Answers

Answer: Thecorrect answer would be

3' GGGAACCTTGATGTTTCGGCTCTAATT 5'

Explanation:

DNA and RNA are nucleic acids, that is, polymers of nucleotide. DNA consists of adenine, guanine, cytosine, and thymine. In contrast, RNA contains uracil in place of thymine. Rest three nucleotide are same.

Please note that transcription (DNA to RNA) as well as reverse transcription (RNA to DNA) is done on the basis of base complementary nature.

The base pairs are:

adenine- thymine/uracilguanine- cytosine

So, if adenine is present in DNA then uracil will be incorporated in RNA and vice-versa.

For example, the initial 5 nucleotide of given RNA are 5' CCCUU...3'

So, in DNA, based on base complementary rule, G will be incorporated against C and A will be incorporated against U. Thus, the DNA sequence would be 3' GGGAA...5'.

Similarly, the whole sequence can be worked out.

Final answer:

The complementary DNA sequence would be: 3' GGGAA CCTTGAUGUUUCGGCUCTAA 5'

Explanation:

To find the sequence of bases in the first strand of DNA complementary to the given RNA sequence, we need to use the complementary base pairing rules:

Adenine (A) pairs with Thymine (T) in DNA or Uracil (U) in RNA.

Thymine (T) pairs with Adenine (A) in DNA.

Cytosine (C) pairs with Guanine (G).

Given the RNA sequence:

5' CCCUUGGAACUACAAAGCCGAGAUUAA 3'

The complementary bases for DNA are:

Adenine (A) → Thymine (T)

Uracil (U) → Adenine (A)

Cytosine (C) → Guanine (G)

Guanine (G) → Cytosine (C)

So, the complementary DNA sequence would be: 3' GGGAA CCTTGAUGUUUCGGCUCTAA 5'.

When electrons flow along the electron transport chains of mitochondria, which of the following changes occurs?
a. The pH of the matrix increases.
b. ATP synthase pumps protons by active transport.
c. The electrons gain free energy.
d. NAD+ is oxidized.

Answers

Answer:

a. The pH of the matrix increases is the correct answer.

Explanation:

When electrons flow along the electron transport chains of mitochondria,The pH of the matrix increases because the electron transport chain is forming a gradient of hydrogen ions in respects to the matrix and the inner membrane surface of the mitochondria.

The concentration of hydrogen ion outside is higher as compared to the matrix. Thus due to higher concentration of hydrogen ions outside creates lower pH and the pH of the matrix increases.

Final answer:

When electrons flow along the electron transport chains of the mitochondria, the pH of the matrix increases. This is because protons are pumped out of the matrix into the intermembrane space, creating a more alkaline (high pH) environment in the matrix.

Explanation:

When electrons flow along the electron transport chains of the mitochondria, a change that occurs is the increase of the pH in the matrix (option a). Here's why: The process of electron transport chain plays a crucial role in cellular respiration.

As electrons pass along the chain, protons (H+ ions) are actively pumped from the mitochondrial matrix into the intermembrane space, creating a proton gradient. The intermembrane space becomes more acidic (low pH) while the matrix becomes more alkaline (high pH). So the pH of the mitochondrial matrix increases during the process.

Learn more about Electron Transport Chain here:

https://brainly.com/question/24368622

#SPJ3

Compare chromosome behaviors during mitosis and meiosis.

Answers

Answer:

Explanation:

he cell division of eukaryotes consists of 2 types of division - mitosis, and meiosis. Both the cell divisions have karyokinesis which follows the cytokinesis. It takes some hours and an indirect type of cell division. The mitotic chromosomes and meiotic chromosomes show different behaviors -  

In mitosis, the cell divides one time while in meiosis the cell divides 2 times. DNA replication occurs during interphase in mitosis. In meiosis DNA replication happens in the first cell division and no DNA replication in the second cell division.

There is no synapsis in the mitotic chromosome. In meiosis, synapsis occurs in homologous chromosomes. It has seen in the prophase I of meiosis.

The 2 chromatids of the chromosome do not exchange their segments in mitosis. In meiosis the chromatids of 2 homologous chromosome exchange segments. This results in the crossing over between the 2 homologous chromosomes.

The mitotic chromosome, each chromosome joined by a centromere. The meiotic chromosome forms tetrads from bivalent. The bivalent consists of 2 centromeres where the tetrads are attached.

In mitosis, the chromosomes separate slowly during anaphase. but in meiosis short chromosomes separate early, and long chromosomes take some time to separate.

Prokaryotes that are round are called spirochetes.
a. True
b. False

Answers

Answer:

False

Explanation:

Spirochetes have a spiral morphology, they are prokaryotes specifically they are bacteria. Spirochetes have flexible walls  

Bacteria that are round in shape are called cocci.  

If the body produces proteins naturally what happens when weconsume
more proteins?

Answers

Answer:

Body constantly break downs and repair or rebuild its own cells and tissues which is lead to the need for the protein. In under different conditions like intense physical activity or sickness or injury can also result in requirement of protein as in diet.

All these process to occur one need to consume enough protein. Excessive protein than requirement for cell or body requirement will normally metabolize to produce amino acids and energy.

Thus, the correct answer would be - it will provide essential amino acids for producing different hormones and building and repair cells and tissues and energy.

Pathogens are transmitted in only two ways: by direct contact and by vectors.
a. True
b. False

Answers

Answer: False

Explanation:

Pathogens can be transmitted in many ways. It can spread by direct contact, indirect contact, or by vectors.

The mode of transmission can be skin contact, airborne particles, touching a surface, bodily fluids, touched by an infected person.

The mode of transmission can be vector that carries disease and helps in disease transmission.

So, the pathogens can be transmitted by direct contact, indirect contact or by vectors and by many more ways.

Ethical considerations aside, if DNA-based technologies became widely used, how might they change the way evolution proceeds, as compared with the natural evolutionary mechanisms that have operated for the past 4 billion years?

Answers

Answer:

Although now a days we have evidence that evolution and speciation process can happen in 1 or just a few generations (e.g. clone crayfish or the golden rain tree bug florida and there are many more) usually evolution and speciation process work at a broader scale of time. This is important because communities are evolving together and this creates equilibrium in ecosystems. If evolution happens only in several other may not adapt to these changes.

DNA technologies can be dangerous especially with bacteria  because Gram Negative Bacteria have been found to be fairly capable of inter-species conjugation, this is dangerous because DNA can change bacteria in a way that may be invasive or harmful to other organism.

DNA-based technologies could potentially alter the course of evolution in several significant ways:

1. Directed Evolution: With DNA-based technologies like gene editing (e.g., CRISPR-Cas9), humans could directly manipulate the genetic makeup of organisms, accelerating the rate of evolution. This could lead to the intentional modification of traits in plants, animals, and even humans, potentially bypassing the slow, random process of natural selection.

2. Selective Breeding: Humans have been selectively breeding plants and animals for thousands of years, but with advancements in DNA technology, this process could become more precise and efficient. Rather than relying on observable traits, scientists could select for specific genetic markers associated with desired traits, potentially leading to the rapid development of new varieties and species.

3. Gene Drives: Gene drives are genetic systems that bias inheritance in sexually reproducing organisms, allowing a particular gene variant to spread rapidly throughout a population. While this technology holds promise for combating diseases and pests, it also raises ethical concerns about its potential ecological impact and unintended consequences.

4. Synthetic Biology: DNA synthesis technologies enable scientists to design and create entirely new DNA sequences, including genes and even entire genomes. This could lead to the creation of organisms with novel traits not found in nature, potentially opening up new avenues for innovation in fields such as medicine, agriculture, and biotechnology.

5. Genetic Engineering for Environmental Adaptation: As climate change continues to alter ecosystems, DNA-based technologies could be used to help organisms adapt more quickly to changing environmental conditions. This might involve introducing genes from other species that confer tolerance to heat, drought, or other stressors.

Overall, while DNA-based technologies offer unprecedented opportunities to shape the course of evolution, they also raise profound ethical questions about the implications of playing such an active role in the genetic destiny of life on Earth. Balancing the potential benefits of these technologies with their potential risks will be a crucial challenge for scientists, policymakers, and society as a whole.

While the Cenozoic is often incorrectly referred to as the "Age of Mammals", in what time period were synapsids the dominant terrestrial vertebrates?
a. permian
b. triassic
c. jurassic
d. cretacous
e. devonian

Answers

The correct answer is A. Permian.

Explanation

The synapsids were terrestrial vertebrate mammals or animals related to them rather than to reptiles or birds that lived during the Permian (a period that began about 299 million years ago and ended about 251 million years ago) and were the dominant terrestrial vertebrates during it. These animals survived until the Triassic; however, due to the Permian-Triassic extinction, they were not the predominant vertebrate as in the previous period. Later, during the Cretatic and Jurassic periods, their development was minimal and did not have great importance as reptiles were dominant in this period. So, the correct answer is A. Permian.

Comparisons of amino acid sequences can shed light on the evolutionary divergence of related species. If you were comparing two living species, would you expect all proteins to show the same degree of divergence? Why or why not? Justify your answer.

Answers

Answer:

If the comparison is made between two of the living species, then all the proteins would not demonstrate a similar degree of divergence. Though the two species got diverged during the progression of evolution, they have originated from a common ancestor.  

Some of the proteins taking part in very essential activities of the cell, like protein synthesis and replication would have got conserved in both the species. The modifications resulting due to mutations in the sequences of DNA, which further lead to modifications in very essential proteins may result in the loss of function of such kind of proteins. This would be harmful to the organism.  

Only modifications in the proteins that are in reality benefit the organism would be encouraged at the time of divergence. Thus, the degree of divergence of all the proteins in two species will not be same.  

Answer:

All proteins will show different degrees of divergence because some cellular functions are more essential than others to the survival of the organism.

All proteins will show different degrees of divergence because different species live in different habitats and experience different selection pressure.

Explanation:

This is the answer to the same question on mastering biology, but you have to select two correct statements.

In glycolysis and the TCA cycle, glucose is _____ down to CO2; this process _____ lots of ATP and reducing power. In photosynthesis, CO2 is ______ back to sugar by the _______ of lots of ATP and reducing power.
A) reduced; requires; oxidized; production
B) oxidized; requires; reduced; production
C) oxidized; produces; reduced; input
D) reduced; produced; oxidized; input

Answers

Answer:

C) oxidized; produces; reduced; input

Explanation:

Glycolysis and TCA cycle are the first two stages of cellular respiration. Glycolysis breaks down glucose into pyruvate which then enters the TCA cycle in the form of acetyl CoA and is completely oxidized into CO2 and H2O.

Both glycolysis and the TCA cycle produce a few ATPs and a large number of reducing powers (NADH and FADH2). The oxidation of reducing powers during oxidative phosphorylation drives the synthesis of a large number of ATP.

Photosynthesis is the process wherein CO2 is reduced into glucose. The process includes light-dependent synthesis of ATP and NADPH which in turn are used during the Calvin cycle to produce glucose from CO2.

Explain how arteries, veins, and capillaries differ in form and function.

Answers

Answer:

The circulatory system of the human body consists of three types of vessels which carry blood. These blood vessels have been distinguished on the basis of structure and function and called arteries, veins and capillaries.

Structure

1. Lumen diameter: Arteries have a large diameter as compared to veins and capillaries and capillaries has the smallest diameter in all of these.

2. Wall thickness: Arteries have the thickest wall than veins and capillaries have the thinnest wall.

3. Wall layer: arteries and veins made of three layers of muscle whereas veins made of one layer of cells.

Function

1. Arteries: brings oxygenated blood (oxygen-rich) from the heart to the body parts in pulses

2. Veins: carry deoxygenated blood from the body to the heart

3. Capillaries: carry both oxygenated and deoxygenated blood away from the body.

Which are the likely consequences of insufficient fat in the diet of a victim of an eating disorder?
A. Weight loss
B. Bone thinning
C. Disruption of the menstrual cycle
D. Sterility
E. All of the above

Answers

The correct answer is E. All of the above

Explanation:

Eating disorders include multiple mental disorders such as anorexia, bulimia, rumination disorder or binge eating disorder in which individuals have negative eating habits that have serious consequences on their health including both mental and physical aspects.

In terms of physical health most eating disorders imply the individual restricts its diet or does not consume the nutrients or substances that are necessary to be healthily including insufficient fat, this leads not only to weight loss but also to disruption in the menstrual cycle as this lead to hormonal imbalances and therefore this might also be linked to sterility. Besides this, individuals with eating disorders are more prompt to develop conditions such as kidney or osteoporosis that occurs as bones thin or lose density due to the lack of nutrients. Thus, all of the options are likely the consequences of insufficient fat in eating disorders.

n German cockroaches, bulging eyes (bu) are recessive to normal eyes (bu+) and curved wings (cv) are recessive to straight wings (cv+). Both traits are encoded by autosomal genes that are linked. A cockroach has genotype bu+ bu cv+ cv, and the genes are in repulsion. Which of the following sets of genes will be found in the most-common gametes produced by this cockroach?a. bu+ cv+b. bu cvc. bu+ bud. cv+ cve. bu cv+

Answers

Answer:

e. bu cv+

Explanation:

The genes bu+/bu and cv+/cv are autosomal and linked --> each homologous chromosome has an allele of both bu+/bu and cv+/cv genes.

The cockroach is heterozygous for both genes, and they are in repulsion.

That means that on one of the homologous chromosomes one of the genes has a dominant allele and the other gene has the recessive allele, and on the other homologous chromosome the alleles are arranged in the opposite way.

In this case, the genotype of the cockroach would be best written as:

[tex]\frac{bu+\ \ \ cv}{bu\ \ \ cv+}[/tex]

The most common gametes will be the parentals, i.e. gametes in which crossing-over between homologous chromosomes did not happen and therefore have the same distribution of alleles as the parental individual.

For those reasons, the most common gametes will be:

bu+ cvbu cv+

The most common gametes produced by this cockroach will be bu⁺ cv and bu , cv⁺. Among the provided options, the set containing these genes is e. bu cv⁺. The correct answer is e. bu cv⁺

To solve this problem, let's first understand what it means for the genes to be in "repulsion" and then determine the most common gametes produced by the cockroach with the genotype bu⁺ bucv⁺ cv.

Key Points:

Linked Genes in Repulsion: When genes are in repulsion, it means that each chromosome in the homologous pair carries one dominant and one recessive allele of the two genes.

Genotype of the Cockroach: bu⁺ bucv⁺ cv

This means the cockroach has one chromosome with bu⁺ cv and another with bucv⁺ .

Chromosome Arrangement:

The chromosomes can be represented as:

One chromosome has bu⁺cv

The other chromosome has bucv⁺

Most Common Gametes:

Since the genes are linked and in repulsion, the most common gametes will be those that reflect the original arrangement of alleles on the chromosomes without recombination. Therefore, the two most common types of gametes will be:

bu⁺ cv

bu , cv⁺

These combinations are produced without crossing over between the linked genes.

Fatty acid metabolism disorder is an autosomal recessive disorder. Two unaffected parents have 6 children - all of whom are unaffected. List all of the mother's possible genotypes.

Answers

Answer:

There are only 2 possible genotypes for the mother, FF and Ff.

Explanation:

Because it is an autosomal inheritance, this case F will be the dominant allele and f the recessive allele, where f produces Fatty acid metabolism disorder. If the mother does not possess the disorder, she must possess at least one dominant allele for that specific gene. However, for the other allele, we cannot assure that it is dominant, since it can be recessive and not express itself either in her or in the offspring, because of the father we also only know his dominant allele.

Describe mechanisms by which new genes could arise.

Answers

Answer:

Exon shuffling.

Explanation:

Exon shuffling may be defined as the phenomena of in which genes are exchanged between the different exons. Types of exon shuffling are transposon shuffling and cross over at the time of gamete formation.

Exon shuffling is responsible for the formation of new genes. Different exons combine together to form the new genes. The duplication of exons also leads to the formation of new genes. The intron-exons structure is altered for the new gene formation.

Thus, the correct answer is exon shuffling.

Name one enzymatic step of the gluconeogenic pathway that constitutes a phosphoryl group transfer. ___________

Answers

Answer:

Final step: Glucose-6-phosphate is converted to glucose  

Explanation:

Gluconeogenesis is the synthesis of glucose occuring during hypoglycaemia. The final step is catalyzed by glucose phosphatase which removes the phosphate group from glucose-6-phosphate.

As you read in this chapter, fungi have long formed symbiotic associations with plants and with algae. In a short essay (100– 150 words), describe how these two types of associations may lead to emergent properties in biological communities.

Answers

Answer:

Fungi show symbiotic association with algae and plants. With plants, they thrive as endophytes in a form of the symbiotic association. This symbiotic association results in the emergence of novel characteristics in the world of biology.  

The lichens function as a tool in finding the quality of air, as they grow in the environment containing good air quality. The tolerance towards heat is another characteristic. Some of the endophytes are witnessed in the plants, which grows in very hot conditions.  

At such conditions, no fungi or plant can thrive, however, in the symbiotic association, they possess the tendency to thrive. If one tries to separate them, it results in death of both.  

Symbiotic associations between fungi, plants, and algae contribute to increased nutrient cycling, enhanced plant growth, and ecosystem stability, fostering emergent properties in biological communities.

Nutrient Exchange:  fungi form associations with plant roots, facilitating the absorption of water and essential nutrients like phosphorus and nitrogen.

This enhanced nutrient uptake benefits both the plants and the fungi, leading to healthier and more productive vegetation.

As a result, the increased plant biomass supports a broader range of herbivores and, in turn, predators, contributing to the complexity of food webs within biological communities.

Improved Plant Tolerance: Symbiotic fungi can also improve a plant's tolerance to various environmental stressors, such as drought or heavy metal contamination.

This enhanced resilience can allow for the coexistence of diverse plant species in the same ecosystem, further increasing biodiversity.

Carbon Sequestration: Mycorrhizal fungi, in association with trees, contribute to carbon sequestration.

This sequestered carbon helps mitigate climate change by reducing atmospheric carbon dioxide levels.

Ecosystem Stability: The overall effect of these fungal-plant associations is an increase in ecosystem stability.

The presence of these relationships helps buffer ecosystems against disturbances and allows for the persistence of diverse species, making the community more resilient in the face of environmental changes.

The symbiotic associations between fungi, plants, and algae promote nutrient cycling, improve plant tolerance, sequester carbon, and enhance ecosystem stability, leading to emergent properties that foster greater biodiversity and complexity within biological communities.

For such a more question on fungi

https://brainly.com/question/12501376

#SPJ3

Because they alter the reading frame of all base-pair triplets, base-pair additions and deletions are collectively referred to as:
a. inversions
b. transversions
c. framshift mutations
d. point mutations
e. codon mutations

Answers

Answer:

The correct answer is option c. "frameshift mutations".

Explanation:

The reading frame of a gene is based on base-pair triplets, starting from the start codon until the ribosome encounters with the end codon. Base-pair additions and deletions are collectively referred to as frameshift mutations because they alter the reading frame of the gene. Base-pair additions and deletions break down the original sequence of the gene triplets, which alters the open reading frame and usually results in the production of non active proteins.

What type of human disorders and diseases might be treatable using stem cells?

Answers

Answer:

The following disorders might be treated by using stem cell therapy:

Spinal injuries can be treated by the stem cell therapy. As the neurons can be replaced by healthy neurons and used to treat Parkinson's disease.

The insulin produced from the somatic cells are used to treat the diabetes.

The cancer can be treated by using stem cell therapy.

Any damaged organ or tissue can be replaced by the stem cell therapy.

Different genetic diseases can be cured by the use of stem cells.

Which of the following is true of unsaturated fats?
(A) They are more common in animals than in plants.
(B) They have double bonds in their fatty acid chains.
(C) They generally solidify at room temperature.
(D) They contain more hydrogen than do saturated fats having the same number of carbon atoms.

Answers

Answer:

The correct answer is option B.

Explanation:

The fatty acids are differentiated into unsaturated and saturated fatty acids on the basis of the double bonds they contain in their composition. If a fatty acid contains no double bond, it is known as saturated fatty acid, on the other hand, the double bond constituting fatty acids are known as unsaturated fatty acids.  

These kinds of fatty acids are abundantly found in animals. An unsaturated fatty acid contains one or more double bonds in their composition. At room temperature, the saturated fatty acids are found in solid form, while unsaturated fatty acids come in liquid form. The number of hydrogen atoms is found more in a saturated fatty acid, in comparison to an unsaturated fatty acid.  

Final answer:

Unsaturated fats are fats that contain at least one double bond in their fatty acid chains, which causes them to be generally liquid at room temperature and to contain fewer hydrogen atoms than saturated fats. They are more commonly found in plants than in animals.

Explanation:

In the context of Biology, unsaturated fats are fats or fatty acids that contain at least one double bond in their fatty acid chains. Therefore, the statement (B) 'They have double bonds in their fatty acid chains' is true of unsaturated fats. This double bond causes the fat molecules to bend, preventing them from packing closely together and making them generally liquid at room temperature, which contradicts statement (C). Unlike saturated fats, which are fully 'saturated' with hydrogen atoms in their molecular structure, unsaturated fats contain fewer hydrogen atoms due to the presence of double bonds, making statement (D) inaccurate. Moreover, unsaturated fats are more commonly found in plants than in animals, refuting statement (A).

Learn more about Unsaturated fats here:

https://brainly.com/question/35306900

#SPJ6

The frequency of autosomal alleles K and k in a large population of snails is 0.6 and 0.4. What is the approximate genotypic frequency of the heterozygote Kk if the inbreeding coefficient (F) was 0.3?
a. 0.48
b. 0.34
c. 0.14
d. 0.30
e. 0.24

Answers

Answer:

Option (b).

Explanation:

The frequency of alleles K and k in population are 0.6 and 0.4. The inbreeding coefficient is 0.3.

The heterozygote frequency can be calculated by the formula:

F = [tex]\frac{2Kk-H}{2Kk}[/tex]

Here, K = 0.6, k= 0.4, F = 0.3 and H = approximate genotypic frequency of heterozygote Kk.

Put the values in the above formula

0.3 = [tex]\frac{2\times2\times0.6\times0.4-H}{2\times0.6\times0.4}[/tex]

H = 0.36 ≈ 0.34.

Thus, the approximate genotypic frequency of the heterozygote Kk is 0.34.

Hence, the correct answer is option (b).

There are 25 individuals in population 1, all with genotype AA, and there are 40 individuals in population 2, all with genotype aa. Assume that these populations are located far from each other and that their environmental conditions are very similar. Based on the information given here, the observed genetic variation most likely resulted from
a. Genetic drift. c. nonrandom mating.
b. gene flow d. directional selection.

Answers

Answer:

a. Genetic drift

Explanation:

When there is a change in the frequency of genes in a small population due to chance event as a result of which a few alleles disappear from the population, is known as genetic drift. In the given situation, the population size is small i.e. 25 and 40 respectively and in both these populations, it can be seen that one of the population only has allele A whereas the other has allele a, and because of this it can be concluded that this situation must have arisen due to genetic drift.The populations got established due to random sampling and then the progenies inherited only the alleles of the organism that reproduced and thus, the frequency of the other allele decreased and this is merely a chance event.

What type of behavior is a bird song, learned or innate?

Answers

Answer:

The tendency of the bird or the inclination to sing is innate in birds, however, the song, which is sung is learned. There exists an innate tendency to sing a song whether the bird is in seclusion or not. The birds possess sensitive/critical periods when they can produce memories of the songs they learn. The anterior forebrain pathway or the anterior vocal pathway is the template for learning a song by the bird.

Key features of seed plants facilitating life on land include three of the following four traits. Select the exception.
(A) homospory
(B) pollen
(C) reduced gametophytes
(D) seeds

Answers

Answer:

(A) homospory

Explanation:

Homospory is a type of reproduction found in pteridophytes. This character does not appear in gymnosperm or angiosperm hence it could not favor life on land.  

The exception from the four traits is : ( A ) Homospory

Key features of seed plants

The seed plants survive on land when planted due to certain key features that seed plants possesses and some of these key features are

PollenReduced gametophytes and Seeds

While Homospory is not a key feature of seed plants it is form of reproduction that is found in pteridophytes. therefore it cannot favor the growth of plants on land.

Hence we can conclude that The exception from the four traits is : ( A ) Homospory

Other Questions
As the chief executive officer of Hayden Corp., Kim found an effective way to reward high-performing employees and boost their morale during an economic downturn. Which of the following management functions was Kim engaged in?a. Planningb. Organizingc. Leadingd. Controlling All of the events listed below occur in the energy-capturing light reactions of photosynthesis except A) oxygen is produced. B) NADPt is reduced to NADPH. C) carbon dioxide is incorporated into PGA. D) ADP is phosphorylated to yield ATP E) light is absorbed and funneled to reaction-center chlorophyll A 55.0 mL aliquot of a 1.50 M solution is diluted to a total volume of 278 mL. A 139 mL portion of that solution is diluted by adding 155 mL of water. What is the final concentration? Assume the volumes are additive. concentration: Explain Mendel's law of segregation and how it predicts the 3:1 dominant-to-recessive phenotypic ratio among the F2 generation of a monohybrid cross. Which sentence uses a participial phrase to add variety and interest to its meaning?A)Delores avoided all the jellyfish that had washed up on the shore overnight.B)Delores walked along the beach and avoided all the jellyfish that had washed ashore.C)Walking on the beach, Delores dodged all the jellyfish that had washed ashore.D)Delores wanted to walk on the beach, but she had to avoid all the jellyfish. Where do prions come from?A.There are prion-like particles in the brain normally, and when these become abnormal they can cause disease.B.Mosquitoes.C.They are clumps which form from normal prion-like particles in the blood that travel to the brain.D.They are introduced by infectious protozoa.E.Contaminated water. What is the answer to number 14 ? A human heart beats approximately 60 times per minute. If a man lives to the age of 90, how many times will his heart in his lifetime. During a drought the water level of a lake changes -3 1/5 feet per day. Write and solve an equation to find how long it takes for the water level to change -16 feet Based on the benefits received from the Three Gorges Dam, China is planning four new dams for the Yangtze River further upstream. The new dams will provide nearly double the electricity generated at Three Gorges , and would trap sediments before they reach the Three Gorges Dam reservoir . Now that the environmental consequences of large dams are known , do you think that China should reconsider additional large hydroelectric projects ? it takes 4/5 of an hour to paint 2/5 of a room, how long does it take to paint one room? Hannah and Francine have $120.hannah and Peter have $230.Peter has 6 times as much money as Francine.How much money does Hannah have? What is one example of a primary succession 90 POINTS Determine the measures of L and M. Question 2 2 pts The _is a natural process that warms the Earth's surface and is the primary reason for global warming. Ocean acidification O Photosynthesis None of the options Greenhouse effect How do boron-10 and boron-11 differ? What problem did the United States and Russia still have to solve after theCold War?OA. Deciding on governments for Eastern EuropeOB. Preventing nuclear warOC. Preventing China from invading RussiaOD. Deciding on a way to contain Germany Tell why small droplets of water on an oily surface are almost spherical. How do you calculate an objects mechanical energy? What is the major source of water pollution that washes chemicals and other pollutants from improperly managed land