Which number best represents the situation. "A plane descends 1, 500ft?
1,500
15
-1,500
-15

Answers

Answer 1
C. -1,500 bc the plane is decreasing in the air

Related Questions

A playground 96 ft long and 48 ft wide is to be resurfaced at a cost of $4.75 per sq ft. What will the resurfacing cost?

Answers

Answer:

$21888

Step-by-step explanation:

96*48=4608

4608*$4.75=21888

The cost to do the resurfacing of the playground can be found to be $21, 888.

How to find the cost ?

To find the cost of resurfacing the playground, you need to calculate the total area of the playground and then multiply it by the cost per square foot.

The playground is 96 feet long and 48 feet wide, so its area is:

Area = Length × Width

Area = 96 ft × 48 ft

Area = 4,608 square feet

Multiply the area by the cost per square foot:

Resurfacing Cost = Area × Cost per square foot

Resurfacing Cost = 4,608 sq ft × $4.75/sq ft

Now, calculate the resurfacing cost:

Resurfacing Cost = $ 21,888

Find out more on resurfacing cost at https://brainly.com/question/25534432

#SPJ3


Find x in the right triangle.

A) 63
B) 175
C) 147
D) 324

Answers

Answer: C

Step-by-step explanation:The solution is 7

3

. This problem can be solved using the Pythagorean Theorem leg2 + leg2 = hyp2. 142 - 72=147,

147

Final answer:

The value of x squared is 147, leading to the answer choice C for the value of x in the right triangle.

Explanation:

To find the value of x in a right triangle where the hypotenuse = 14, and the length of the other side = 7, we will use the Pythagorean Theorem.

The Pythagorean Theorem states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the lengths of the other two sides.

This can be written as c² = a² + b², where c is the length of the hypotenuse and a and b are the lengths of the other two sides.

Using the given values we have: 14² = 7² + x².

Simplifying this, we get 196 = 49 + x2, and then 196 - 49 = x², which leads to 147 = x².

Therefore, x = √147.

After calculating, we find that x = √147, which simplifies to x = 12.124 (rounded to three decimal places).

However, the answer choices seem to require the square of x, in which case the answer would be 147, which is option C.

Rebecca is making bracelets to sell at a charity event. Each bracelet takes 1 1/4 of a foot of embroidery floss to make.If Rebecca has five yards of embroidery floss,how many bracelets can she make?

Answers

Answer:

12

Step-by-step explanation:

She has 15 feet of floss. 15/1.25 is 12.

Hope this helps!!

Answer:

15

Step-by-step explanation:

She has 15 feet of floss

A circular plate has circumference 21.4 inches. What is the area of this​ plate? Use 3.14 for pi.

Answers

Answer:

The area of this plate is [tex]36.31\ \text{inches}^2[/tex].

Step-by-step explanation:

We have,

Circumference of a circular plate, C = 21.4 inches

The circumference of a circular shape is given by :

[tex]C=2\pi r[/tex]

r is radius of circular shape

[tex]r=\dfrac{C}{2\pi}\\\\r=\dfrac{21.4}{2\times 3.14}\\\\r=3.4\ \text{inches}[/tex]

Area of this plate is given by :

[tex]A=\pi r^2\\\\A=\pi (3.4)^2\\\\A=36.31\ \text{inches}^2[/tex]

So, the area of this plate is [tex]36.31\ \text{inches}^2[/tex].

HELP PLEASE
Identify a, b, and c in the following quadratic equation 2x2+24=−4x.

Answers

Answer:

term a is 2x²

term b is 4x

term c is 24

Step-by-step explanation:

2x² + 24 = -4x

2x² + 4x + 24 = 0

term a is 2x²

term b is 4x

term c is 24

Tell me if I am wrong.

Can I get brainliest

Antonia bought a set of dishes, a towel, and a candle at a housewares store. The set of dishes cost $35.10, the towel cost $21.28, and the candle cost $9.53 before any coupons or discounts. She used a $0.50-off coupon on the candle, a $2.75-off coupon on the towel, and the set of dishes was on sale for 10% off the regular price. Which of the following best describes the amounts that Antonia saved? a. she saved the greatest percentage on the set of dishes b. she saved the greatest percentage on the towel c. she saved the greatest percentage on the candle d. she saved the same percentage on the towel and the set of dishes.

Answers

Answer:

A

Step-by-step explanation:

Since $2.75 discount is given on towel

$0.5 discount is given on candle

10% discount is given on set of dishes

We will have to calculate the discount for the set of dishes

10% of $35.10

10/100 ×35.10

=35.1

So the discount on the set of dishes is $35.1

When comparing the discount on the three things she bought,it was observed that she gained a lot from the discount given on the set of dishes

So the answer is A

Mikiah must choose between a pack of four 6.5-ounce containers of ice cream for $3.77 or a pack of three 8-ounce containers for $3.87. Which is the better buy? Why?

Answers

Answer:

a pack of three 8-ounce containers his is a better purchase

Step-by-step explanation:

In this case, what we must do is calculate the price per ounce and the one with the best value is the best purchase:

option 1: a pack of four 6.5-ounce containers of ice cream for $ 3.77

3.77 / (4 * 6.5) = 0.145

option 2: a pack of three 8-ounce containers for $ 3.87

3.87 / (3 * 8) = 0.161

The value of the price per ounce is less in option 1, therefore, this is a better purchase


Which could be the length of BC?

11 ft

13 ft

15 ft

18 ft

Answers

Answer:D

Step-by-step explanation: Got it right on the test

Evaluate 6²-7²+8²-9²+..+998²-999²​

Answers

Answer:

-499,485.

Step-by-step explanation:

We can transform this to an arithmetic series by  working it out in pairs:

6^2 - 7^2 = (6-7)(6+7) = -13

8^2 - 9^2 = (8-9)*8+9) = -17  

10^2 - 11^2 = -1 * 21 = -21 and so on

The common difference is -4.

The number of terms in this series  is (998 - 6) / 2 + 1

= 992/2 + 1 = 497.

Sum of n terms of an A.S:

= n/2 [2a1 + (n - 1)d  

Here a1 = -13, n = 497, d = -4:

Sum = (497/2)[-26 - 4(497-1)]

= 497/2 * -2010

= -499,485.

Based on the scale drawing, what is the length, in feet, of the actual parking lot?

Answers

Answer:

No one can help

Step-by-step explanation:

You did not provide the scale drawing

We need more details you added none we can’t help :/

The following distribution is not a probability distribution because
the probability values are not discrete.
the values of the variable are negative
the probability values are not increasing
the probability values do not add to 1.

Answers

Answer:

Choice 2

Step-by-step explanation:

The following distribution is not a probability distribution because the probability values do not add to 1.

If it were a probability distribution, the sum of all the probability values would be equal to 1.

The sum of the probability values is 0.16 + 0.15 + 0.42 + 0.13 + 0.31,

which is equal to 1.17.

Since the sum is greater than 1, it violates the requirement for a probability distribution.

Hence, the probability values do not add to 1.

To learn more on probability click:

https://brainly.com/question/11234923

#SPJ2

A segment XD is drawn in rectangle QUAD as shown
below.
What are the measures of ZXDQ and ZUXD ?
mZ XDQ=
mZ UXD =







–​

Answers

Answer:

41 and 139

Step-by-step explanation:

the answers are 41 and 139

For a standard normal distribution, find the approximate value of P(z≤0.42). Use the portion of the standard normal table below to help answer the question.
0.00
0.22
0.32
0.42
0.44
0.64
0.84
1.00
Probability
0.5000
0.5871
0.6255
0.6628
0.6700
0.7389
0.7995
0.8413
O
A. 16%
B. 34%
C. 66%
D. 84%​

Answers

We have been given that a z-score table and corresponding probability to each z-score. We are asked to find the probability of a getting a z-score less than or equal to 0.42 that is [tex]P(z\leq0.42)[/tex].

z-score                               Probability

0.00                                    0.5000

0.22                                    0.5871

0.32                                     0.6255

0.42                                     0.6628

0.44                                     0.6700

0.64                                     0.7389

0.84                                     0.7995

1.00                                     0.8413

Upon looking at our given table, we can see that the probability corresponding to z-score of 0.42 is 0.6628.

[tex]P(z\leq0.42)=0.6628[/tex]

Now, we will convert [tex]0.6628[/tex] into percent as:

[tex]0.6628\times 100\%=66.28\%[/tex]

Upon rounding to nearest percent, we will get:

[tex]66.28\%\approx 66\%[/tex]

Therefore, the approximate value of [tex]P(z\leq0.42)[/tex] is [tex]66\%[/tex] and option C is the correct choice.

Answer:

C

Step-by-step explanation:

Explain to me the strategy that you use to order a group of numbers that may be written in different forms, for example percentages, decimals, and fractions.

Answers

Answer:

Convert fractions, decimals, and percents to the same form to compare the values. Convert Percent to Decimal or Fraction. Convert Decimal to Percent or Fraction. Convert Fraction to Decimal or Percent. Then figure out which is greater or lesser. Use this information to write a set of numbers or quantities in order from least to greatest or from greatest to least.

Step-by-step explanation:

Ordering numbers mean plan of numbers either from little to enormous or from huge to little. At the point when the numbers are orchestrated in an expanding order, it is known as Ascending Order, and when the numbers are organized in a diminishing order, and afterward they are known as Descending Order. For ascending, check the most modest number from the given rundown and spot it first and afterward put the numbers as indicated by the expanding order. For descending check the greatest number from the given rundown and spot it first and afterward put the numbers as per the diminishing order.

A percentage is a part of an entire communicated as a number somewhere in the range of 0 and 100 instead of as a portion. All of something is 100 percent, half of it is 50%, none of something is zero percent.

A decimal is a part written in an extraordinary structure. Rather than composing 1/2, for instance, you can communicate the division as the decimal 0.5, where the zero is during the ones spot and the five is in the tenths spot.

A fraction just discloses to us what number of parts of an entire we have. You can perceive a fraction by the slice that is composed between the two numbers. We have a top number, the numerator, and a base number, the denominator. For instance, 1/2 is a fraction. You can compose it with an inclined slice like we have or you can compose the 1 on the 2 with the slice between the two numbers. The 1 is the numerator, and the 2 is the denominator.

Use the original price and the markdown to find the retail price.

Original price: $40; Markdown: 16%

Answers

Answer:

$33.6.

Step-by-step explanation:

40 x .16 = 6.4

40 - 6.4 = 33.6.

Feel free to let me know if you need more help. :)

what is the distance between ( 4, 7 ) and ( 2, 2 )

Answers

Answer:

it would be [tex]\sqrt{29}[/tex]

Step-by-step explanation:

Final answer:

To calculate the distance between (4, 7) and (2, 2), we use the distance formula, derived from the Pythagorean theorem: d = √[(x₂ - x₁)² + (y₂ - y₁)²]. Substituting our values into the equation gives a final answer of √29 units.

Explanation:

The subject of your question pertains to the calculation of distance between two points in a two-dimensional space, which is a concept in Mathematics. The points given are (4, 7) and (2, 2). To find the distance between these points, we can use the distance formula, derived from the Pythagorean theorem. The formula is d = √[(x₂ - x₁)² + (y₂ - y₁)²].

Here, (x₁,y₁) is (4, 7) and (x₂,y₂) is (2, 2). By substituting these values into the formula, we get

d = √[(2 - 4)² + (2 - 7)²]

= √[(-2)² + (-5)²]

= √[4 + 25]

= √29.

Therefore, the distance between (4, 7) and (2, 2) is √29 units.

Learn more about Distance Calculation here:

https://brainly.com/question/34212393

#SPJ2

earth moves in a orbit that is 585 million miles away from the sun.Write 585 million in scientific notation form.

Answers

Answer: 5.85 x 10 to the power of 6

Step-by-step explanation:

In the diagram, the measure of angle 1 is (3x), and the measure of angle 2 is (12x)".
516
87
What is the measure of angle 4?

Answers

Answer:

Angle 4 is 144.

Step-by-step explanation:

Applying the definition of vertical angles, the measure of angle 4 is: 144°.

What are Vertical Angles?

Vertical angles are a pair of angles that lie directly opposite each other and are equal in measure to each other.

m∠1 + m∠2 = 180° (linear pair)

Substitute

3x + 12x = 180

15x = 180

x = 12

∠4 and ∠2 are vertical angles, therefore:

m∠4 = m∠2 = 12x

Plug in the value of x

m∠4 = 12(12)

m∠4 = 144°

Therefore, applying the definition of vertical angles, the measure of angle 4 is: 144°.

Learn more about vertical angles on:

https://brainly.com/question/14362353

!!!!20 POINTS PLZ HELP!!!
A scale drawing of a rectangular garden has a length of 5 inches and a width of 3.5 inches. If the scale is 1-inch colon 3 feet, what is the area of the actual garden?
Answer options with 5 options
A.10.5 square feet
B.15 square feet
C.17.5 square feet
D.52.5 square feet
E.157.5 square feet

Answers

C de mmmmmmggffthxjdue

Answer:

E

Step-by-step explanation:

map scale: actual scale

= 1 inch: 3 feet

Area scale

= (1 in)²: (3 ft)²

= 1 in²: 9 ft²

This means that 1 in² of the drawing represents an actual area of 9 ft².

Area of garden in the drawing

= 5(3.5)

= 17.5 in²

Area of actual garden

= 17.5 ×9

= 157.5 ft²

Thus, the answer is E.

Need help..................

Answers

Answer:

(4-7x)(4+7x)

Step-by-step explanation:

This is a difference of squares. (16 is the square of 4, 49x^2 is the square of 7x.)

The formula for difference of squares is a^2 - b^2 = (a-b)(a+b)

16 - 49^2 = (4-7x)(4+7x)

what is the domain for y=3

Answers

Answer:

The domain is all real numbers

Step-by-step explanation:

The domain is the input values

y= 3 is a horizontal line across all x

The domain is all real numbers

The domain is all real numbers.

The domain is the possible values for x that result in a valid equation, no dividing by zero or any of that stuff.   Here there's no x in the formula, y=3 is a horizontal line, f(x)=3 for all x.  No x in the formula means it works for all x; nothing to go wrong.

Are the lines 2x+3y=2 and 2x+3y=4 parallel?

Answers

Answer:

Yes.

Step-by-step explanation:

Since the coefficients of x and y, respectively, are equal, the answer is yes. These two lines are two different parallel lines with the same slope and different y-intercepts.

Answer:

2x+3y=2--------(1)

2x+3y=4----------(2)

|d|=|C2-C1|/SQ.RT A SQ.+B SQ.

=4-2/RT.4+9

=2/RT.13 UNITS

What is (3 - 3i)(-5 - 4) in the form a + bi?​

Answers

Answer:

Hey

Step-by-step explanation:

Answer:

-27+27i

Step-by-step explanation:

you are trying to simplify this and have to follow pemdas and rearrange it into a+bi form

What is the slope of a line that passes through the points
(-2, -7) and (-6, -2)?

Answers

Hope this will help u...

Look at the attached picture

simplify. Write the answer with positive exponents. (3x^4y^5) / (21xy^5) (14x^3y^3)/(2xy^8) someone help please

Answers

answer:
x^5/y^5

explanation:
3x^4y^5/21xy^5•14x^3y^3/2xy^8

x^3/7•7x^2/y^5

x^3•x^2/y^5

x^5/y^5

What is the minimum amount of information you need in
order to calculate the slope of a line?
A. The x and y intercepts of the line.
B. Any two points along the line.
C. The length of the line.
D. The endpoints of the line,
NEED THIS BY TODAY PLZZZZ!!!!! BE SURE OF YOU ANSWER​

Answers

To calculate the slope of a line we require any two points along the line.

Explanation:

suppose two points are given that is (x1,y1) (x2, y2) . The equation of a line is  y-y1=m(x-x1) , where m is referred to as the slope of the line .

To find m,

m= y2-y1/x2-x1 . Hence this way of finding slope is known as point- slope form. Another form is there known as slope- intercept form

y=mx+c.

But to find a slope , minimum amount of information that we require is points along the line.

Final answer:

To calculate the slope of a line, only two points on the line are needed. Slope is computed as the difference in y-coordinates divided by the difference in x-coordinates of these points.

Explanation:

To calculate the slope of a line, the minimum amount of information needed is any two points along the line. The slope is the rate of change between two points on a line and can be calculated using the formula slope (m) = (Y₂ - Y₁) / (X₂ - X₁), where Y₂ and Y₁ are the y-coordinates and X₂ and X₁ are the x-coordinates of the two points. It is not necessary to know the length of the line, the endpoints specifically, or the x and y intercepts separately.

The slope-intercept form of a linear equation, y = mx + b, shows that m is the slope and b is the y-intercept. Here, the y-intercept is simply the point where the line crosses the y-axis, but it is not required for calculating the slope when you have two points on the line.

Given: F(x) = 2x - 1; G(x) = 3x + 2; H(x) = x2
Find F{G[H(2)]}

Answers

Answer:

Step-by-step explanation:

hello :

Given: F(x) = 2x - 1; G(x) = 3x + 2; H(x) = x2

Find F{G[H(2)]}

calculate : H(2) =2² =4

G[H(2)] =G[4]= 3(4)+2 =14

F{G[H(2)]} = F{14}=2(14) =28

if it takes 20 farmers 36 days to harvest their fruits, how long would it take 30 farmers to harvest the same amount of fruit ?

Answers

Answer:

24  days

Step-by-step explanation:

the information we have is:

Farmers         Days

   20         ⇒       36

   30         ⇒       x

the table describes that 20 farmers harvest the fruits in 36 days, and the x represents the quantity of days that will take 30 farmers to harvest the fruits.

since the amount of farmers and the amount of days are inversely proportional (if we have more farmers they will need less days, and the other way around) we use the inverse rule of three to solve this problem: multiply the quantities at the top of the table (20 and 36) and divide the result by the remaining amount (30).

we get the following:

x = 20 * 36 / 30

x = 720 / 30

x = 24

It will take 24 days for the 30 farmers to harvest the same amount of fruit

Greg sells magazine subscriptions. He earns $.50 for every subscription he sells. He sold 200 magazine subscriptions. How much money did he earn?

Answers

Answer:

100 dollars 0.50x200=100

Step-by-step explanation:

Answer:

He made 100 dollars

Step-by-step explanation:

If he makes half a dollar for every one sold, and he sold 200, then you just do 200 times .50 and you get 100

A 45 foot ladder is leaning against a building. The foot of the ladder is positioned 10 feet from the base of the building. Determine the angle at which the ladder meets the ground

Answers

The angle at which the ladder meets the ground is 77.17 degree

Solution:

Given that,

A 45 foot ladder is leaning against a building

The foot of the ladder is positioned 10 feet from the base of the building

The figure is attached below

Let,

AB = foot of the ladder from the base of the building

AB = 10 feet

AC = length of ladder

AC = 45 feet

Then by definition of cos,

[tex]cos\ \theta = \frac{AB}{AC} \\\\cos\ \theta = \frac{10}{45}\\\\\theta = cos^{-1} 0.222 \\\\\theta = 77.17[/tex]

Thus, the angle at which the ladder meets the ground is 77.17 degree

Other Questions
Jana made a table to help her review the types of mutations for an exam. She started with the sequence THE MAN SAT TALL. Which statement best describes Janas error in the table? The insertion sequence should be the deletion sequence. The substitution sequence should be the insertion sequence. The insertion and deletion sequences should be switched. The substitution and deletion sequences should be switched. This group was formed in the Georgia General Assembly in 1960 for the purpose of gathering public reaction to Federal orders to integrate public schools within the state. From the Khan Academy Video on Impact of Media Evolution on Politics (Slide #2), what example of early newspapers influenced the ratification (passing) of our US Constitution? (Hint: we learned this earlier in the yearwhat group believed in a Strong Central Government?) What are the three domains of life?Plantae, Animalia, and Fungiclass, kingdom, and phylumEubacteria, family, and EukaryaBacteria, Archaea, and Eukarya 5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand The Confederacy held captured Union soldiers in a military prison located in As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes.