Which excerpts from the passage provide strong evidence that Hrothgar’s hall is famous throughout the lands? Check all that apply.

Answers

Answer 1
The excerpts from the passage which provide strong evidence that Hrothgar’s hall is famous throughout the lands are: B and C.
B) Nobody on earth knew of another building like it. This excerpt reflects how this place was unique, therefore very famous among all the people. Nobody could even imagine a building like this because everybody knows this exact place.

C) Majesty lodged there, its light shone over many lands. The descriptive elements of these lines point out that this place is known by anyone from any land, as if it can be seen from elsewhere. 'its light shone over many lands' and people from many lands know its light.

Answer 2

Final answer:

The evidence indicating Hrothgar’s hall's fame is expressed in the hall's uniqueness and the extent of its renown, as highlighted in the passage's descriptors of its majesty and brilliance.

Explanation:

The excerpts from the passage that provide the strongest evidence that Hrothgar’s hall is famous throughout the lands are:

(b) “Nobody on earth knew of another building like it. Majesty lodged there, its light shone over many lands.” and

(c) “Their gallant escort guided them to that dazzling stronghold.”

These excerpts suggest the hall’s unique and grand nature, implying its fame and prominence. The mention that the majesty lodged in the hall and its light shone over many lands indicates the extensive reach and knowledge of the hall’s existence, while being guided to a “dazzling stronghold” emphasizes the hall’s impressive and widely recognized stature.


Related Questions

The ____ act combined juggling,tap dancing and singing

Answers

Sampion Bouglione act

Final answer:

Vaudeville is the variety entertainment genre where acts combined juggling, tap dancing, and singing. Tap dancing was a key feature of those performances and evolved over time to include elements of musical theater and jazz, with figures like Gene Kelly popularizing these integrated styles in film.

Explanation:

The act that combined juggling, tap dancing, and singing is most commonly associated with Vaudeville. Vaudeville was a genre of variety entertainment prevalent in the United States from the early 1870s until the early 1930s. It featured a range of different performances, including but not limited to musical acts, comedians, and acrobatics. Tap dancing was a significant element of Vaudeville, evolving from a blend of Irish clogging, African rhythms, and other influences, creating truly American dance forms. Performers like Gene Kelly and Fred Astaire later brought this style to Broadway and film, showcasing performances that included tap dancing with elements of jazz and musical theater. Tap dance, which is characterized by the sound of tap shoes striking the floor as a form of percussion, was immensely popular during the Vaudeville era. Techniques and styles of tap evolved over time, incorporating the storytelling aspects of musical theater and the expressive movements found in jazz dance. Films and television further broadcasted these dance forms, where tap dancing continued to develop, with iconic scenes like Gene Kelly's performance in 'Singin' in the Rain' illustrating the integration of tap with other dance styles.

Imagine you are giving a speech about the history of television. Which visual aid would best appeal to the audience's logic and reason?

A. A photo collage of the casts of popular television shows
B. The theme music from a well-known cartoon
C. A short clip from an episode of a classic television show
D. A graph showing the growth of television viewership

Answers

The best answer I can offer is D.

The correct answer is D. A graph showing the growth of television viewership

Explanation:

Visual aids are graphs, charts, images or any other visual tools that help a speaker to develop presentations by providing the audience with visual elements that summarize, exemplify or show what the speaker is trying to explain and which in most cases are easier to understand that the word of the speaker. Additionally, the speaker should select the most appropriate visual tool according to the subject or the topic, the audience and the purpose of the presentation. If the speech or presentation is about the history of television the purpose is probably to show to the audience how television has change over time, because of this, the most appropriate visual tool in this case is one that allows the speaker to explain how television evolved in some way and thus, "A graph showing the growth of television viewership" should be the most appropriate one as it allows the audience to understand visually how television viewership changes in this case, how it increases during history.

Charles Brockden Brown might be called a(n) ____ novelist.
Idealist
Gothic

Answers

the correct answer is gothic

Answer: Gothic is 100% correct.

Explanation:

A student is asked to write a critique of this excerpt from Utopia. If these metals were laid up in any tower in the kingdom it would raise a jealousy of the Prince and Senate, and give birth to that foolish mistrust into which the people are apt to fall—a jealousy of their intending to sacrifice the interest of the public to their own private advantage. If they should work it into vessels, or any sort of plate, they fear that the people might grow too fond of it, and so be unwilling to let the plate be run down, if a war made it necessary, to employ it in paying their soldiers. To prevent all these inconveniences they have fallen upon an expedient which, as it agrees with their other policy, so is it very different from ours, and will scarce gain belief among us who value gold so much, and lay it up so carefully. They eat and drink out of vessels of earth or glass, which make an agreeable appearance, though formed of brittle materials; while they make their chamber-pots and close-stools of gold and silver, and that not only in their public halls but in their private houses. Of the same metals they likewise make chains and fetters for their slaves, to some of which, as a badge of infamy, they hang an earring of gold, and make others wear a chain or a coronet of the same metal; and thus they take care by all possible means to render gold and silver of no esteem . . . Which is a critique of the excerpt? Gold earrings are given to enslaved people and seen as cause for shame. The effects of slavery are much worse than the effects of materialism. To show their disdain for gold and silver, Utopians use them for chamber pots. Utopians make a great effort to treat precious metals for everyday purposes.

Answers

Utopians make a great effort to treat precious metals for everyday purposes.

This is the option that shows the most critique rather than just summarizing or repeating parts of the passage. It provides insight into the meaning of the passage and a perspective on their views/opinions within. 

The answer is B. The effects of slavery are much worse than the effects of materialism.

Explanation:

The word "critique" refers to a revision, assessment or evaluation of one material or set of ideas. This means in a critique of a text you evaluate "critically" the positive and negative aspects of it. In the text presented, which belongs to the book Utopia, it is explained to avoid the effect of materialism the authorities of a nation had implemented the use of precious materials such as gold and silver in everyday objects and in objects that are not desirable such as chains for slaves.

Because of this, one of the critics of this excerpt is that "The effects of slavery are much worse than the effects of materialism" because slavery is linked to human degradation, violence, etc and therefore it has more negative consequence than materialism, which is opposite to the ideas suggested in the tex and therefore this sentence is an evaluation or critique of the excerpt. Also, other options only restate or summarize ideas of the text rather than create a critique about them.

Read Pat Mora’s poem quoted in "The Leader in the Mirror." Immigrants wrap their babies in the American flag, feed them mashed hot dogs and apple pie, name them Bill and Daisy, buy them blonde dolls that blink blue eyes or a football and tiny cleats before the baby can even walk, speak to them in thick English Now read the excerpt from Mora’s essay "The Leader in the Mirror." My own father was once a paper boy for the newspaper hosting the banquet. I might not have known that fact, nor his long history of hard work, had I not been listening to him with my tape recorder a few years ago. I did not want the students to wait as long as I had to begin preserving the rich inheritance of their family voices. The strength of their heritage would give them the courage to face the future. How are the two passages different? In the poem, Mora writes about immigrant families’ desire to fit in. In the essay, she writes about the importance of remembering one’s heritage. In the poem, Mora writes about her own family heritage. In the essay, she writes about immigrant families in general. The poem uses flowery language, while the language in the essay is scientific. The poem is written with a rhyming pattern, while the essay is not written in rhyme.

Answers

A. In the poem, Mora writes about immigrant families' desire to fit in. In the essay, she writes about the importance of remembering one's heritage.

The correct answer is A.

In Pat Mora's poem, she shows how important it was for immigrant families to fit in the american society. They educated their children with american values, gave them american names and even thought them English rather than their own languagues as babies.

On the other hand, in the essay, Mora expresses the importance of rememebering one's heritage. She explains that it had taken her a long time to know all the hardship his father had gone through as a boy and seeks to get students to familiarise with their own familys's histories and heritages.

In a Shakespearean sonnet, the first quatrain is usually composed of _____.
A.three alternating lines with AABB rhyme
B.four lines with ABAB rhyme
C.two lines with AB rhyme
D.four lines with AAAA rhyme

Answers

The answer is
B. Four lines with ABAB rhyme.
In a Shakespearean sonnet, the first quatrain is usually composed of four lines with ABAB rhyme. So the answer to your question would be letter B.  The Shakespearean sonnet is usually composed  three quatrains (four lines in a group) and a closing couplet (two rhymed lines).

Select all that apply. Twenty Thousand Leagues Under the Sea is considered science fiction because it _____.
A. is a work of fantasy
B. is a work of pure scientific fact
C. breaks away from reality
D. takes place in an unreal world
E. portrays life at sea in the nineteenth century
F. is based on science fact or assumption

P.S. Please remember that this question may have more than one answer,
Thank You for the Help!

Answers

A, C, D, and F, Good luck!
All of the above. Fantasy, breaking away from reality, takes place in an unreal world, and is based on science fact or assumption are all characteristics of science fiction. Science fiction typically portrays space or time travel with life on another planet.  


What literary device is employed here?
" O my love! my wife! Death, that hath suck'd the honey of thy breath, Hath had no power yet upon thy beauty: Thou art not conquer'd; beauty's ensign yet Is crimson in thy lips and in thy cheeks, And death's pale flag is not advanced there. (V, ii, 94-99) "

a. dramatic irony
b. foreshadowing
c. oxymoron
d. allusion

Answers

Right away you can eliminate Allusion and Oxymoron
Allusion would be repetition of the beginning of the words which it doesn't have. Oxymoron would be a combination of ideas etc. cruel kindness or living death which it doesn't have. Now we have foreshadowing and Dramatic irony. In this case it isn't exactly given a story and it leaves no hints to tell what could happen later on in the story. Therefore A. Dramatic Irony should be the answer. It describes with a dramatic tone how Romeo is looking at Juliet's corpse and talking about how beautiful it looks

Answer:

the answer A. dramatic irony

1. What is the best summary of Alice’s scene with the White Rabbit? (1 point)

A. Alice meets the White Rabbit and gives him back his gloves. The White Rabbit is upset because he is late, and he ignores Alice and runs away. Alice keeps getting smaller.

B. Alice has just realized she is shrinking when the White Rabbit runs in. She begs him to help her get home, but he is distracted by his fear of the Duchess. The Rabbit recovers his gloves from the floor and hurries on his way through a trap door, leaving Alice alone to investigate the door.

C. Alice keeps getting smaller and smaller. She talks about being smaller than a table. She throws the
gloves and fan to the ground. When the White Rabbit comes in, she says she wants to go home. The Rabbit is looking for his fan and gloves. He finds his fan and gloves on the floor. Alice says that he dropped them. The Rabbit talks about the Duchess and says she will chop off Alice’s head.

D. Alice is all alone again when the White Rabbit leaves through the trap door. Before that, she begged the Rabbit to help her get home, but the Rabbit ignored her because he was too worried about the Duchess. Alice is worried about shrinking.

Answers

To be honest they all are great choices but personally I would suggest answer C.

Hope this helps. 

Answer:

C. Alice keeps getting smaller and smaller. She talks about being smaller than a table. She throws the

gloves and fan to the ground. When the White Rabbit comes in, she says she wants to go home. The Rabbit is looking for his fan and gloves. He finds his fan and gloves on the floor. Alice says that he dropped them. The Rabbit talks about the Duchess and says she will chop off Alice’s head.

Which information is provided explicitly in this passage?
A) Hiawatha was a gifted and talented public speaker.
B) The Iroquois people united in order to protect their crops.
C) The Iroquois Confederacy is comprised of five different tribes.
D) Schools are named in honor of Hiawatha, primarily in the Midwest.

Answers

I can't know for sure without seeing the passage as some answers may not even be in the paragraph but explicit is when something is clearly stated and does not leave you with questions. I would have to go with A but check the paragraph first to make sure it is even in it.
B . the iroquois people united in order to protect their crops.

What is the correct way to revise the punctuation in the sentence? We could choose one of three ice cream flavors that had strawberries, cherries, and blueberries; chocolate chips, peanut butter, and fudge; or almonds, walnuts, and pecans. We could choose one of three ice cream flavors that had strawberries: cherries: and blueberries; chocolate chips: peanut butter: and fudge; or almonds: walnuts: and pecans. We could choose one of three ice cream flavors that had strawberries, cherries, and blueberries, chocolate chips, peanut butter, and fudge, or almonds, walnuts, and pecans. We could choose one of three ice cream flavors that had strawberries; cherries; and blueberries; chocolate chips; peanut butter; and fudge; or almonds; walnuts; and pecans

Answers

Answer:

a

Explanation: imsmart

The correct way to revise the punctuation in the sentence is: We could choose one of three ice cream flavors that had strawberries, cherries, and blueberries; chocolate chips, peanut butter, and fudge; or almonds, walnuts, and pecans.

What is punctuation?

Punctuation refers to the set of symbols and marks used in writing to clarify meaning and convey the intended tone, emphasis, and structure of a sentence.

Proper punctuation is important because it helps to ensure that the meaning of a sentence is clear and that the writer's intended emphasis and tone are conveyed accurately.

We could choose one of three ice cream flavors that had strawberries, cherries, and blueberries; chocolate chips, peanut butter, and fudge; or almonds, walnuts, and pecans is the correct way to revise the punctuation in the sentence.

Learn more about punctuation here:

https://brainly.com/question/12015116

#SPJ5

Which characters describe themselves as friends with Mersault? Select all that apply. Céleste Masson Raymond Salamano

Answers

Hello :D

Answer:
Raymond Salamano described themselves as friends with Mersault

I hope this helps!
Good day :)))

The answer is:

Céleste Raymond

In Albert Camus' "The Stranger," even though Mersault's neighbor Raymond manipulates him to get involved in his maneuvers, he still testifies on Mersault's behalf at his trial. Similarly, cafe owner Céleste also gives testimony on his murder prosecution supporting him. She claims that he is a respectable, honest man, and attributes the murder of the Arab to Mersault's bad luck.

In which sentence are parentheses correctly used?
A. (South of Pecan Bayou near the old mill) stands the historic Greenleaf Fisk home. B. South of Pecan Bayou (near the old mill) stands the historic Greenleaf Fisk home. C. South of Pecan Bayou near the old mill (stands the historic) Greenleaf Fisk home.

Answers

The answer is, in-fact, B.

In sentence B, parentheses are correctly used to provide additional information or clarification within the sentence.

In sentence B, parentheses are correctly used: South of Pecan Bayou (near the old mill) stands the historic Greenleaf Fisk home. Parentheses are used to provide additional information or clarification within a sentence without disrupting its structure. In this case, the parentheses clarify the specific location of the historic home.

Learn more about parentheses usage here:

https://brainly.com/question/37187392

#SPJ2

Read the paragraph. Global warming resulting from greenhouse gases is a serious issue that demands immediate action. Throughout the world, we can already see the significant effects of global warming on people and natural habitats. What would make the best conclusion? If we do not take action now, our world will undergo drastic changes that will negatively affect our environment for thousands of years. I’ve seen temperatures rise over my lifetime, and I hate to think of them rising further. Scientists will lead the way with new evidence, but we all must join together to take effective action against this impending issue. More and more, our ice caps will melt and our weather will change, and only those of us who are insightful will take a stand.

Answers

The correct answer is this:  IF WE DO NOT TAKE ACTION NOW, OUR WORLD WILL UNDERGO DRASTIC CHANGES THAT WILL NEGATIVELY AFFECT OUR ENVIRONMENT FOR THOUSAND OF YEARS. 
The passage given above is talking about the negative effects of global warming on natural environments and on humans. The best conclusion for the sentences written above is the sentence in option A, which talks about the need to take action now in order to prevent negative changes that may last for many years.

The option that would make the best conclusion is:  If we do not take action now, our world will undergo drastic changes that will negatively affect our environment for thousands of years.

What is a Conclusion?

A conclusion is a final decision that is reached based on glaring facts. As the passage mentioned, global warming is an occurrence that can have negative consequences for the future.

So, a good conclusion will be to take action now.

Learn more about conclusions here:

https://brainly.com/question/24542637

Mr. Utterson had been some minutes at his post, when he was aware of an odd light footstep drawing near. In the course of his nightly patrols, he had long grown accustomed to the quaint effect with which the footfalls of a single person, while he is still a great way off, suddenly spring out distinct from the vast hum and clatter of the city. Yet his attention had never before been so sharply and decisively arrested; and it was with a strong, superstitious prevision of success that he withdrew into the entry of the court. What is the mood of the excerpt?

Answers

Hello!

I'd say that the mood of this excerpt is suspenseful. 

First of all, the setting is during the night, and this centers around a man by himself on patrol and hearing footsteps drawing near. Passages like this would usually create a feeling of anticipation for what's going to happen next.

Hope I helped! :3

What is the name of the poetic division used in "The Divine Comedy"?

A. Libras

B. Cantos

C. Chapters

D. Pages

Answers

cantos should be right but I'm not 100%

Final answer:

The poetic division used in "The Divine Comedy" is called Cantos, serving a similar purpose to chapters, and is essential for the poem's narrative and thematic structure.

Explanation:

The poetic division used in "The Divine Comedy" is known as Cantos. This division functions similarly to chapters in a book, organizing the epic poem into distinct sections. Each canto encapsulates a specific event or theme, guiding readers through Dante's allegorical journey through Hell (Inferno), Purgatory (Purgatorio), and Paradise (Paradiso). For example, in the fifth canto of Inferno, Dante and his guide Virgil encounter the circle of the lustful, showcasing Dante's use of vivid imagery and complex moral inquiries within these carefully structured divisions. The Divine Comedy's use of cantos is crucial for its narrative and thematic development, marking a significant contribution to epic poetry.

which story element gives the reader the most insight into the negative aspects of a culture's code of behavior

Answers

the awnser to the question is a- apex 

The correct answer is option "A. How the antagonist opposes other characters in the story. "



The antagonist is the restricting power in a story. It could be a human enemy, or it could be non-human, similar to a creature or something less substantial, similar to fear. The antagonist assumes a vital part in story improvement. Consider a most loved motion picture you jump at the chance to watch. In the event that there is antagonist in a story or motion picture, this is on the grounds that there is a type of enemy. The protagonist in the story is looking for determination; the antagonist opposes such determination, however all great stories require antagonists.

how can citations lend credibility to your work

a. they show that you have done the necessary research to back up your thesis
b. they show that researchers have allowed you access to their work
c. they increase the technical complexity of the overall paper
d. they display conformity with accepted style and usage guidelines

Answers

I believe the answer is A

If something is stated implicitly in a text, this means it is ________ stated. directly indirectly plainly unclearly

Answers

indirectly, as that is what implicitly means
If something is stated implicitly in a text, this means it is indirectly stated. The word 'implicitly' means something that is not directly expressed. The word 'indirectly' means something that is not direct or not directly caused by something. These two words are incredibly similar which leads to believe that indirectly is in fact the correct answer.

Which of the following additions would make the paragraph more objective and effective? the use of facts and statistics to support the anecdote the use of more subjective words like “worst” and “best” the use of another anecdote about a patient the use of more figurative language when relating the anecdote

Answers

A. the use of facts and statistics to support the anecdote


When trying to be objective in writing what should be avoided is the use of bias.  To make writing more effective and objective, one technique often employed is the inclusion of facts and statistics without any sort of analysis on a writer’s behalf.  One should only include (as bland as it may seem) the fact and just the facts.  The moment a writer includes an opinion or analysis, the writing becomes subjective and biased.  As such, writer's will want to avoid words like "best" and "worst" because of the innate biased/opinionated nature of those words.







Final answer:

The paragraph would be more objective and effective with the inclusion of facts and statistics to support the anecdote, as they add credibility and strengthen the argument, contrasting with subjective words and figurative language that may detract from objectivity.

Explanation:

The paragraph would become more objective and effective with the use of facts and statistics to support the anecdote. Relying on objective evidence like data and statistics adds a layer of credibility and can demonstrate that the anecdote is not an isolated case but part of a broader trend or reality, thereby strengthening your argument. On the contrary, the use of subjective words like "worst" and "best," or adding more anecdotes, might make the paragraph more interesting but will not necessarily enhance its objectivity. Moreover, the overuse of figurative language could detract from the clarity of the message. Maintaining an objective tone and backing up statements with concrete evidence establishes authority and encourages the reader to take the argument seriously.

Read the excerpt from "Violets." Some whispered that a broken heart had ceased to flutter in that still, young form, and that it was a mercy for the soul to ascend on the slender sunbeam. What larger universal idea about life do the mourners’ whispers convey?

Answers

Unrequited love resulting to broken relationships or heart can be or could correspond to death. It may seem overly rated but this happens in real life as emotions play a big part to a person's well being. This is what makes us human.

Answer:

The heartbreak of unrequited love is akin to death.

Explanation:

These lines convey the idea that a broken heart due to unrequited love is as painful and as sad as death. We learn that the person being discussed is most likely young and in love. However, her heart was broken because her love was not reciprocated. This was so painful it felt like a death to her, and to those who observed it.

as a boy—that's all he was— backs from the corner package store shooting a pistol, firing it, once, at the dumbfounded man who falls forward, grabbing at his chest. When the speaker describes the shooter as "a boy—that’s all he was—” what theme is suggested? Young boys are more violent than young girls. Children who commit crimes should be tried as adults. Young boys need structure to stay out of trouble. Children who commit acts of violence are victims too.

Answers

I think the answer would be children who commit acts of violence are victims too.
I agree is children who commit violence

Mr. Thomas's attitude and tone toward the Wormsley Common Gang can be described as which of following?

Question 7 options:

A)

indulgent approval


B)

gruff kindness

C)

total disregard


D)

stern disapproval

Answers

B.) Gruff Kindness . . .. 

Which sentence does not use the past tense consistently?

Answers

I need to see the options to help, but past tense would be "Was", "-ed", and so forth
what is the answer choice for this question  

Choose the correct relative pronoun. I scolded the boy _____ shouting disturbed me. who whose whom what

Answers

The answer is whose
"I scolded the boy whose shouting disturbed me."

a vacation of five days Which is the correct way to rewrite this phrase?
A. five days’s vacation
B. five days’ vacation
C. five days’es vacation
D. five days vacation

Answers

Maybe B.) 


Personally, I wouldn't choose any and I would put a Five-day vacation.

Answer:

B. five days’ vacation

Explanation:

Hence it is that both Emily and Charlotte are always invoking the help of nature. They both feel the need of some more powerful symbol of the vast and slumbering passions in human nature than words or actions can convey. . . . They seized those aspects of the earth which were most akin to what they themselves felt or imputed to their characters, and so their storms, their moors, their lovely spaces of summer weather are not ornaments applied to decorate a dull page or display the writer's powers of observation—they carry on the emotion and light up the meaning of the book. Appropriate textual support for this claim would include _____. Select all that apply. the use of hyperbole and personification the description of a natural landscape insight into the emotional state of a character an explanation of the relationship between characters

Answers

Final answer:

To support the claim about Emily and Charlotte Brontë's use of nature in writing, appropriate textual support would include personification of nature, detailed descriptions of landscapes, insights into characters' emotions, and examination of characters' relationships to their surroundings.

Explanation:

The claim that both Emily and Charlotte Brontë incorporate nature into their works in a way that conveys emotion and meaning can be supported by highlighting different elements of their writing. To validate this claim, one could look for textual support in the forms of personification, where nature takes on human characteristics; descriptions of natural landscapes, which reflect the inner states of characters; insights into emotional states provoked by these natural settings; and the relationship between characters and their environments.

An example of effective quotation integration might discuss how natural elements, such as the moors in 'Wuthering Heights', serve more than mere backdrop but underscore the turbulent emotions of the characters. The stormy weather often mirrors the internal chaos, providing an external representation of the inner conflict. Furthermore, descriptions of the landscape, seizing the breath or reeling and dancing, are not merely decorative but carry significant emotional weight and connection to the characters' experiences.

Model examples can draw from specific scenes that showcase how the environment and the portrayal of nature advance the narrative or thematic development, thereby strengthening the argument that the natural world is integral to conveying the deeper meaning of these literary works.

why is "sea-scented beach" an example of both alliteration ans of assonance

Answers

"Sea-scented beach" is an example of both alliteration and assonance due to the fact that, (alliteration) you have two repeating consonants "sea-scented..." and assonance because of the "ea" in sea, and the "ea" in beach make the same sound.

Read the sentence. I wish that advanced algebra _____ extremely easy. Which verb correctly completes the sentence? was were is has been

Answers

the best answer would ether be was or were

the correct answer is "is"

Where would Jane have to go if Mrs. Reed did not support her? A) To the poorhouse B) To boarding school C) To another country D) To live on the streets

Answers

A is MOST Likely the answer.

Hope this Helped!

;D

correct answer is A.) To the poorhouse -nyah

Other Questions
BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is The difference between two numbers 2.when each number is rounded to the nearest hundred , the difference between them is 100. What Numbers Could these be? What prevents bacteria and materials in the large intestine from flowing backward into the ilieum of the small intestine? "Iconography" is best described as A. identifying, describing, and interpreting subject matter in art. B. writing about artwork. C. organizing a collection of images by style. D. discovering and cataloging artifacts.