Which expressions are equivalent to -6+3(2+(-4t))?
Choose all answers that apply:

(Choice A)
A
-12t

(Choice B)
B
12t-12

(Choice C)
C
None of the above

Answers

Answer 1

Answer:

I belive that choice A would be the best answer!

Step-by-step explanation:


Related Questions

Which cylinder has the greatest volume?
O a cylinder with a height of 9 cm and a radius of 9
cm
a cylinder with a height of 12 cm and a radius of 6
cm
a cylinder with a height of 6 cm and a radius of 12
cm
a cylinder with a height of 15 cm and a radius of 3
cm

Answers

Answer:

The answer is C. a cylinder with a height of 6 cm and a radius of 12 cm

Step-by-step explanation:

I did it on the assignment

Answer:

The answer is C. a cylinder with a height of 6 cm and a radius of 12 cm

Step-by-step explanation:

(4-2)^3-3x4 what is the answer

Answers

Answer:

-4.

Step-by-step explanation:

I am assuming that x means times here.

(4-2)^3-3x4

= 2^3 - 12

= 8 - 12

= -4.

HELP ASAP
Select the correct answer.
D = matrix (1 2 -3
2 -6 1
4 2 5)
is the coefficient matrix of a system of linear equations and
Dx = matrix ( 46 2 -3
-41 6 1
-11 2 5)

What is the solution of the system of linear equations represented by D and Dx?A.
(5, 4, -11)
B.
(5, 7, -9)
C.
(6, 7, -11)
D.
(6, 4, -9)

Answers

Final answer:

The solution to the system of linear equations represented by D and Dx is (x,y,z) = (5, 4, -11), which corresponds to option A.

Explanation:

To solve for Dx in the given system of linear equations, we multiply matrix D by the unknowns (x, y, z). So let's assume that Dx = (x, y, z).

By comparing the results of Dx and the given matrix, we can write the system of equations as:

1x + 2y - 3z = 46; 2x - 6y + z = -41; 4x + 2y + 5z = -11.

By solving this system of equations, we can find that the solution is (x,y,z) = (5, 4, -11), which corresponds to the multiple-choice option A.

Learn more about System of Linear Equations here:

https://brainly.com/question/33609849

#SPJ11

Final answer:

To find the solution of the system of linear equations represented by matrices D and Dx, we need to solve the equation Dx = Dⁿⁿ. By calculating the inverse of matrix D and substituting the values of Dx, we find that the solution is (5, 7, -9).

Explanation:

To find the solution of the system of linear equations represented by matrices D and Dx, we need to solve the equation Dx = Dⁿⁿ

Let's use matrix inversion to solve for x. We know that Dx = Dⁿⁿ can be rewritten as x = Dⁿⁿ −1 Dx. To find Dⁿⁿ −1, we need to calculate the inverse of matrix D:

After calculating the inverse of matrix D, we can substitute the values of Dx into the equation x = Dⁿⁿ −1 Dx to find the solution.

Plugging in the values of Dⁿⁿ and Dx, we get x = (5, 7, -9).

Learn more about Solution of Linear Equations here:

https://brainly.com/question/34777099

#SPJ3

What is 25% of what number is 13?

Answers

Answer:

52

Step-by-step explanation:

Of means multiply and is means equals

25% * W = 13

Changing to decimal form

.25W =13

Divide each side by .25

.25W/.25 = 13/.25

W =52

the side of an equilateral triangle are8 units long. what is the length of the altitude of the triangle?

Answers

So, the triangle is equilateral, all its sides are equal⇒

AB=BC=AC=8

In an equilateral triangle, the height is also the median, so it divides the sides into 2 equal parts⇒

AO=OC=8:2=4

by the Pythagorean theorem

[tex]8^2=4^2+BO^2\\BO^2=64-16\\BO=\sqrt{48} \\BO=4\sqrt{3}[/tex]

Answer: BO=4√3

/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\

P.S. Hello from Russia :^)

Very Simple 1st to get a right answer gets Brainliest!!
The coordinates of the community center are (−5, −1). Who has a house in the same quadrant as the community center?

Dan
Joe
Lee
Roy

Answers

Answer:

Lee's house.

Step-by-step explanation:

Plot (-5, -1) on a graph and Lee's house is the closest and in the same quadrant.

Answer: LEE

Step-by-step explanation:

because its a negative and a negative.

The radius of the circle is 12 cm. What is the circumference of the circle? (Use [pi = 3.14.)

Answers

Answer:

C =75.36 cm

Step-by-step explanation:

The circumference of a circle is given by

C = 2*pi*r

C = 2 *3.14 *12

C =75.36 cm

A line segment has an endpoint at (3, 2). If the midpoint of the line segment is (6, -2), what are the coordinates of the point at the other end of the line segment?

Answers

Answer:

(9,-6)

Step-by-step explanation:

The difference between the x coordinates (3 and 6) is 3 and the y coordinates (2 and -2) is -4, so the differences need to be the same from the midpoint to the other point.

6+3=9

-2+(-4)=-6

So the coordinates are (9,-6)

A car wash detailed 148 cars in 4 hours. At what rate did the car wash detail cars in cars per hour?
A. 38 cars per hour
B. 36 cars per hour
C. 35 cars per hour
D. 37 cars per hour

Answers

Answer:

D) 37 cars/hour

Step-by-step explanation:

148/4=37

37 because you / by 4

Find the answer please

Answers

Answer:

12.57

Step-by-step explanation:

(╯°□°)╯︵ ┻━┻ ᶠᴸᴵᴾ ᵀᴴᴬᵀ ᵀᴬᴮᴸᴱ.

┻━┻ ︵ ヽ(°□°ヽ) ᶠᴸᴵᴾ ᵀᴴᴵˢ ᵀᴬᴮᴸᴱ.

┻━┻ ︵ \(`0`)// ︵ ┻━┻ ᶠᴸᴵᴾ ᴬᴸᴸ ᵀᴴᴱ ᵀᴬᴮᴸᴱˢ

ಠ_ಠ ᶜᴴᴵᴸᴰ. . .

ಠ_ಠ ᴾᵁᵀ.

ಠ__ಠ ᵀᴴᴱ ᵀᴬᴮᴸᴱˢ.

ಠ___ಠ ᴮᴬᶜᴷ.

(╮°-°)╮┳━┳

(╯°□°)╯︵ ┻━┻ ᴺᴱᵛᴱᴿ

(•_•)

<) )╯ᴮᴱᶜᴬᵁˢᴱ ᴵ'ᴹ

/ \

⊂_ヽ

 \\ _

  \( •_•) ᶠ

   < ⌒ヽ ᴬ

  /   へ\ ᴮ

  /  / \\ ᵁ

  レ ノ   ヽ_つ ᴸ

 / / ᴼ

 / /| ᵁ

 ( (ヽ ˢ

 | |、\

 | 丿 \ ⌒)

 | |  ) /

`ノ )  ᴸノ

(_/

Answer:

4pi

Step-by-step explanation:

Pi * r^2 = area of circle

r = 2

pi*2^2 =

4pi

juan needs to measure 6 cups of flour for a recipe.he only has a 1/4 cup measuring cup.how many times must he fill the measuring cup to get 6 cups of flour

Answers

Answer:

Juan would need to fill up the 1/4 measuring cup 24 times.

Step-by-step explanation:

So to measure one cup of flour with a 1/4 measuring cup, you would need to fill up the 1/4 measuring cup 4 times. Since we want 6 cups, you would need to fill up the 1/4 measuring cup 24 times. 6 times 4 = 24. Hope this helps!

Final answer:

Juan would need to use his 1/4 cup measuring cup 24 times to get a total of 6 cups of flour. This is solved by multiplying the number of quarters (4) in a cup with the total cups Juan needs (6).

Explanation:

In order to understand the problem, we need to consider that each cup contains 4 quarters. So, if 1 cup equals 4 quarters, then 6 cups, the amount Juan needs for his recipe, would be 6 multiplied by 4, which is 24. Therefore, Juan would need to fill his 1/4 cup measuring cup 24 times to get a total of 6 cups of flour.

This is a problem of mathematics, precisely about ratios and proportions, commonly taught in middle school.

Learn more about Ratios and Proportions here:

https://brainly.com/question/26974513

#SPJ3

Equivalent Expression of

11 - 30x + 24​

Answers

The correct answer is -30x+35

In this picture b, d, and f are midpoints. Ac=50 ce=60 and bd=35. What is bf

Answers

Answer:

BF = 30

Step-by-step explanation:

Since B and F are midpoints of AC and AE then BF is a midsegment and is one half the measure of the third side CE, thus

BF = 0.5 × 60 = 30

The value of BF will be, 30 units.

What is mean by Triangle?

A triangle is a three sided polygon, which has three vertices and three angles which has the sum 180 degrees.

Given that;

In this picture;

B, D, and F are midpoints.

And, AC = 50, CE = 60 and BD = 35.

Here, C is midpoint of CE.

Hence, We get;

⇒ CD = 1/2 × 60

           = 30

Here, The length of BF is equal to the length of CD.

Hence, The value of BF = 30 units.

Learn more about the triangle visit;

brainly.com/question/1058720

#SPJ5

At the toy store for cars cost $3.28 how much does it cost to buy 30 toy cars

Answers

Answer:

98.4

Step-by-step explanation:

Multiply 3.28 by 30

Answer:

$98.40

Step-by-step explanation:

3.28x30=98.4

Using the Addition Method, solve for y in the following system of linear equations.

4x-2y=6
2x+y=7

Answers

Answer:

x = 3.33

y = 0.33

Step-by-step explanation:

to evaluate for y in this system of linear equation we would say that let

4x-2y=6 ........................................................... equation 1

2x+y=7 ..............................................................equation 2

from equation 2

2x+y=7 ..............................................................equation 2

y = 7 - 2x........................................... equation 3

substitute for y in equation 1

4x-2y=6 ........................................................... equation 1

4x -2( 7 - 2x) = 6

4x - 14 + 2x = 6

6x = 6 +14

6x = 20

divide both sides by 6

6x/6 = 20/6

x = 3.33

put x into equation 3

y = 7 - 2x........................................... equation 3

y = 7 -2( 3.33)

y = 7 -6.667

y = 0.33

Final answer:

To solve for y using the Addition Method, first manipulate the equations to have opposite coefficients for y, add them to find x, and then substitute x back into one of the original equations to solve for y. The solution is x = 2.5 and y = 2.

Explanation:

The student is asking how to solve for y in a system of linear equations using the Addition Method. The given system of equations is:

4x - 2y = 6

2x + y = 7

To use the Addition Method, we aim to eliminate one variable by adding the equations. First, we manipulate the equations to have opposite coefficients for the y variable. Multiply the second equation by 2:

(2x + y) × 2 → 4x + 2y = 14

Now we have:

4x - 2y = 6  (Equation A)

4x + 2y = 14 (Equation B)

Add Equation A and Equation B:

4x - 2y + 4x + 2y = 6 + 14

8x = 20

x = 20 / 8

x = 2.5

Substitute x back into the second original equation to solve for y:

2(2.5) + y = 7

5 + y = 7

y = 7 - 5

y = 2

Hence, the solution to the system of equations is x = 2.5 and y = 2.

Help please and thankyou <3

Answers

The answer is D, because -2/3/2 = -4/3.

Answer:

the answer is D

Step-by-step explanation:

-2/ 3/2

= -2 × 2/3

= -4/3


Hakim was feeling adventurous at lunch. Rather than choosing a single drink, he decided to
mix together all the drink choices. He mixed an equal amount of 7 types of soda to fill his 12-
ounce cup to the brim!
How many ounces of each type of soda did hakim get?​

Answers

1.71 ounces for the sodas

Mr. Hopkins has a 1-meter wire he is using to make clocks. Each fourth meter is marked off and

divided into 5 smaller equal lengths. If Mr. Hopkins bends the wire at - meter, what fraction of the

smaller marks is that?

Answers

Answer: fraction = 1/20 or 0.05

Step-by-step explanation:

Let's first convert metre to centimeter

1 metre = 100 centimeters

Given that Each fourth meter is marked off and divided into 5 smaller equal lengths. This means:

1/4 × 100 = 25

Then divide 25 into 5 places

25/5 = 5cm

If Mr. Hopkins bends the wire at - meter, what fraction of the smaller marks is that?

The fraction = 5/100 = 1/ 20 or 0.05

3x + 14 = 3,,,,,,,,,,,,

Answers

Answer:

-11/3

Step-by-step explanation:

-11/3 i think, i’m not sure what it’s for tho

What is the radius of the circle without the equation to solve it?

Answers

Answer:

radious 7

diameter 14

Step-by-step explanation:

Final answer:

The radius of a circle can be found using the formula r = C/(2π), where r is the radius and C is the circumference of the circle.

Explanation:

The radius of a circle can be found using the formula r = C/(2π), where r is the radius and C is the circumference of the circle. Since the value of π is approximately 3.14159, you can divide the circumference of the circle by 2π to find the radius.

For example, if the circumference of the circle is 10 units, the radius would be 10/(2π) units.

Remember to use the appropriate units for both the circumference and the radius.

What is the value of y in this simplified expression?

11^-4/11^-8=11^y

a.-12

b.2

c.4

d.32

Answers

Answer:

choice C. y = 4

Step-by-step explanation:

Simplify  11^-4 / 11^-8

=  11^(-4 - (-8) ) =  11^(-4+8)  =  11^4

so

11^4 = 11^y

means  y = 4

Please answer this question

Answers

Answer:

One of these numbers is a cube number which means that it could be 1,8, or 27 because those are the first three cube numbers.

If you go with one then you have to find two more numbers that add up to 35 and are a factor of 20, which is not possible.

Then you use 8, which means you have to find two numbers that add up to 26, and are factors of 20, which could be nothing, there aren't any.

Last you do 27 which means you need to find two numbers that add up to 9 and are factors of 27, which can be 4 and 5, because 4+5=9 and 4*5=20.

27,4,5

Hope this helps ;)

WILL MARK BRANLIEST! 100 POINTS!

Answers

Answer:

g(x)=9

Step-by-step explanation:

use a vertical line to determine what the y value is for g(x)

g(x)=9

Step-by-step explanation:

use a vertical line to determine what the y value is for g(x)

Find the median of the following numbers. 14, 17, 21, 28, 40. ​

Answers

Answer:21

Step-by-step explanation: The median is the number in the middle sorted from least to greatest, here 21 is the middle number.

Answer:

21

Step-by-step explanation:

3. What is the area of the parallelogram below?

Answers

40.

Step-by-step explanation:

Base times height. This is a rhombus. 4 x 10 = 40. If you chop off the triangle to the right and place it on the left where 5 is, it'll be a rectangle. Formula for a rhombus is B x H, Base is 10, height is 4, and you get 40.

Identify the fungus type pictured below.
Public Domain (2 points)
A.Sac fungi
B.Zygote fungi
C.Club fungi
D.Imperfect fungi

Answers

Not sure I think it’s Sac fungi but I may be wrong

Answer: sac fungi

Step-by-step explanation:

The Lewis family is building a circular swimming pool if the radius of the pool is 9 feet what is it’s circumference use TT =3.14 to solve


51.62
56.52
61.52
66.42

Answers

Answer:

C =56.52 ft

Step-by-step explanation:

The circumference is found by

C = 2*pi*r  where r is the radius

C = 2*3.14 * 9

C =56.52 ft

Use the definition of continuity and the properties of limits to show that the function f(x) = x^2 + 5(x - 2)^7 is continuous at x = 3

Answers

Answer:

See below.

Step-by-step explanation:

First check that f(x) has a real value at x = 3:

f(3) = 3^2 + 5(3 - 2)^7

=  9 + 5 * 1^7

=  14,

So the first condition is met.

Now we check if limit as x approaches 3 exists.

As x approaches 3 from below f(x) approaches 14 and at x = 3 = 14.

As x approaches 3 from above f(x) approaches 14 and at x = 3 = 14.

These 3 conditions  shows that f(x) is continuous at x = 3.

Final answer:

The function f(x) = x^2 + 5(x - 2)^7 is continuous at x = 3 because it meets all the conditions of continuity: it is defined at x = 3, the limit of the function as x approaches 3 exists, and the limit equals the function's value at x = 3.

Explanation:

The function f(x) = x^2 + 5(x - 2)^7 is continuous at x = 3 if it satisfies the following three properties: the function is defined at x = 3, the limit of the function as x approaches 3 exists, and the function value at x = 3 is equal to the limit as x approaches 3.

Step 1

The function is defined at x = 3. When we substitute x = 3, we get f(x) = 3^2 + 5(3 - 2)^7= 9 + 5*1^7 = 14.

Step 2

The limit of the function as x approaches 3 exists. As x approaches 3 from both the left and right sides, the function takes the value 14.

Step 3

Finally, the limit as x approaches 3 is equal to the function's value at x = 3. In other words, the limit is 14, which is equal to the function's value when x = 3 (which is also 14).

Since the function satisfies all these conditions, we can say that the function f(x) = x^2 + 5(x - 2)^7 is continuous at x = 3.

Learn more about Continuity of Functions here:

https://brainly.com/question/32522941

#SPJ2

Solve for x to the nearest degree (34.3 = 34)

Answers

Answer:

48°

Step-by-step explanation:

We can solve this using our knowledge on tangents of an angle. Remember, tangents are the opposite leg divided by the leg adjacent to that angle.

This means the tangent of x° =  [tex]\frac{10}{9}[/tex]. Now that we know the tangent ratio, we can find the angle with inverse trigonometric ratios. These kinds of ratios give us the opposite of the tangent - which would lead to the angle measure we're looking for. The equation would look like this:

[tex]x = arctan (\frac{10}{9})[/tex]

Using a calculator, the answer would be:

[tex]x = 48.0128[/tex]

Rounding this to the nearest degree would give us 48° as our answer! I hope this was clear enough.

What is 1 gallon, 3 quarts, 4 pints minus 3 quarts, 5 pints?

Answers

0.875 US gallons i think this is the aswer
Other Questions
11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes. Ethan and Chloe shared 50 in the ratio 1:4 Which are evidence of seafloor spreading? Select three options. There are 14 books on a shelf. 6 of these books are new.(a) What is the ratio of used books to all books?(b) What is the ratio of new books to used books?? an elevator at a construction site has a maximum capacity of 2500 pounds. if the elevator operator weights 160 pounds and each cement bag weighs 60 pounds, how many bags of cement can be safely lifted on the elevator in one trip? What is the image point of (6,-1) after a translation left 4 units and down 5 units?