Which two words are synonyms of the word protest? strike snarl march pry jump

Answers

Answer 1

Answer:

Strike and March

Answer 2

Answer:

The answer is STRIKE AND MARCH because them are the two words that are a synonyms HOPE this Helps!!

Explanation:


Related Questions

Which term best describes the type of work done by a postindustrial
community?
O
A. Administration
O
B. Hunting and gathering
O
C. Agriculture
O
D. Industry

Answers

Answer:

D

Explanation:

because postindustrial don't do any of the other's

The life expectancy of smokers will equal that of non-smokers after ____ years after quitting.
a. 1 to 5
b. 5 to 10
c. 10 to 15
d. 15 to 20
e. 20 to 25

Answers

Life expectancy for smokers is at least 10 years shorter than that of non-smokers. Quitting smoking before the age of 40 reduces the risk of dying from smoking-related disease by about 90%.

PLEASE I WILL GIV YOU BARLIEST is there any scienific proof or evidence behind the brain of a person who identfies as aroantic

Answers

Answer:

I'm petty sure there is but I'm not sure. Just tryin' to be helpful. Rlly hope this helps you.

There are approximately 1386 million cubic kilometers (km^3) of water on earth. Approximately how much of that total is fresh groundwater?

A. 1251558

B. 12515580

C. 28565460

D. 125155800

Answers

Answer:

b

Explanation:

well i cant clearly explain but my calculations add up to that

1. Ludwig Bump runs the bank in Mathsville. You have to help him, though, because he has

forgotten the combination number of the safe. Fortunately, he does remember some things

about the number which may help you to help him.

• The number has four digits (eg. 1234 or 9876).

• All the digits are different.

• It begins and ends with an odd number and has two even numbers in the middle.

· 19 and 519 go into it exactly

Answers

Answer:

9861

Explanation:

The last clue indicates that the solution is 19*519 = 9861. This value also satisfies the other clues, that is, it has four digits, all digits are different, it begins and ends with an odd number (9 and 1) and has two even numbers in the middle (8 and 6).

help me please 18w^2 - 27w. ?

Answers

Answer: 9w(2w-3)

Explanation:

Factor:

18w^2−27w      

9x2=18

9x3=27

=   9w(2w−3)

9w(2w-3) is the answer

Which of the following is air that moves from regions of high pressure to regions of low pressure?
Orain
wind
snow
clouds

Answers

Clouds, correct me if I’m wrong, sorry

When you can tell how a person feels based on the person's facial expression, which of the four components of emotional intelligence

propagated by Mayer and Salovey comes into play?

A understanding emotions

B. perceiving emotions

C managing emotions

D. using emotions

Answers

Answer:

perceiving emotions

Explanation: got it right on my test!

On the basis of the person's facial expression, you can tell how a person feels by perceiving their emotions. Thus, the correct option for this question is B.

What are the four components of emotional intelligence?

The four components of emotional intelligence are as follows;

Self-awareness.Self-management.Social awareness.Relational management.

Apart from this emotional intelligence, some other components are also essential in determining the feeling of an individual. They may include empathy, motivation, social skills, etc.

Among the given four components of emotional intelligence, you can definitely tell the feeling of an individual by analyzing their facial expression through the perception of their thoughts, emotions, ideas, etc.

Therefore, you can tell how a person feels by perceiving their emotions. Thus, the correct option for this question is B.

To learn more about Emotional intelligence, refer to the link:

https://brainly.com/question/7905042

#SPJ5

Why is Salt dissolved in water and pepper oil used instead of regular salt and pepper?

Answers

Answer: Because the way salt is a fine grain so it will blend with the water

Explanation:

Salt dissolved in water and pepper oil is used  because regular salt and pepper can get lost in a space station

Although your question is incomplete this is the complete question :

Why is Salt dissolved in water and pepper oil used instead of regular salt and pepper in space ?

In space, Astronauts make use of salt dissolved in water and pepper oil when preparing a meal in a space station, and this because salt and pepper in their natural form can get lost in a space station.

Regular salt and pepper lost in a space station can get stuck in any equipment found in the space station which might lead to some level of damage.  

Hence salt dissolved in water and pepper oil is used in space rather than regular salt and pepper .

learn more : https://brainly.com/question/2973933

Tom scored 200 on a test with a mean of 150 and a standard deviation of 25. What is Toms z score and percentile?

Answers

Answer:

Z score is 2.0

In normal distribution Percentile is

97. 72% Left tailed

2.28% Right tailed

Explanation:

Z score is = (score - mean) / SD

Z = (200-150)/25=50/25=2

The value of Tom's z-score and percentile are;

Z-score = 2

Percentile = 97.725th percentile.

We are given;

score; x' = 200

Mean score; μ = 150

Standard deviation; σ = 25

Formula for z-score here is;

z = (x' - μ)/σ

z = (200 - 150)/25

z = 2

From p-value from z-score calculator, the percentile of a z-score of 2 is 0.97725 or 97.725th percentile.

Read more about z-score at; https://brainly.com/question/25638875

100 Points [Calculus] Finding Power Series. An explanation would be greatly appreciated. See attached image.

Answers

It’s the third option. Also look at the explanation

Answer:

[tex]\textsf{C)}\quad \displaystyle 2\sum^{\infty}_{n=0} \dfrac{x^{2n+1}}{(2n+1)!}[/tex]

Explanation:

The series expansions for [tex]e^x[/tex] and [tex]e^{-x}[/tex] are:

[tex]\displaystyle e^x = \sum_{n=0}^{\infty} \frac{x^n}{n!}=1 + x + \frac{x^2}{2!} + \frac{x^3}{3!} + \frac{x^4}{4!}+ \cdots \\\\\\\\e^{-x} = \sum_{n=0}^{\infty} \frac{(-x)^n}{n!}=1 - x + \frac{x^2}{2!} - \frac{x^3}{3!} + \frac{x^4}{4!}- \cdots[/tex]

Therefore:

[tex]\displaystyle e^x -e^{-x} = \left(1 + x + \frac{x^2}{2!} + \frac{x^3}{3!} + \frac{x^4}{4!} + \cdots\right)-\left(1 - x + \frac{x^2}{2!} - \frac{x^3}{3!} + \frac{x^4}{4!} -\cdots\right)[/tex]

This simplifies to:

[tex]\displaystyle e^x -e^{-x} = \left(x + \frac{x^3}{3!} + \frac{x^5}{5!}+\cdots\right)-\left( - x - \frac{x^3}{3!} -\frac{x^5}{5!} -\cdots\right)[/tex]

[tex]\displaystyle e^x -e^{-x} = \left(x + \frac{x^3}{3!} + \frac{x^5}{5!}+\cdots\right)+\left( x + \frac{x^3}{3!} +\frac{x^5}{5!} +\cdots\right)[/tex]

[tex]\displaystyle e^x -e^{-x} =2 \left(\dfrac{x^1}{1!} + \frac{x^3}{3!} + \frac{x^5}{5!}+\cdots\right)[/tex]

The expression inside the parentheses represents terms where the numerators are x raised to consecutive positive odd numbers, and the denominators are factorials of those odd numbers

A positive odd number can be expressed as 2n + 1, where n is a non-negative integer starting from zero.

So, the numerator of each term in the series can be expressed as [tex]x^{2n+1}[/tex] and the denominator as (2n + 1)!.

Therefore, we can express the power series of [tex]e^x -e^{-x}[/tex] as:

[tex]\displaystyle e^x -e^{-x}=2\sum^{\infty}_{n=0} \dfrac{x^{2n+1}}{(2n+1)!}[/tex]


Michaela has up to $20 to spend on bottled water and orange juice for a group hike. It cost $2
for each bottle of water and $4 for each bottle of orange juice.
a) Write an inequality statement for this situation.

Answers

Answer:

20 > 2w + 4j

Explanation:

It feels as though some of the information is missing. So, based upon the information provided above, this is the best equation I can come up with. The total amount is up to $20 (but not including $20, so it is an inequality, meaning that $20 cannot be used). 20 is greater than the sum of the number of bottles of w (water) multiplied by the $2 (cost of water) and the number of bottles of j (orange juice) multipled by the $4 (cost of the orange juice).  

6. A cell with a diploid chromosome number of 12 divided two times, producing four
cells with six chromosomes each. The process that produced these four cells was
most likely (1.) meiotic cell division (2.) external fertilization
(3.) mitotic cell division (4.) internal fertilization

Answers

Answer:

3

Explanation:

A meiotic cell division is the likely process that produced these four cells.

The Meiosis cell division entails a process that reduce the number of chromosomes in the parent cell by half and produces four gamete cells.

Hence, the meiotic cell division is the likely proces that produced these four cells.

Therefore, the Option A is correct.

Read more about meiotic cell division

brainly.com/question/15475960

_____ is the removal of trees and other organisms so that the land can be converted to another use such as a farm, ranch, or new town. A. Strip mining B. Urbanization C. Deforestation D. Desertification

Answers

Answer:deforestation

Explanation:

Describe an example of a technology or team and technology interaction that you have had in the context

of school or work

Answers

When you have to call ur parents?

Describe one positive and one negative effect of rural to urban migration

Answers

Positive - Rural communities lose human capital, particularly young adults who are attracted to education and job opportunities in urban centers.

Negative - The migrant population tends to be wealthier and better educated than rural populations, but poorer and less educated than urban populations.

Summarizing List the reasons behind what the researcher calls the middle-class squeeze" in regard student loan debt.

Answers

Final answer:

The 'middle-class squeeze' in relation to student loan debt is attributed to flat incomes, rising education costs, higher unemployment rates since the 2008 recession, and a lack of savings compared to past generations.

Explanation:Reasons Behind the 'Middle-Class Squeeze' in Relation to Student Loan Debt

There are several reasons behind what researchers refer to as the 'middle-class squeeze' when it comes to student loan debt. Notably, it is caused by a combination of flat incomes and skyrocketing education costs, which lead to a significant financial burden on students and graduates. This situation is exacerbated by challenging economic factors, such as the increase in unemployment since the 2008 recession, creating fewer job opportunities for recent graduates. This makes the repayment of student loans even more daunting, particularly when starting on entry-level wages.

Moreover, the rising tuition rates force students to take on larger loans, resulting in average debts of $25,250 upon graduation as reported in 2010. The interplay between stagnant wages and increasing costs of living compounds the issue, as American families have less money saved compared to previous generations. The phenomenon of the 'middle-class squeeze' is further supported by indicators such as lower bond returns and a widening gap between lower and middle-class incomes. In effect, the social challenge of student loan debt not only impacts the individual graduates but also affects the broader society.

The middle-class squeeze in relation to student loan debt is due to rising tuition rates, stagnating wages, higher private loan interest rates, and limited governmental support for higher education costs, resulting in financial hardships for graduates.

The term "middle-class squeeze" in relation to student loan debt refers to the financial hardship faced by middle-income earners due to the disparity between stagnant wages and the escalating costs of higher education. This has led to a significant burden of debt on graduates. The reasons behind this include rising tuition rates, the increase of student loan debt, limited government funding, higher interest rates on private loans, and sluggish wage growth.

Research by economist Susan Dynarski points out that while the government provides student loans, the structure of the US loan market involves both public and private sectors. Private loans often carry fewer consumer protections and come with higher interest rates, contributing to financial strain. Additionally, Daniela Senderowicz emphasizes that flat incomes and inflating education expenses lead many students towards financial ruin, though she also highlights activism and community building as potential solutions to manage crippling student debts.

Data from the Levy Economics Institute and various studies, like the Class of 2017 college debt statistics, corroborate the issue, revealing the ongoing trend of indebtedness among graduates which impacts the broader economic participation of the middle class.

Every student in fourth grade at Watson Elementary took a Big Five Personality test the first week of school. Principal Albert
recorded the agreeableness score for each child along with the number of referrals for misconduct. He thinks that rating high on
the agreeableness scale might predict better behavior from students.
What type of graph should he choose to best represent his data?

Answers

Answer: Scatterplot

Explanation: The scatterplot is the appropriate way to graph a correlational set of data to display the direction and strength of a relationship.

Answer:

scatter plot

Explanation:

How do folk and popular cultures differ in the ways they help form a society’s overall culture?

Answers

Answer:

Folk culture and popular culture differ in their patterns of origins,distribution and diffusion. Folk culture is practiced by small homogeneous groups living in isolated rural areas while Popular culture is found in large heterogeneous societies that share certain customs despite differences in other personal characteristics among them.

Explanation:

In terms of the way they are both different from each other, we can explain under the patterns listed i.e origin, distribution and diffusion.

Origin: Customs originate from hearths. Folk customs are often anonymous while popular customs originate in more developed countries as part of the market for recreational and disposable income to purchase these material goods.

Distribution :Popular culture is distributed widely across many countries, with little regard for physical factors while Folk cultures often (though not always) incorporate elements of the local environment of wherever it is being noticed. Groups with relatively little contact with others develop unique folk cultures. Thus, people living in some remote environments tend to have a specific culture related to their environment and quite different from other geographical locations practicing same named culture.  

Diffusion: Popular culture diffuses or mixes (usually hierarchically) through rapid electronic communications and transportation networks while Folk culture diffuses or mixes through relocation diffusion.

What were nazis taught about other races? How do you think this affected the way that they interacted with people that were different form them?

Answers

Nazis were taught that if someone didn’t look a certain way they weren’t aloud to have what they had, children, respect, good food. And since they were taught this way it affected the people around them by scaring them because they thought they were better than everyone else.

does anyone do parkour here

Answers

Answer:

yessir

Explanation:

i am rad

what was the point of view of harry truman doctrine speech

Answers

He stated that United States should provide support to free people who are continuously resisting and showing oppressiveness against outside pressure or armed minorities.

Explanation:

President Harry S Truman provided 18 minute speech before joint session of congress on 12th March 1947.

Truman stated that U.S. should provide all aids (financial/political/military) to nations which are under threat from internal or external forces. Truman Doctrine marked change in U.S. international policy to containment from isolationism. As an immediate effect in 1947, his effort helped Greek and Turkish to fight against communist.

Inorganic mercury is not particularly harmful, but its release into the environment can be hazardous because of a chemical transformation it undergoes into the highly toxic substance known as _______________________________________

Answers

Answer : The kind of substance is probably “Methylmercury.”
Other Questions
Solve for r 12-1/5r=2r+1 What are two causes of soil loss? Jana made a table to help her review the types of mutations for an exam. She started with the sequence THE MAN SAT TALL. Which statement best describes Janas error in the table? The insertion sequence should be the deletion sequence. The substitution sequence should be the insertion sequence. The insertion and deletion sequences should be switched. The substitution and deletion sequences should be switched. This group was formed in the Georgia General Assembly in 1960 for the purpose of gathering public reaction to Federal orders to integrate public schools within the state. From the Khan Academy Video on Impact of Media Evolution on Politics (Slide #2), what example of early newspapers influenced the ratification (passing) of our US Constitution? (Hint: we learned this earlier in the yearwhat group believed in a Strong Central Government?) What are the three domains of life?Plantae, Animalia, and Fungiclass, kingdom, and phylumEubacteria, family, and EukaryaBacteria, Archaea, and Eukarya 5c + cd, c = 1.5 d = 15 11. A wasp lays its eggs on a caterpillar. When the wasp eggs hatch, the larva will eat the caterpillarand kill it. *(2 Points)OA. ParasitismOB. MutualismOC. Commensalism what is the length of bc in the triangle below Research paper assignment Why didnt America help in the French Revolution? Was it justified? What was a characteristic of the rulers of the Zhou dynasty? A photo is printed on a 20-inch by 24-inch piece of paper. The photo covers 320 square inches and has a uniform border. What is the width of the border? At the local airport, you set off the alarm on the magnetometer. If you announce, "Never mind, I don't want to fly today," Can the security officials still detain you and search you for weapons? PLEASE HELP!! DUE TODAY! I GIVE BRAINLIEST Why can a theory never become a law Why do you think Dreiser wrote this piece? What is he attempting to say by writing about his brother? Solve for x. Write both solutions, separatedby a comma.5x2 + 2x - 7 = 0 What causes the trade winds? Read the following paragraph and answer the question below.1Wuthering Heights is in the midst of the desolate English moors. 2Outside the gates of this solitary dwelling, the landscape expands into dreary shades of brown and gray, with only the craggy cliffs on the distant horizon to break the monotony. 3Wildlife and foliage are scarce. 4The few trees that do live must eke out their existence: the north wind blows constantly. 5The house itself, built to withstand the tumults of wind and rain, is cold and forbidding. 6The stone walls and earthen floors offer no relief from the bone-chilling dampness of northern England. 7In sharp contrast to Wuthering Heights is Thrushcross Grange. 8Situated in a sheltered valley, Thrushcross Grange is calm and peaceful, and is surrounded by lush flower gardens. 9The refined elegance of Thrushcross Grange differs as much from Wuthering Heights as the rose differs from the thorn. 10The contrast between these two settings is symbolic of the ultimate conflicts in Emily Bronte's novel Wuthering Heights.Name the shape of the paragraph. __________ .A)regular triangle B)inverted triangle C) diamond D) rectangle Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, that codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3 3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5 promoter terminator Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice. A. Top B. Bottom C. Either can serve as the codong strand D. There isn't enough information to determine which is the coding strand