Which quotation is an example of pathos

Answers

Answer 1

Answer:

political speeches

Explanation:


Related Questions

What ruin Doolittle's life?

Answers

Answer: What does Higgins do to ruin Doolittle's life calls Doolittle England's most original moralist to an American millionaire gives him a great deal of money in exchange for his daughter gives him a guilty conscience as to how he has raised his daughter.

Explanation:

The author most likely included the information about the principal’s and teachers’ reactions in order to

Answers

Answer:

Entertain the reader I think

Explanation:

Below is supposed to be the passage:

It would be rather fun for a change, Millicent mused, getting her books out of her locker in the hall, rather exciting to be part of a closely knit group, the exclusive set at Lansing High. Of course, it wasn't a school organization. In fact, the principal, Mr. Cranton, wanted to do away with initiation week altogether, because he thought it was undemocratic and disturbed the routine of school work. But there wasn't really anything he could do about it. Sure, the girls had to come to school for five days without any lipstick on and without curling their hair, and of course everybody noticed them, but what could the teachers do?

The answer is The author most likely included the information about the principal's and teachers' reactions in order to introduce another character vs. society conflict.

How are satellite radio, Internet radio, and podcasting different?

Answers

Answer:

Satellite radio is live, as Internet radio is pre-made(not live), and podcasting is the same as a television sow just as audio, so its discretionary.

Explanation:

In this passage from hamlet, act IV, scene VII, king claudius tells laertes why he is not taking action against polonius’s muderer. Which line conveys the idea that the danish people love hamlet and that accusing him of murder would generate bad public opinion for claudius?

Answers

Answer:

" ... Why to a public count I might not go. Is the great love the general gender bear him. Who, dipping all his faults in their affection ... "

Not verbatim, but that part is the answer. I got it correct on Plato, if you're concerned about that.

Answer:

Is the great love the general gender bear him;

Who, dipping all his faults in their affection,

Work, like the spring that turneth wood to stone,

Explanation:

This is the correct answer on plato :D

Marvins grandfather doted on him because he was his only grandson he loved spending time with Marvin

What does doted mean in this context?

A: to be related

B:to be show appreciation

C: to show a lot of attention

D: to be respectful

Answers

Answer:

c

Explanation:

he was the only one to spend time with him

In this context, "doted" means the grandfather showered Marvin with affection, attention, and care, emphasizing the strong emotional bond between them due to Marvin being the only grandson. Here option C is correct.

In this context, "doted" means that Marvin's grandfather showered him with a great deal of affection, attention, and care. The grandfather had a strong fondness for Marvin and enjoyed spending quality time with him.

This affectionate and attentive behavior likely stemmed from the fact that Marvin was his only grandson, making him particularly special and cherished in the eyes of his grandfather.

This close bond between Marvin and his grandfather suggests a strong emotional connection and a desire to nurture and care for Marvin. Overall, "doting" in this context indicates a deep and loving relationship characterized by a high level of attention and affection from the grandfather towards Marvin. Here option C is correct.

To learn more about Marvin

https://brainly.com/question/26870667

#SPJ3

A minority is powerless while it conforms to the majority; it is not even a minority then; but it is irresistible when it clogs by its whole weight. If the alternative is to keep all just men in prison, or give up war and slavery, the State will not hesitate which to choose. If a thousand men were not to pay their tax bills this year, that would not be a violent and bloody measure, as it would be to pay them, and enable the State to commit violence and shed innocent blood.

— “Civil Disobedience,”
Henry David Thoreau

According to Thoreau, how can a minority exercise power?

by following the laws that the majority agree upon

by engaging in violent conflict when necessary
by protesting as a group in a nonviolent way

by ensuring that just people are not imprisoned

Answers

Answer:

by protesting as a group in a nonviolent way.

Explanation:

According to Thoreau in the text, protesting as a group in a nonviolent way is how a minority can exercise power.

The correct answer is by protesting as a group in a not violent.

Meaning of the passage

He is voicing his opposition to slavery in this passage.He claims that the State would rather imprison innocent people than abolish slavery.*He also discusses how a minority that submits to the majority is powerless; by this, he implies that if you are unwilling to take action against something you disagree with, you are no better than those who support it.A good and moral guy should at the very least refuse to support the government if they are not going to improve.

What is power minority?

A dominating minority, also known as an elite dominance, is a minority group that dominates politics, the economy, or culture in a nation despite making up a negligible portion of the total population (a demographic minority). If they are recent immigrants, dominant minorities are also referred to as alien elites.

Read more about minority on:https://brainly.com/question/3711073

#SPJ2

HELP PLEASE

Refer to Explorations in Literature for a complete version of this story.

Read this excerpt from “The Pit and The Pendulum” by Edgar Allan Poe.

At length, with a wild desperation at heart, I quickly unclosed my eyes. My worst thoughts, then, were confirmed. The blackness of eternal night encompassed me. I struggled for breath. The intensity of the darkness seemed to oppress and stifle me.

How does the first-person point of view most affect the meaning of the text?


A It explains exactly how the narrator feels about the pitch dark, and it allows the reader to share that fear.

B It shows the narrator to be unflappable and strong despite the danger, and it forces the reader to admire him.

C It demonstrates the narrator's confusion over the reality of his situation and suggests to the reader that the narrator is unreliable.

D It provides insight into the narrator’s deep fear of the dark and shows his great capacity to overcome that fear.










Answers

Final answer:

The first-person point of view in “The Pit and The Pendulum” effectively conveys the narrator’s fear of the darkness, allowing readers to share in this experience.

Explanation:

The first-person point of view in the excerpt from “The Pit and The Pendulum” by Edgar Allan Poe most affects the meaning of the text by allowing readers to fully engage with and share in the narrator's experiences and emotions, specifically fear. Answer A is correct: It explains exactly how the narrator feels about the pitch dark, and it allows the reader to share that fear. The intense first-person narrative style enables readers to feel the narrator’s suffocating terror, as the darkness is described as oppressive and stifling. Furthermore, this perspective contributes to a profound sense of confinement and anxiety, drawing the reader into the same feeling of despair.

Select the correct answer.
In "Everyday Use" by Alice Walker, what is the most likely reason that Dee takes pictures of her mother and Maggie when she first arrives at the
house?
A.
Dee has distanced herself so much from her mother and Maggie that seeing their house was like seeing an exhibit in a
museum
B. Dee was intent on recreating every aspect of her mother and Maggie's house.
OC. Dee does not remember what the house looks like, and she wants to make sure she doesn't forget in the future.
OD. - Dee wants to be able to show her friends pictures of her family and the place where she grew up.

Answers

A.
Dee has distanced herself so much from her mother and Maggie that seeing their house was like seeing an exhibit in a
museum

Answer:

A. Dee has distanced herself so much from her mother and Maggie that seeing their house was like seeing an exhibit in a museum.

Explanation:

In this story, we learn that Maggie and Dee are very different people. While Maggie is traditional and enjoys being close to home, Dee has distanced herself from her family and adopted a very different lifestyle. One of the ways in which we can see this distance is by the fact that Dee takes pictures of her mother and Maggie, as if the two of them were exhibits, and not her family. This can also be seen in the opinion that she has about what should happen to the quilts.

True or false? The Earth is the only planet in our Solar System with a natural satellite.

Answers

Answer:

false

Explanation:

but the moon and sun also have a natural satellite

Answer:

False

Explanation:

Earth is the first planet in the solar system to have one, but almost every other planet has a smaller body revolving around it. Hope this helps!

To understand the values expressed in a myth, what are the best elements in the story for a reader to consider? Check all
that apply
actions
clothing
conflict
diet
motivations
resolution

Answers

Actions, Conflict, Motivations, and Resolution

What does Liana ask Tara during the break

Answers

Answer:

did we have homework??

Answer:

Where she wants to eat

Explanation:

Which word bests create a positive hopeful tone

Answers

Answer: free, real, human

Answer:

I don't see any answer choices... sorry can't help

Explanation:

Based on paragraph 2 of the book review, what does the reviewer
Like about the book Sleeping Upside Down?
A)
The reviewer likes the way the author was able to
provide details from a bat's point of view.
B)
The reviewer likes the reasons the author gives for
Kate not having a pet.
The reviewer likes the interesting human characters
as much as the animal characters.
D)
The reviewer likes the description of the character's
home where the story takes place.

Answers

Answer:

A. the reviewer likes the way the author was able to provide details from a bat's point of view

Explanation:

I hope I'm not wrong sorry if I am though

the parents caused ____ between their children by constantly comparing one to the other (strife, chiding, ruse, embroiling
\)

Answers

Answer:

strife

Explanation:

The story's exposition:

A. is the moment when the audience learns what happens to the
characters.
B. introduces readers to the main characters, setting, and conflict.
c. is the main struggle or problem that causes the events in the story
to progress
D. drives the plot toward the climax.​

Answers

The answer is most likely option A "is the moment when the audience learns what happens to the characters." Exposition is basically background information in a story. This information can be about characters, events, or conflicts which means the answer is option A because it is explaining what has happened to the characters.

Hope this helps.

New York is a city that never sleeps--is this a metaphor

Answers

Answer:

yes

Explanation:

trust me i know

I feel like it is more of a hyperbole than a metaphor because you are not saying New York never sleeps just like when you say “what happens in Vegas stays in Vegas” it is more of a hyperbole than a metaphor.

Is Holden a hero? Is he an anti-hero?

Answers

Holden tends to dream of acting like a hero in certain hypothetical situations, but when push comes to shove, Holden backs down, gets beat up, or avoids the altercation all together.
Final answer:

Holden Caulfield from 'The Catcher in the Rye' can be considered an anti-hero because he lacks traditional heroic qualities but still gains the audience's sympathy through his complex character.

Explanation:

The character of Holden Caulfield from J.D. Salinger's novel 'The Catcher in the Rye' is often subject to analysis regarding his status as a hero or an anti-hero. An anti-hero is a type of protagonist who lacks conventional heroic qualities such as idealism, courage, and morality, but can still elicit sympathy from the audience. In contrast to a traditional hero, who is often characterized by noble actions and virtue, an anti-hero may demonstrate behavior that is less than noble or have flaws that stand in stark contrast to traditional heroism.

Holden displays characteristics that align with those of an anti-hero. He often lies, exhibits cynical views, and flouts social norms, which differentiates him from the archetype of a classic hero. Despite this, readers often sympathize with his inner turmoil, his deep desire to protect the innocence of children, and his disdain for the 'phoniness' he perceives in the adult world. These complexities in Holden's character make him overall more relatable to readers, who may identify with his rebellion against societal expectations and his struggle to find his place in the world.

Enriquez plans to research the topic of air pollution. Based on the topic , what is the strongest research question ?

Answers

what place has the strongest amount of air pollution? (answer is probably asia) and how did this problem come about?

Write a brief definition for these three literary terms and describe the relationship between them: setting, plot, characterizations.

Answers

the setting of a story is the location it takes place.
the plot of a story is the series of events that make it up.
characterizations are the character/personality traits that make up the personality of a character.
They relate to each other because all three of these things are necessary to create a story.

Answer:

the setting of a story is the location it takes place. the plot of a story is the series of events that make it up. characterizations are the character/personality traits that make up the personality of a character. They relate to each other because all three of these things are necessary to create a story.

Explanation:

Words like "inspirational, mysterious, cheerful," that influence the way the reader feels about the poem, are examples of what type of poetic device?
Alliteration
Symbolism
Tone
Mood

Answers

Mood, Tone, and Symbolism.

Hope this helped!

__________ are especially risky in combination with other drugs because they affect the body's ability to process other chemicals.


A. Barbiturates

B. Amphetamines

C. Antihistamines

D. None of the above

Answers

Final answer:

Barbiturates are especially risky when combined with other CNS depressants because they can multiply the effects of these drugs, leading to severe respiratory depression or even death.

Explanation:

Barbiturates are especially risky in combination with other drugs because they affect the body's ability to process other chemicals. Barbiturates, when taken in overdose with other central nervous system (CNS) depressants like alcohol, opiates, or benzodiazepines, can lead to significantly more dangerous outcomes due to their additive CNS and respiratory depressant effects. Furthermore, barbiturates increase the binding affinity of the benzodiazepine binding site, causing exaggerated effects of benzodiazepines. The effect of this combination is not simply additive; it's multiplicative, leading to a potentially severe reduction in respiration, decreased heart rate, coma, or even death.

Depressants as a class, which include alcohol, barbiturates, benzodiazepines, and toxic inhalants, are known to reduce the activity of the CNS and are prescribed for conditions such as pain relief, reduction of heart rate and respiration, and as anticonvulsants. These substances have a low safety index and can cause permanent brain damage if misused. It's crucial to understand the risks associated with mixing depressants and the potential for synergistic effects leading to serious health consequences.

Which detail supports this theme shared by "Kaddo's Wall" and "The Magic Prison"? If you are selfish, you may find yourself alone when you need others the most. "They used wet dough for mortar to hold the bricks together, and slowly the wall grew." "'The corn is mine. It is my surplus. I can't eat it all. It comes from my own fields. I am rich.'" “'You must be hungry, too, poor little thing!' he said." "The next day he was so hungry that he began to eat one of the old withered apples, and as he bit it he thought of the bird, his fellow prisoner."

Answers

Answer:

Prince Harweda had no sooner set his foot inside the small rose-colored palace than the iron door shut with a bang and locked itself.If you are selfish you may find your self alone and without help.If we ask for too much, we may lose what we have.Happiness comes when you are content with life as it is.

Explanation:

Answer:

"The corn is mine. It is my surplus. I can't eat it all. It comes from my own fields. I am rich."

Hope this helps!!

-Agarvated

PLEASE HELP ME


6) Type the following sentence and add parentheses or brackets where needed. Use exact spelling and correct spacing. Add any necessary punctuation marks for clarity.



The first game to be held in the new gym is against Rocky Point High School.



7) Read the passage below (taken from "The Struggle for an Education." Washington, Booker T. 1901. Up From Slavery) Select the passage that uses ellipses correctly.

One day, while at work in the coal-mine, I happened to overhear two miners talking about a great school for coloured people somewhere in Virginia. This was the first time that I had ever heard anything about any kind of school or college that was more pretentious than that little coloured school in our town.



One day, I happened to overhear two miners talking about a great school for coloured people. . . This was the first time that I had ever heard anything about any kind of school or college. . . .


One day, . . . I happened to overhear two miners talking about a great school for coloured people. This was the first time that I had ever heard anything about any kind of school or college. . . .


One day, . . . I happened to overhear two miners talking about a great school for coloured people. . . . This was the first time that I had ever heard anything about any kind of school or college. . . .


One day, . . . I happened to overhear two miners talking about a great school for coloured people. . . . This was the first time that I had ever heard anything about any kind of school or college.

Answers

Answer:

The first game to be held (in the new gym) is against Rocky and Point high school

Explanation:

One day, I happened to overhear two miners talking about a great school for coloured people. . . This was the first time that I had ever heard anything about any kind of school or college. . . .Above selected paragraph is used to show the correct use of ellipses as a form of punctuation . As a Literal work , author uses the ellipses for both dramatic and aesthetic value.In dramatic technique, the ellipses have been used to show the new discovery made by narrator in view of education among the coloured  which comes at the end of each sentences .Aesthetic value, the marks show the beauty in the statement as it appeal to our senses more importantly to substantiate the aesthetic ideal of a literal work

Using Punctuation
Warm-Up Active
6
Punctuation and Meaning
The sentence below uses no internal punctuation which interpretation best reflects your understanding of what the
sentence means?
Claire Jackson and Lena ordered fruit salad and iced tea at the café
Two people (Claire Jackson and Lena) ordered two items (fruit salad and iced tea).
Two people (Claire Jackson and Lena) ordered three items (fruit salad and iced tea).
Three people (Claire, Jackson, and Lena) ordered two items (fruit salad and iced tea)
Three people (Claire. Jackson, and Lena) ordered three items (fruit, salad, and iced tea).

Answers

A. Two people ordered two items

Explanation:

Since there are no commas between Claire Jackson and Lena, there are only two people. Claire Jackson being one, Lena being the other.

There are also no commas between fruit salad and iced tea. This means there are only two items. Fruit salad being one and iced tea being the other.

The sentence that best reflects the understanding of the sentence means Two people (Claire Jackson and Lena) ordered two items (fruit salad and Iced tea). The correct option is a.

What is a sentence?

A sentence can be understood as a linguistic expression In traditional grammar it is typically defined as a string of words that expresses a complete thought, or as a unit consisting of a subject and predicate.

In non-functional linguistics, it is typically defined as a maximal unit of syntactic structure such as a constituent. In functional linguistics, it is defined as a unit of written texts delimited by graphological features such as upper-case letters and markers such as periods, question marks, and exclamation marks. This notion contrasts with a curve, which is delimited by phonologic features such as pitch and loudness and markers such as pauses; and with a clause, which is a sequence of words that represents some process going on throughout time.

A sentence can include words grouped meaningfully to express a statement, question, exclamation, request, command, or suggestion.

Learn more about sentence, here:

https://brainly.com/question/16890064

#SPJ6

1_Select the word or group of words that is the subject of the following sentence. Julia and her friend will meet us at the theater. a. At the theater b. Julia c. Julia and her friend


2_Select the group of words that is a prepositional phrase in the following sentence.

Everyone agreed to the plan.
a. Everyone agreed
b. To the plan
c. The plan




3_Select the group of words that is a prepositional phrase in the following sentence.

Paolo hid his savings in a locked box, but he foolishly lost the key.
a. Hid his savings
b. But he foolishly lost the key
c. In a locked box


4_Select the group of words that is NOT a prepositional phrase in the following sentence.

There were delegates from Denmark, Norway, and Sweden at the convention.
a. There were delegates
b. At the convention
c. From Denmark, Norway, and Sweden



5-Select the word or group of words that is the complete verb in the following sentence.

The parakeet is chirping loudly from the cage.
a. Parakeet
b. Is chirping
c. Cage



6_Select the word that is the complete verb in the following sentence.

Rafael joined us without saying a word.
a. Saying
b. Rafael
c. Joined



7_Select the word or group of words that is the complete verb in the following sentence.

Sarah might have forgotten to pick me up from work.
a. Forgotten
b. Might have forgotten
c. Might



8_Select the word or group of words that is the complete verb in the following sentence.

He could answer all the questions easily.
a. Easily
b. He could
c. Could answer

Answers

Answer:

The correct answers are: 1)c, 2)b, 3)c, 4)a, 5)b, 6)a, 7)b, 8)c

Explanation:

1)c: Julia and her friend are the group of words that is the subject of the sentence because they are both "in charge" of the action (will meet us at the theater). "At the theater" is an adverb of place (it tells where the action will take place).

2)b: To the plan is the group of words that is a prepositional phrase because it is the one that starts with a preposition ("to")

3)c: In a locked box is the group of words that is a prepositional phrase (serving as an adverb of place) because it is the only phrase that starts with a preposition ("in")

4)a: There were delegates is the group of words that is NOT a prepositional phrase because there is no preposition here. The preposition in b) is "at" and in c) is "from"

5)b: Is chirping is the group of words that is the complete verb because the main verb "chirping" is accompanied by the auxiliary "is".

6)a: Joined is the complete verb in the sentence although there are no auxiliaries. "without saying a word" is an adverb of manner (tells us how the action is performed)

7)b: Might have forgotten is the complete verb in this sentence. "Forgotten" is the main verb, "Might" is a modal verb (of possibility) and "have" an auxiliary".

8)c: Could answer is the group of words that is the complete verb. "Answer" is the main verb and could is a modal verb (of ability)

1. Julia is the subject of the following sentence. Thus, option B is the correct option.

2. To the plan: is a prepositional phrase in the following sentence. Thus, option B is the correct option.

3. In a locked box: is a prepositional phrase in the following sentence. Thus, option C is the correct option.

4. There were delegates: this is not a prepositional phrase in the following sentence. Thus, option A is the correct option.

5. Is chirping: is the complete verb in the following sentence. Thus, option B is the correct option.

6. Joined: is the complete verb in the following sentence. Thus, option C is the correct option.

7. Might have forgotten: is the complete verb in the following sentence. Thus, option B is the correct option.

8. Could answer: is the complete verb in the following sentence. Thus, option C is the correct option.

1. "Julia and her friend" is the subject of the sentence. It is the group of words that performs the action of meeting.

2. "To the plan" is a prepositional phrase that provides additional information about the action of agreeing. It answers the question "Agreed to what?"

3. "In a locked box" is a prepositional phrase that describes where Paolo hid his savings. It provides location information.

4. "There were delegates" is the subject of the sentence. The phrase "from Denmark, Norway, and Sweden at the convention" is a prepositional phrase that provides additional information about the delegates.

5. "Is chirping" is the complete verb in the sentence. It indicates the action that the parakeet is performing.

6. "Joined" is the complete verb in the sentence. It represents the action that Rafael performed.

7. "Might have forgotten" is the complete verb in the sentence. It describes the possibility of Sarah forgetting to pick someone up.

8. "Could answer" is the complete verb in the sentence. It indicates the capability of answering questions.

Learn more about verb here:

https://brainly.com/question/1946818

#SPJ3

King uses this allusion to

Answers

Answer:

King uses this allusion to emphasize the morality of his cause

Explanation:

My First Day on the Job

The complicating incident is when the narrator’s editor has a family emergency.

Which event is a result of the complicating incident?


A The narrator decides that journalism is the right career for her.

B The narrator learns a great deal about journalism over the next few months.

C The narrator needs to do all her reporting, as well as write her story, in one day.

D The narrator must complete her first news story without much guidance.

Answers

Answer:

D because the narrator must complete her first news story without much guidance.

The narrator must complete her first news story without much guidance. This event is a result of the complicating incident.

What is the meaning of Complicating Incident?

Complicating incident is the event or set of events involving one or more types of conflict occurs.

What is the another word of Incident?

Another word of incident are:

FactHappeningCircumstanceEpisode

Hence, the correct answer is Option D.

Learn more about complicating incident on https://brainly.com/question/1910366

#SPJ2

With no dredging, Central Park's ponds and reservoir have
been reincarnated as marshes. Without natural grazers -
unless horses used by hansom cabs and by park
policemen managed to go feral and breed - Central Park's
grass is gone. A maturing forest is in its place, radiating
down former streets and invading empty foundations.
Which best explains how the structure of this passage supports the author's
purpose?
O
A. The passage shows the effects of human activity on Central Park
to prove that laws protecting the environment are necessary for
human survival

B. The passage describes how the absence of human activity will
change Central Park to show that nature will eventually destroy
what people have built.

C. The passage compares the Central Park from before and from
during a posthuman world to underscore that pollution levels will
remain the same.

D. The passage traces several events in the order that they will occur
to highlight how people have harmed the environment in Central
Park

Answers

What best explains the structure of the writer's purpose is:

"B. This section explains how the absence of human activity will change Central Park to show that nature will ultimately destroy what people have built."

Further explanation

The author made the paragraph aims to sensitize human activity in the central park, wherein the text section is explained how the condition of the central park before and after it was built by humans.

Learn more

about the structure of this section supporting the author https://brainly.com/question/10877313, https://brainly.com/question/11497286

Details

Class: Middle School

Subject: English

Keywords: paragraph structure

Final answer:

Option B is the correct choice, explaining how the passage illustrates the effects of nature reclaiming Central Park in the absence of human activity, showcasing the natural succession and restoration.

Explanation:

The structure of the passage supports the author's purpose by describing the transformation of Central Park in a scenario devoid of human activity, illustrating the power and resilience of nature. Option B is the best explanation, as the passage details a natural succession taking place: where once there were ponds, marshes now grow; without the maintenance of grass by humans, forests arise. This indicates a rewilding process, highlighting nature's ability to reclaim and restore environments when human influence wanes, rather than pointing to a direct harm from pollution or a call for environmental laws as other options suggest.

What quotations are evidence of the claim that the Constitution was not written to assert the rights of white people only? Check all that apply.
“the Constitution was made exclusively by and for the white race”
“It has already been shown that in five of the thirteen original States”
“colored persons then possessed the elective franchise”
“that it was made exclusively for the white race is . . . contradicted by its opening declaration”
“free colored persons were then citizens of at least five States”

Answers

colored people then possessed the elective franchise

Hi,

The answer is C, D and E

“colored persons then possessed the elective franchise”

“that it was made exclusively for the white race is . . . contradicted by its opening declaration”

“free colored persons were then citizens of at least five States”

Hope this Helped,

Letizia

1. PART A: Which statement best expresses
the central idea of the text?
A. People have different dreams for different
reasons, making it difficult for scientists to
answer the question "why do humans dream?"
B.
Most of the theories that scientists have about
dreams show their benefits; however, there
are no concrete conclusions for why humans
dream.
C. Scientists struggle to understand why people
dream as there is currently no way to see what
goes on in the brain when someone sleeps.
D.
Since humans are the only creatures that
dream, scientists believe that dreaming is an
important part of humans' advanced
intelligence.

Answers

Answer:

B.  Most of the theories that scientists have about  dreams show their benefits; however, there  are no concrete conclusions for why humans  dream.

Explanation:

A lot  of what scientists think about dreams is just theorizing.

This sentence in the text shows that the theories on why we dream remain pure guesses and that there are no clear arguments to support these statements.

Scientists agree that dreams can have many benefits.

Dreams have proven to help people solve complex problems, provide inspiration, but unfortunately the deeper meaning as for why we dream remains unknown.

Final answer:

Without the actual text, it's hard to definitively choose the correct answer, but from the given options, choice B appears most accurate as it states theories recognize dreams' benefits, despite the unknowns. The central idea should reflect the text's main points.

Explanation:

The question asks to identify the central idea of an unspecified text regarding the scientific understanding of dreams. It's challenging to choose a correct option without the context of the original text. However, presuming the outlined information, choice B,

'Most of the theories that scientists have about dreams show their benefits; however, there are no concrete conclusions for why humans dream.'

seems a reliable statement. This concludes that while there is appreciation for dreaming's potential benefits, scientists have yet to establish a firm rationale for dream occurrence. Remember, the central idea of a text should be a comprehensive and objective summary of its entire content.

Learn more about Central Idea of a Text here:

https://brainly.com/question/1914190

#SPJ3

Other Questions
An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph? Consider a river flowing toward a lake at an average velocity of 3 m/s at a rate of 500m3/sat a location 90 m above the lake surface. Determine the total mechanical energy of the river water per unit mass and the power generation potential of the entire river at that location. Angelo made the decision to outsource the software components of his consulting company so he could focus on the companys ________, which are sources of competitive advantage, make a contribution to perceived customer benefits, have application in a wide variety of markets, and are difficult to imitate. Food web starting with sun and pointing to grasshopper and squirrel; Grasshopper pointing to squirrel, wolf, and snake; squirrel pointing to wolf, snake, and bird; wolf pointing to decomposition with worms and mushrooms; snake pointing to wolf and decomposition with worms and mushrooms; bird pointing to decomposition with worms and mushrooms; decomposition pointing to the sun stating soil nutrients.If we removed the decomposers from this food web, how would it affect the balance of the ecosystem? There would be an increase in dead matter and a lack of nutrients in the soil. There would be a decrease in dead matter and a lack of nutrients in the soil. There would be an increase in dead matter and an increase in nutrients in the soil. There would be a decrease in dead matter and an increase in nutrients in the soil. Which of the following would NOT be considered an investment in human capital?Aobtaining a college degreeBpurchasing a new computerCattending a first-aid classDpaying for cooking lessons For a class Foo, one difference between a variable declared Foo * and a variable declared Foo & is that only the variable declared Foo & can potentially have the value NULL.Select one:a. FALSEb. TRUE how do chemicals affect our lives? what is the region of very calm seas and little to no wind on either side of equator? Which was not one of the major disagreements that the framers faced at the Constitutional Convention?The process for adding future states to the union.Balancing the power of the large and small states.Balancing the power between the state governments and the federal government.What should be done about slavery. A construction company has built 30 houses so far this year at a total cost to the company of $7.5 million. If the company builds a 31st house, its total cost will increase to $7.76 million. Which of the following statements is correct?a. For the first 30 houses, the average cost per house was $250,000.b. The marginal cost of the 31st house, if it is built, will be $260,000.c. If the company can experience a marginal benefit of $275,000 by building the 31st house, then the company should build it.d. All of the above are correct. Adriana is a member of a culture that does not believe in birth control, but she recognizes that another culture has the right to decide about birth control because they are different. What is this an example of? At what distance from a long straight wire carrying acurrentof 5.0A is the magnitude of the magnetic field due to thewireequal to the strength of the Earth's magnetic field of about5.0 x10^-5 T? An object, initially at rest, moves with a constant acceleration of 10 m/s2. How far will it travel in (a) 2.0 s and (b) 4.0 s? If this object had an initial velocity of 4 m/s, how far will it travel in (C) 2.0 s and (d) 4.0 s? Glucose is a carbohydrate that contains carbon, hydrogen, and oxygen. The empirical formula of glucose is CH2O and its molar mass is 180.12 g/mol. Find the molecular formula of glucose. If the molality of a NaBr(aq) solution is 2.50 m, what is the weight percent of NaBr? The molar mass of NaBr is 1029 g/mol 20.5% 25.0% 25.7% 34.6% 65.4% ent Navigator J K L