What theme does Rahul develop by describing his work in Ashok's fish shop in Free from School? Click here to read the excerpt. Passion is necessary for success Life is too short to waste in school Experience is the best teacher The most valuable knowledge is self-taught

Answers

Answer 1
Experience is the best teacher. 
Answer 2

The correct answer is "experience is the best teacher".

Explanation: In "Free From School" by Rahul Alvares, the author tells us of his experience working in Ashok's fish shop after finishing school. He describes everything that he had learned from observation and trial-and-error through hands-on training. Not only did he learn to take care of fish, he learned how to build tanks, transport materials, and even learned how to deposit and withdraw money. The author expresses that his job has taught him more than school ever could.


Related Questions

Which answer best explains where a marginal note should be placed?
in the right or left margin of the text
in any open space on the page
at the bottom of the page beneath the text
at the top of the page or bottom of the page

Answers

The marginal note is the first guide for the user of statutes. It steers the reader to the appropriate section, and it briefly indicates the contents of that section.

which goes
in the right or left margin of the text

Why does Wiesel refer to indifference as "tempting"? A. To show how indifference can be a horrible sin. B. To show that small temptations can be good. C. To show that being indifferent to suffering is easy. D. To show that he has also ignored those in trouble.

Answers

C
because I did this in Apex

C

because I did this in Apex

The authors of the Paston letters have which of the following in common with all authors of primary source documents?

A.Their writings are written after the fact, with the benefit of hindsight.
B.Their writings are largely commentaries on currently published material.
C.Included in their writings are social criticisms based on data interpreted by experts in the field.
D.Within their writings are both implicit and explicit assumptions about the conditions under which they lived.

Answers

The answer is D. Hope I helped

Answer:

Within their writings are both implicit and explicit assumptions about the conditions under which they lived.

Explanation:

The Paston letter is one of the largest collections of personal correspondence from the 15th century, between different members of the Paston family, which was part of the royalty, this collection includes official an important state documents , and like any kind of written work it includes references from the kind of surroundings they had and how they were living life.

In group discussion, what is the best reason you should respect the opinions of others even if you do not agree with them?

a.) because everyone should have a chance to speak
b.) because the facilitator will get angry with you if you do not pay attention
c.) because it will improve your listening skills and understanding of other points of view
d.) because the teacher might give you a failing grade if you do not listen









Answers

The answer would be A. I hope this helps

a.) because everyone should have a chance to speak

Think about the message that Chief Joseph was trying to convey in “An Indian’s View of Indian Affairs.” What does this message tell you about the cultural values of the Nez Percé tribe?



The tribe will always fight to defend its honor.


The tribe has fundamentally different values from white Americans.


The tribe values honesty, tradition, and respect for life.


The tribe will avoid conflict at all costs.

Answers

The message that can be gotten from the cultural values of the Nez Percé tribe is C. The tribe values honesty, tradition, and respect for life.

The Next Perce tribe was from North-Central Idaho. They were known for being excellent horsemen and were also known for breeding beautiful horses.

The message that can be depicted from the cultural values of the Nez Percé tribe is that they value honesty, tradition, and respect for life. The people are respectful towards themselves and ate friendly towards others.

Read related link on:

https://brainly.com/question/11468432

On this assignment could I write about a restaurant or hotel complaint or any suggestions would be greatly appreciated.
(Write a letter of complaint. Follow the rules for a formal letter, and use the full block style. The complaint may be about anything you wish such as malfunctioning equipment, poor building maintenance, or destructive noises from a nearby business). Well give brilliance

Answers

I would write about poor building maintenance such as a broken toilet in a hotel room or a broken sink

Final answer:

A formal business letter in full block style begins with your address and the recipient's address, states the purpose of the letter, details the issue, and concludes with the action you desire. Maintain a professional tone throughout the letter.

Explanation:

How to Write a Formal Business Letter-

When drafting a formal business letter, it is essential to use the appropriate format and style. The full block style is a common format where all elements of the letter are left-justified, with single spacing between lines and double spacing between paragraphs. Begin with your address (no name), followed by the date, recipient's address, and then the salutation. The body of the letter should clearly state the complaint, provide supporting details, and articulate the desired resolution or action. Conclude with a courteous closing, your signature, and your typed name.

To illustrate, if you were writing about a restaurant or hotel complaint, your first paragraph would state the purpose of your letter - dissatisfaction with a service or product. The subsequent paragraphs would outline the specific issues encountered, referencing any relevant data or examples. Conclude by reiterating the problem and affirming why a resolution is critical, whether that entails a refund, a corrective action, or an acknowledgment of poor service.

Remember, a formal letter should maintain a professional tone throughout. For example, 'I am writing to express my dissatisfaction with the services provided during my stay at your hotel...' is better than 'I had a terrible stay at your hotel...'. This helps in conveying the seriousness of the issue while maintaining respect for the recipient.

Effect of adding the prefix in

Answers

The prefix in- appears in numerous words and can have various meanings, including "in," "on," "not," "without," or "opposite of." Often times it turns a root word into its antonym. 

For example, adding in- to the word "sane" would create the word "insane." The meaning is then in the word, as insane means "in-" or not sane.

Hope this helps! :)

A how-to-essay is an informational essay: true or false

Answers

true :D  !!!!!! S M I L E
The statement : A how-to-essay is an informational essay is True

who pretends to help cassio after his embarrassing street brawl the night before?
a. iago.
b.desdemona.
c.roderigo.
d.the duke

Answers

C.roderigo is you answr
Final answer:

In 'Othello', Iago pretends to help Cassio after the street brawl, suggesting he appeal to Desdemona. However, Iago uses this as a plot to manipulate other characters, further showcasing his deceptive nature.

Explanation:

In the play Othello by William Shakespeare, the character who pretends to help Cassio after his embarrassing street brawl is Iago. Iago is a soldier under Othello's command and is known for his deceitful nature. The street brawl resulted in Cassio's dismissal from his rank as lieutenant. Iago, pretending to be a loyal friend, proposes that Cassio appeal to Desdemona, Othello's wife, to regain his position.

However, his intentions are anything but kind. Iago crafts this plan to make it appear that Desdemona and Cassio are having an affair and this plot eventually leads to tragedy. Iago's false friendship and manipulation play a pivotal role in this play, showcasing the theme of deception.

Learn more about Iago here:

https://brainly.com/question/38875929

#SPJ3

why is it a sin to kill a mockingbird

Answers

Mocking birds are innocent birds who do nothing but sing and make people happy. Killing one is a sin because there was no reason to do so.

Answer:

Because all the mockingbirds do is sing songs for our enjoyment. They haven't done anything wrong.

Why is it ironic that creon acusses ismene of helping Antigone bury poly wives

Answers

I believe the correct answer is: Because Ismene was actually afraid to help Antigone.

 

As a figure of speech, irony primary represent the use of one's language that normally signifies the opposite. But, it can also represent the state of affairs or an event that seems deliberately contrary to our expectations.

Therefore, in this case of Sophocle’s play “Antigone”, Ismene denies the help to Antigone to bury their brother, Polyneces, because she is afraid to help. But, never the less, Ismene is imprisoned by Creon, alongside Antigone. This is ironic because the audience/readers would not expect for Ismene to be imprisoned as she is abiding the law out of fear.

What is soma in the book A Brave New World?

Answers

Soma is a recreational drug used by a large percentage of the populace in "A Brave New World." Some would say it is one of the many factors that contributes to the people's submissiveness to the government in the book.
Final answer:

Soma in 'A Brave New World' is a hallucinogenic drug used by the government to control and pacify citizens, ensuring social stability within a dystopian community.

Explanation:

What is Soma in 'A Brave New World'?

In Aldous Huxley's dystopian novel A Brave New World, soma is a government-provided drug that acts as a central tool of social control. It is a powerful, hallucinogenic substance that pacifies the citizens of the World State, inducing a state of mindless happiness and contentment, effectively preventing any form of unhappiness or dissent. Recreational use of soma is encouraged to ensure that the populace remains docile and easily manipulable, facilitating the maintenance of social stability and dystopian communities. As a result, the concept of self-reliance is virtually nonexistent because individuals become dependent on soma to manage their emotions and maintain the illusion of a harmonious society.

Learn more about Soma in 'A Brave New World' here:

https://brainly.com/question/14696297

#SPJ11

Use the following passage to answer the question. (1) Water is something most of us take for granted. (2) If we need a cold drink or want to take a shower, water is there. (3) If we want to water our yards or wash the dishes, water is there. (4) For many parts of the world, however, this is not true. (5) Water is not everywhere it's miles away. (6) To get water involves a long walk to and from the source. (7) Traditionally it is the job of women and children to spend their days searching for water. (8) Then, they gather it to bring back to their homes. (9) Sadly, even after that water is found, only some of its clean and safe enough to drink. (10) A number of groups across the globe have spent decades helping people get better access to water. (11) One such organization is called Water.org (12) It was started in 2009 by actor Matt Damon and Gary White, the co-founder of Water partners. (13) What have they accomplished so far Which sentence contains a word that should be capitalized?

Answers

The sentence that contains the word which should be capitalized is sentence 12. The word 'partners' should be capitalized, because it is a proper noun, which represent the name of a company. The correct way to write the name of the company is ' Water Partners'.

why would a poster be a poor choice of genre for "How to Prepare for a Road Trip"?

Answers

Because there's too much information to fit on a poster, and people can't take it with them
Posters are usually not as large and if this type of a poster should have a lot of text that can't fit unless the font is reduced to make it barely readable. In addition, the people need the information at their homes so they can look at it again and check if they've prepared correctly and they can't take the poster home.

Answer:

Because there's too much information to fit on a poster and people can't take it with them

Not exactly a question, but what is your favorite subject at school? Language Arts/Reading, Mathematics, Science, U.S. History/Civics, or Physical Education (P.E.)

Answers

Math or PE but I do also like chemistry too


My favorite class is Civics because we don't really do anything in there. All we did was sit around in P.E. (and I didn't like that at all) Reading used to be my favorite until my teacher started giving us ridiculous assignments. So... Civics

Score: 50%
Directions: The following sentences have errors in capitalization and comma usage, semicolon and colon usage, and quotation marks usage. Make corrections to the sentences so they reflect proper punctuation. An example is done for you. Review the information if necessary.

Example: nigel says he wants to go to africa in march but i don’t think he has enough money
Correction: Nigel says he wants to go to Africa in March, but I don’t think he has enough money.
1.

Did you know that Marcus is getting married on July 26th?
2.

Wow! That is a great idea. I’d love to join you, but I have a softball tournament that day.
3.

Uncle Carl said " We would like you to come to the reunion," but my mom told him that we would not be able to make it.
4.

Go to the hardware store and pick up the following items a saw, a hammer and some rope
5.

The invitation said to go to 117 Donner Creek Road in Fresno, but Sinclair couldn’t find that address.
6.

Because I had a dentist appointment, at 1:30 pm, I had to leave school early.
7.

The story called, "Out In The Woods" is one of my favorites.



8.

Bernice, my sister’s best friend, is giving us a ride to school.
9.

Most of the students passed the history test about Mexico; therefore, we are going to move on to a different topic.
10.

When Trisha saw the boys on the stage; she exclaimed: "Finally a group of students who can act!"

Answers

Final answer:

The sentences have errors in capitalization and punctuation. We need to correct the errors in each sentence to reflect proper punctuation.

Explanation:

1. Did you know that Marcus is getting married on July 26th?

2. Wow! That is a great idea. I’d love to join you, but I have a softball tournament that day.

3. Uncle Carl said, "We would like you to come to the reunion," but my mom told him that we would not be able to make it.

4. Go to the hardware store and pick up the following items: a saw, a hammer, and some rope.

5. The invitation said to go to 117 Donner Creek Road in Fresno, but Sinclair couldn’t find that address.

6. Because I had a dentist appointment at 1:30 pm, I had to leave school early.

7. The story called "Out In The Woods" is one of my favorites.

8. Bernice, my sister’s best friend, is giving us a ride to school.

9. Most of the students passed the history test about Mexico; therefore, we are going to move on to a different topic.

10. When Trisha saw the boys on the stage, she exclaimed, "Finally a group of students who can act!"

Finding different concepts in a paragraph suggests that the context clue is

A. example.
B. comparison.
C. contrast.

Answers

C. Contrast


It says, "Finding different concepts in a paragraph," and contrast means find the difference between one thing and another.


act 3 scene 4 and 5 essay on macbeth

Answers

In scene 4, at Forres, Macbeth and his wife welcome the thanes of Scotland to the banquet. Immediately prior to the feast, one of the murderers appears at a side door and reveals to Macbeth the truth about the mission: their success in the killing of Banquo and their failure to murder Fleance. Macbeth recomposes himself and returns to the table. As he raises a toast to his absent friend, he imagines he sees the ghost of Banquo. As with the ethereal dagger, the ghost of Banquo appears to come and go, propelling Macbeth into alternating fits of courage and despair. Lady Macbeth invites the thanes to depart and, once alone, tries one last time to soothe her husband. But Macbeth's paranoid mind is already on to the next murder, that of Macduff. To ascertain his future with greater certainty, he makes clear his intention to visit the Weird Sisters once more.
In Scene 5, Hecate, the classical goddess of the lower world who represents the spirit of ancient witchcraft, calls the weird sisters to her to complain that her own part in Macbeth's downfall has been overlooked and that she now wishes personally to make his downfall complete. The scene is unnecessary to understanding the play and was probably not written by Shakespeare.

A sentence that combines two or more complete thoughts without using proper punctuation is known as

Answers

a run-on

A run-on sentence is a sentence that has two or more complete thoughts without proper punctuation. This makes the sentence grammatically incorrect. For example: I have a dog she runs fast. There are two complete ideas, but they aren't punctuated correctly. It's also missing a conjunction. Two join the ideas, it must be changed to: I have a dog, and she runs fast.
A fragment is an incomplete sentence. Most fragments are dependent clauses. For example: Since the dog runs fast. This is a fragment because of the word "since". Since tells you that there should be some follow up information about the dog running fast. Since the dog runs fast, she must always be on a leash. 

"Different from the painted-over red lanterns, others (made of thick cutout cardboard) had their designs drawn upon the paper windows, so that the candle's light seemed to emanate from the form and color of the design itself." Which word or phrase could replace the word "emanate" in the excerpt? A. Shade B. Originate C. Look like D. Move toward

Answers

I believe the correct answer is: B. Originate.

 

I believe the word or phrase that could replace the word "emanate" in the excerpt is originate, as the word emanate and originate are synonyms (meaning: originate from; be produced by). In this excerpt is said that the wanted effect is to look like candle’s light was coming from the design itself.

The word or phrase could replace the word "emanate" in the excerpt is "Originate". So the answer to your question would be letter B. Emanate and originate are synonyms so they have the same meaning that is why it can be replaced to this excerpt.

Is the underlined verb in the present progressive or past progressive tense? I was cooking dinner when the phone rang. A. present progressive B. past progressive

Answers

The answer is B. Past progressive.

Read “The Lion’s Share” by Aesop. What is the theme of this fable?

The Lion went once a-hunting along with the Fox, the Jackal, and the Wolf. They hunted and they hunted until at last they surprised a Stag and soon took its life. Then came the question how the spoil should be divided. “Quarter me this Stag,” roared the Lion; so the other animals skinned it and cut it into four parts. Then the Lion took his stand in front of the carcass and pronounced judgment: “The first quarter is for me in my capacity as King of Beasts; the second is mine as arbiter; another share comes to me for my part in the chase; and as for the fourth quarter, well, as for that, I should like to see which of you will dare to lay a paw upon it.”

“Humph,” rumbled the Fox as he walked away with his tail between his legs; but he spoke in a low growl. "You may share the labors of the great, but you will not share the spoil."

Always look at the brighter side.
Hard work is not always rewarded.
The king is always right.
A cunning mind always wins.

Answers

B) Hark work is not always rewarded.

Answer:

B. Hard work is not always rewarded.

Explanation:

Hopely this helps you finely.

Which of the following passages provides the best example of imagery? a. "To what green altar, O mysterious priest, / Lead'st thou that heifer lowing at the skies, / And all her silken flanks with garlands dressed?" b. "What men or gods are these? What maidens loath?" c. "Thou, silent form, dost tease us out of thought / As doth eternity: Cold Pastoral!" d. "Beauty is truth, truth beauty,--that is all / Ye know on earth, and all ye need to know."

Answers

The answer to this question is A. "To what green altar, O mysterious priest, / Lead'st thou that heifer lowing at the skies, / And all her silken flanks with garlands dressed?"

Answer: a. "To what green altar, O mysterious priest, / Lead'st thou that heifer lowing at the skies, / And all her silken flanks with garlands dressed?"

Explanation: Of all options, this is the passage that carries the most words with sensory descriptions, mostly visual ones: we read of a green altar, a priest, a heifer lowing at the skies "dressed" with garlands. All the other options are more concerned with action and discourse than with imagery.

What is a good strategy to use when taking a test? Carefully read each question first before attempting to answer any. Spend the majority of your time proofreading your answers. Answer the easy questions first, then go back to the harder ones.

Answers

Answer C. Answer the easy questions first, then go back to the harder ones. This way you get some of the questions out of the way.

Answer: A good strategy to use when taking a test is to carefully read each question first before attempting to answer any.

Explanation: When taking a test, it is highly important to pay attention to what the questions are asking the students to do in order for them to be clear and concise when answering them. Furthermore, reading questions carefully can help students to figure out which questions are convenient to answer first and what is their word limit. Moreover, in some cases, questions are related to one another; therefore, paying attention to each question is fundamental in order to organize the test in a correct way.

How does Shelley’s idea for Frankenstein fit the Gothic tradition?


It takes readers from a world of logic and practicality to a world of natural phenomenon.


It takes readers from a work-a-day world to a world of mischief and mystery.


It takes readers from a world of reason and science to a world of monsters and terror.


Answers

The correct answer is C. It takes readers from a world of reason and science to a world of monsters and terror.
Gothic fiction usually has to do with something dark, mysterious, scary, and supernatural. Shelley's Frankenstein fits that description perfectly - it is a story about a monster being brought back to life, which is obviously supernatural. Gothic literature was especially popular during Shelley's time (19th century), but also even centuries before.

The correct answer is C.

Mary Shelley's idea for Frankenstein fit the Gothic tradiction because it turned science into horror.

Gothic tradition is largely based on highly developed sense of atmosphere, extreme emotions including fear and awe, and emphases on the mysterious and the paranormal. Shelley includes all of this aspects in her novel by creating a monster and a world of terror with the help of science.

The development of Gothic fiction on Shelley's work can be seen in the cultural concerns about human nature, its potentials and limits, and the forces that go into its making.

The antagonist in To Be Immortal is:

a. an abstract antagonist
b. a physical antagonist
c. an unknown antagonist
d. august

Answers

b. a physical antagonist

The correct answer is an abstract antagonist

What do parables and fables have in common

Answers

They both pass on values important to culture
they both pass on values important to nature

Choose the answer which best completes the sentence. Emails _____ memos in many offices.

do not require as much professionalism as

are not used as frequently as

have begun to replace

Answers

have began to replace

What is one reason writers must do research?
A. To construct a text that is completely unoriginal
B. To complete a works cited quota
C. To reach a word count or required essay length
D. To validate the writer's idea and hypothesis

Answers

to validate the writers idea and hyphothesis

Match the example to the word. 1. Sarah studies word meanings, sounds, and word order. What does she study? linguistics 2. Aaron is researching how the ê was pronounced in second century Rome. What is he studying? phonetics 3. Kara is researching the word "butter" to find out its original meaning. What is she studying? morphology

Answers

1. Sarah studies morphology

2. Aaron studies phonetics

3. Kara studies linguistics


Please rate & thank : )

Answer:

Sarah studies morphology

Aaron studies phonetics

Kara studies linguistics

Explanation:

Other Questions
As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts. how to tell if the histogram is is right skewed I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible which was an outcome of the Nazi governments final solutionhitler shot himself with a pistolthe allies dropped the atomic bomb millions died in german death campgermany surrendered to the alliesim thinking the answer is A but i just wanna be sure Summarize the narrative Churchill present Read this timeline:1975: federal election commission (fec) is established2002: bipartisan campaign reform act (bcra) is passed2010: citizens united v. fec is decidedwhat process do the events in the timeline reflect? Read this newspaper headline: Congressman Pushes Immigration Agenda Which change to the wording of this headline would make it more neutral without changing the overall meaning? A.Congressman Opposes Immigration Agenda B.Congressman Forces Immigration Agenda C.Congressman Advances Immigration Agenda D.Congressman Retracts Immigration Agenda Simon, come and clean up this mess at once for you(be)in trouble